- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Cui, X.
- Articles by Schnable, P. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Cui, X.
- Articles by Schnable, P. S.
Alternative Transcription Initiation Sites and Polyadenylation Sites Are Recruited During Mu Suppression at the rf2a Locus of Maize
Xiangqin Cui1,a,b, An-Ping Hsiac, Feng Liu2,a,b, Daniel A. Ashlockd, Roger P. Wisea,e,f,g, and Patrick S. Schnablea,b,c,ga Interdepartmental Genetics Program, United States Department of Agriculture-Agricultural Research Service
b Department of Zoology and Genetics, United States Department of Agriculture-Agricultural Research Service
c Department of Agronomy, United States Department of Agriculture-Agricultural Research Service
d Department of Mathematics, United States Department of Agriculture-Agricultural Research Service
e Corn Insects and Crop Genetics Research, United States Department of Agriculture-Agricultural Research Service
f Department of Plant Pathology, Iowa State University, Ames, Iowa 50011
g Center for Plant Genomics, Iowa State University, Ames, Iowa 50011
Corresponding author: Patrick S. Schnable, Iowa State University, Ames, IA 50011., schnable{at}iastate.edu (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
Even in the absence of excisional loss of the associated Mu transposons, some Mu-induced mutant alleles of maize can lose their capacity to condition a mutant phenotype. Three of five Mu-derived rf2a alleles are susceptible to such Mu suppression. The suppressible rf2a-m9437 allele has a novel Mu transposon insertion (Mu10) in its 5' untranslated region (UTR). The suppressible rf2a-m9390 allele has a Mu1 insertion in its 5' UTR. During suppression, alternative transcription initiation sites flanking the Mu1 transposon yield functional transcripts. The suppressible rf2a-m8110 allele has an rcy/Mu7 insertion in its 3' UTR. Suppression of this allele occurs via a previously unreported mechanism; sequences in the terminal inverted repeats of rcy/Mu7 function as alternative polyadenylation sites such that the suppressed rf2a-m8110 allele yields functional rf2a transcripts. No significant differences were observed in the nucleotide compositions of these alternative polyadenylation sites as compared with 94 other polyadenylation sites from maize genes.
THERE are two broad categories of DNA transposons, autonomous and nonautonomous. Autonomous transposons encode all nonhost factors required for their own transposition. In contrast, the transposition of nonautonomous transposons is dependent upon factors encoded by autonomous transposons of the same family. Hence, only in the presence of factors encoded by the autonomous Spm/En, Ac, and MuDR maize transposons can the nonautonomous dSpm/I, Ds, and Mu transposons undergo excision and transposition (reviewed by ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Many transposon-induced mutants exhibit unstable phenotypes as a result of DNA rearrangements such as excision. In addition, some transposon-induced alleles also exhibit instabilities that occur in the absence of DNA rearrangements (![]()
![]()
![]()
The loss of a Mu-induced allele's capacity to condition a mutant phenotype is termed Mu suppression. Mu suppression was first reported at the hcf106::Mu1 mutant allele, which has a Mu1 insertion in its 5' untranslated region (UTR; ![]()
![]()
![]()
![]()
Mu suppression has been observed in several other Mu-induced mutants. Two suppressible Knotted1 (Kn1) alleles arose via Mu1 and Mu8 insertions in the junction region of the Kn1-0 repeats. This junction region contains the promoter region of the downstream copy of Kn1-0 (![]()
![]()
![]()
![]()
![]()
The hcf106::Mu1 mutation and the genetically unlinked Mu-induced suppressible mutation Les28 exhibit coordinated suppression and reactivation. The suppression of both mutant phenotypes is well correlated with hypermethylation of Mu transposons throughout the entire genome and also with hypermethylation of the region of the hcf106 locus flanking the Mu1 insertion (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Mu suppression has the potential to complicate efforts to clone genes via transposon tagging, because a critical step in such a project is to identify the particular Mu-containing restriction fragment length polymorphism or PCR fragment responsible for a Mu-induced mutation. This step is generally accomplished by identifying Mu-containing DNA fragments that cosegregate with the mutant phenotype through meioses. Because suppressed plants exhibit a wild-type phenotype even though they carry a Mu transposon in the target gene, suppression can mask the cosegregation between the mutant phenotype and the Mu-containing DNA fragment. Mu suppression can also lead to the loss of mutant phenotypes during backcrossing programs, which are becoming increasingly important with the adoption of new technologies such as RNA profiling and proteomics. These problems can be avoided if these analyses are conducted in an active Mu stock but this restriction limits the available genetic backgrounds.
Mu suppression also impacts technologies, such as Trait Utility System for Corn (![]()
![]()
![]()
![]()
Therefore, understanding the frequency and mechanisms of Mu suppression is critical to using Mu transposons to understand maize biology. Here we report the identification and characterization of three Mu-suppressible rf2a alleles. We found that Mu suppression can occur not only at alleles caused by Mu insertions in a 5' UTR via the recruitment of alternative transcription initiation sites as reported previously, but also at an allele caused by a Mu insertion in the 3' UTR. Polyadenylation sites within the TIRs of the inserted Mu transposon are recruited during Mu suppression of this new class of Mu-suppressible alleles. In addition, these studies establish that insertions of two additional classes of Mu transposons can generate suppressible alleles.
| MATERIALS AND METHODS |
|---|
Alleles of the rf2a gene:
The rf2a gene (previously designated rf2; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Backcrosses of the rf2a-m alleles:
Plants heterozygous for each rf2a-m allele (rf2a-m/Rf2a) carrying T cytoplasm were crossed as females by the inbred line Ky21. Progeny that carried the rf2a-m alleles were identified by DNA gel blot or PCR analyses. The 1.2-kb partial or 2.2-kb full-length rf2a cDNA was used as a hybridization probe against EcoRV- (for rf2a-m9437) or HindIII- (for the rest of the rf2a-m alleles) digested genomic DNA in DNA gel blot analyses. Genotypes of plants in families segregating for rf2a-m alleles were often confirmed via testcrosses: (T) rf2a-R213/rf2a-R213 x rf2a-m/Rf2a-Ky21 (or Rf2a-Ky21/Rf2a-Ky21). Segregation of male-sterile and male-fertile plants (1:1) in the resulting progeny confirmed the presence of a nonsuppressed rf2a-m allele in a particular male parent.
Male-fertility ratings:
Phenotypes were scored in the morning during the period of pollen shedding for several days according to the rating system of ![]()
Mu-active lines:
Mu-active lines were derived either from the stocks used to generate the rf2a-m alleles (![]()
Rf2a genomic clones:
Two overlapping rf2a-hybridizing genomic clones were obtained by screening B73 libraries. Both libraries were constructed using the
DASHII (Stratagene, La Jolla, CA) vector and were prepared by Pam Close and John Tossberg, respectively. Library screening conditions were as described by ![]()
![]()
Clone rf2-DNA1 was obtained using a 900-bp probe (DD1, see Fig 1C of ![]()
|
Mapping transposon insertion sites and identifying Mu transposons:
The transposon insertion site in the rf2a-m8122 allele was established during the cloning of the rf2a gene (![]()
PCR reactions were also conducted on DNA from plants homozygous for each of the rf2a-m alleles to map and to identify Mu transposons. Each PCR reaction included a Mu-TIR primer and one of many primers specific to the exons of rf2a. Due to the large introns of this gene, most of these PCR reactions did not yield rf2a-specific products. After some of the transposon insertion sites were mapped via genomic restriction mapping, appropriate rf2a-specific primers were used (RF2C6 for rf2a-m9390 and rf2a-m9437 and RF2C1 for rf2a-m8110) to amplify these rf2a-m alleles (Fig 1). In these instances the transposon insertion sites were physically mapped via sequence comparisons between the resulting PCR products and the sequence of the rf2a gene (GenBank accession no. AF215823). The junction between the rf2a and Mu-TIR sequences in these PCR products defines the Mu insertion site. Because the TIRs of each class of Mu transposon contain diagnostic polymorphisms, it was possible to determine the identities of the Mu transposons inserted in rf2a-m alleles by comparing the Mu-TIR sequence contained in the allele-specific PCR products to the TIRs of all known Mu transposons. In addition, because the sequences of the two TIRs of most Mu transposons have one or more polymorphisms relative to each other, the orientations of the Mu insertions in rf2a-m alleles could also be determined.
To confirm the identity of the transposon inserted into the rf2a-m9390 allele, genomic DNA samples from plants homozygous for rf2a-m9390 and its progenitor Q67 were digested with EcoRV, HindIII, XbaI, EcoRV + HindIII, EcoRV + XbaI, and HindIII + XbaI and then hybridized with the rf2a-specific probe, rf2-5m. The same filter was stripped (![]()
The identity of the rcy/Mu7 transposon in rf2a-m8110 was confirmed similarly with the rf2a-specific probe C1-C2 and a rcy/Mu7-specific probe. To further confirm the identity and orientation of the rcy/Mu7 transposon insertion in rf2a-m8110, an rf2a-specific primer, RF2C2, which is
0.1 kb 3' of the rcy/Mu7 insertion site in this allele, and an rcy/Mu7 internal primer, Mu7-R, were used to amplify a 1.7-kb fragment from the 5' end (i.e., the rightmost end in Fig 1) of the rcy/Mu7 transposon in rf2a-m8110. This PCR product was subcloned into a pGEM-T vector (Promega, Madison, WI) and >80% was sequenced. Sequence comparisons between this PCR product and rcy/Mu7 (GenBank accession no.
X15872) identified only a few nucleotide polymorphisms.
The transposon insertion in the rf2a-m8904 allele was identified by PCR amplification using primers rf2a-3320 and RF2C5UTRR, which flank the transposon insertion. Based on its sequence, this transposon is Ds1 (GenBank accession no. AF010445).
Probes:
DNA fragments used as probes in this study were obtained as follows. The 2.2-kb full-length rf2a cDNA fragment was obtained from plasmid prf273-11 with the restriction enzymes XhoI and EcoRI. The 1.2-kb partial rf2a cDNA was obtained from plasmid prf2a-1.2 with the restriction enzyme EcoRI. Plasmids prf273-11 and prf2a-1.2 contain the 1.2-kb and 2.2-kb rf2a cDNAs as described in ![]()
![]()
![]()
![]()
Genotyping rf2a-m alleles via PCR:
To determine which plants in a segregating family carry an rf2a-m allele, PCR amplifications were conducted using a Mu-TIR primer in combination with an appropriate rf2a-specific primer. Various primers that anneal to Mu-TIRs, such as XX153, were used in these PCR reactions. The rf2a-specific primers used for genotyping rf2a-m alleles include RF2C1 (for rf2a-m8110 and rf2a-m8122) and RF2C6 (for rf2a-m9390 and rf2a-m9437; Fig 1). PCR reactions were performed for 34 cycles as follows: denature at 94° for 40 sec; anneal primers for 40 sec at 55°58° (depends upon the Mu-TIR primer used); extend at 72° for 2 min in the presence of 2.5 units of Taq polymerase (Promega) per reaction.
Primer sequences:
- Mu7-R: 5' TTCTCCGCCGTTGCCATCTC 3'
- RF2C1: 5' GCGTCGTTGGTGATCCGTTC 3'
- RF2C2: 5' CCAGGCTAGGGCAAATCTTAT 3'
- RF2C4: 5' AGCGGGAGACGAGCGAGGAC 3'
- RF2C5: 5' ATGCTGCGATTCCGTTTGGTG 3'
- RF2C6: 5' TCCTCACTCCCACACCAACC 3'
- RF2C8: 5' GCAGCAGGAGAAGCGGCAGGCAG 3'
- RF2C9: 5' GTGATGGGCTCCTCTACT 3'
- XX153: 5' CGCCTCCATTTCGTCGAATCC 3'
- rf2-B461: 5' ACAGATCTAAAGCTCCTCATTAAT 3'
- rf2-xq: 5' CCAACTTTCCAGGCATACATCA 3'
- rf2a-3320: 5' GAGGAACCAGTAGCGGAGGC 3'
- RF2C5UTRR: 5' GCTCCCGTTCGCAGTCG 3'
DNA and RNA gel blot analyses:
Maize genomic DNA was isolated using a 1x CTAB procedure (![]()
![]()
Total RNA from immature tassels (still in the whorl) was isolated according to ![]()
![]()
![]()
3' and 5' rapid amplification of cDNA ends:
RNA was isolated from immature tassels (still in the whorl) using the Trizol reagent (GIBCO BRL, Rockville, MD) and treated with PCR-grade DNaseI (GIBCO BRL) according to the manufacturer's instructions. A total of 5 µg and 100 ng of RNA were used for 3' and 5' rapid amplification of cDNA ends (RACE) experiments, respectively, using kits obtained from GIBCO BRL. The rf2a-specific primers RF2C5 and RF2C9 (Fig 1) were used for 3' and 5' RACE, respectively. The position of RF2C9 in exon 2 allows the inadvertent amplification of genomic DNA to be detected. Primer RF2C 4 was used as a nested primer for the 5' RACE experiments. RACE products were subcloned into the pGEM-T vector (Promega) and sequenced.
Analysis of polyadenylation sites:
All GenBank records for which the organism was Zea mays (excluding chloroplast and mitochondrial genes) that had the feature of "polyA_site" were downloaded on March 22, 2000. This data set was then parsed for the feature of polyadenylation site. The few records that lacked sequence data downstream of the reported poly(A) site or that had only "A" bases downstream of this site were excluded. Only the most recent GenBank submission was used in those instances of multiple submissions of the same gene. Chi-square homogeneity tests were performed according to ![]()
| RESULTS |
|---|
Structure of the rf2a gene:
The rf2a cDNA encodes a mitochondrially localized aldehyde dehydrogenase (![]()
![]()
4 kb (positions 833512,129) that encodes predicted proteins with high degrees of sequence similarity to the reverse transcriptase, protease, integrase, and endonuclease typical of copia-like retrotransposons (![]()
140 bp 5' of exon 2 in rf2-DNA2-65 exhibits 91% sequence identity to the LTR of Grande1-4 retrotransposon (GenBank accession no.
X97604). Two other regions of the rf2a gene (base positions 20653096, 5' of the transcription initiation site and positions 48755270 in intron 1) exhibit
88 and 85% sequence similarity, respectively, to the noncoding regions of various maize genes (GenBank accession nos.
X06333,
L40803,
AF030385,
AF031569,
AF041044 and
AJ005343,
Z22760,
AF043346,
Z26824,
AJ223471). These regions of sequence similarity have not been assigned any putative functions and do not exhibit characteristics of DNA transposons or retrotransposons.
Positions of transposons in rf2a-m alleles:
The positions of transposon insertions responsible for four of the five Mu-derived rf2a-m alleles (rf2a-m8110, rf2a-m8122, rf2a-m9390, and rf2a-m9437) were mapped via genomic restriction mapping and sequence comparisons between PCR products obtained using rf2a-m DNA templates in conjunction with Mu-TIR- and rf2a-specific primer pairs and the sequence of the rf2a gene (Fig 1). The specific class of Mu transposon responsible for each mutant and its orientation were determined via sequence analysis of the Mu-TIRs obtained from these PCR products. The rf2a-m9390 allele has a Mu1 transposon inserted into its 5' UTR, 105 bp 5' of the translation start codon. The identity of this Mu1 transposon was confirmed by DNA gel blot analysis (MATERIALS AND METHODS). The rf2a-m9437 allele contains a novel Mu transposon insertion in its 5' UTR, 35 bp 5' of the translation start codon. The TIR of this transposon differs from all other described Mu transposons. Therefore, this Mu transposon has been designated Mu10 (GenBank accession no.
AF231940). The rf2a-m8110 allele arose via an rcy/Mu7 insertion in the 3' UTR, 30 bp 3' of the translation stop codon. The identity of this rcy/Mu7 transposon was confirmed by sequence analysis of a 1.7-kb fragment of it and DNA gel blot analyses. The rf2a-m8122 allele has a Mu1 insertion in exon 9 (![]()
Reanalysis of data from ![]()
Although one-half of the progeny from the testcross, (T) rf2a-m8110/Rf2a x rf2a-R213/rf2a-R213, would be expected to be male sterile, Schnable and Wise found only 4 of 26 progeny from this cross to be male sterile. A high rate of nonconcordance between the male sterile phenotype and a nearby marker (wx1) was also obtained from a similar testcross but involving rf2a-m9390 allele (![]()
![]()
![]()
|
Reactivation of rf2a-m alleles:
Because these three alleles (rf2a-m8110, rf2a-m9390, and rf2a-m9437) all have a transposon insertion in an UTR, this low penetrance could reflect Mu suppression, which occurs when a genome lacks Mu activity (![]()
![]()
|
The stability of the reactivation of rf2a-m8110 was tested by crossing a reactivated (i.e., male sterile) heterozygous plant, (T) rf2a-m8110/rf2a-R213, by (N) rf2a-m8904/rf2a-m8904. The rf2a-m8904 allele was used for this cross instead of rf2a-R213 because unlike rf2a-R213 it does not accumulate a detectable amount of rf2a mRNA (![]()
Because the rf2a-m9390 allele became suppressed early in the backcrossing program, male-sterile plants homozygous for rf2a-m9390 were not initially available for mRNA accumulation analyses. To generate unsuppressed stocks homozygous for this allele, some unsuppressed heterozygous plants, (T) rf2a-m9390/rf2a-R213 from an early generation, were crossed by suppressed (i.e., male fertile) plants with the genotype (T) rf2a-m9390/rf2a-m9390. About 300 progeny were screened for male-sterile (i.e., unsuppressed) plants. Only 19 were obtained. When these 19 plants were genotyped, it was found that they all had the genotype rf2a-m9390/rf2a-R213; i.e., no male-sterile rf2a-m9390 homozygous plants were obtained. The reason for this unbalanced result is not known.
Methylation and Mu suppression of rf2a-m9390:
There is a good correlation between the methylation of Mu-TIRs and Mu activity (reviewed by ![]()
![]()
![]()
![]()
2 = 9.59). This result is consistent with the hypothesis that the low penetrance of rf2a-m9390 is due to Mu suppression. Interestingly, plants from a family (family 92 2148) that had just begun to show suppression after outcrossing to inbred lines exhibited a higher level of Mu methylation in general (Table 3) than did plants from the reactivated families.
|
|
![]()
Accumulation of rf2a mRNA in plants homozygous for suppressed rf2a-m alleles:
Prior RNA gel blot analysis identified a plant homozygous for rf2a-m9390 that accumulated rf2a mRNA at the same level as wild-type plants (![]()
|
Native transcription initiation sites are not used in suppressed rf2a-m9390 plants:
Because the rf2a-m9390 allele contains a Mu1 insertion in its 5' UTR, the rf2a transcripts that accumulate in the suppressed rf2a-m9390 plants (Fig 3) could be derived from alternative transcription initiation sites downstream of the native sites (i.e., in Mu1 and/or in its flanking region) as has been reported for hcf106::Mu1 (![]()
|
Transcription initiation sites in rf2a-m9390:
Initially 5' RACE experiments were conducted on RNA extracted from the inbred line Q67, which is homozygous for the wild-type progenitor of rf2a-m9390 (![]()
290 bp, a result that is consistent with the size of the longest rf2a cDNA clone isolated to date (prf273-11), which begins at position -253. Cloned 5' RACE products obtained using RNA extracted from a plant homozygous for suppressed rf2a-m9390 were considerably smaller than those obtained from the inbred line Q67. Sequence analysis of nine of the RACE products from rf2a-m9390 revealed multiple transcription initiation sites, all of which were located between the position of the Mu1 insertion (-105) and the translation start codon (Fig 5). This result is similar to what has been observed during suppression of hcf106::Mu1 (![]()
|
Alternative polyadenylation sites in the TIR of rcy/Mu7 are used during suppression of rf2a-m8110:
The rf2a-m8110 allele contains an rcy/Mu7 insertion in its 3' UTR. As is true for rf2a-m9390, suppressed plants homozygous for rf2a-m8110 accumulate rf2a mRNA that is indistinguishable from wild type by RNA gel blot analyses (Fig 3). On the basis of the analysis of cDNA clones, two Rf2a alleles (Rf2a-B73 and Rf2a-W22) use polyadenylation sites >140 bp 3' of the site of the rcy/Mu7 insertion in the rf2a-m8110 allele (Fig 6). In addition, 3' RACE experiments have established that this is also true for the Rf2a-Q67 allele, which is the wild-type progenitor of rf2a-m8110 (Fig 6). These results indicate that the rf2a-m8110 allele either uses the native polyadenylation sites but with the rcy/Mu7 transposon subsequently spliced out or uses alternative polyadenylation sites. 3' RACE was used to identify the polyadenylation sites used by suppressed rf2a-m8110 and to thereby distinguish between these two possibilities. As shown in Fig 6, five alternative polyadenylation sites were detected in two independent 3' RACE experiments. Some sites were recovered in both experiments. All identified sites are within the 3' TIR (i.e., leftmost TIR in Fig 6) of the rcy/Mu7 transposon insertion in rf2a-m8110.
|
Polyadenylation sites are preferentially located at the 3' end of a YA (i.e., UA, CA, or GA) sequence in at least some eukaryotes (reviewed by ![]()
![]()
2 homogeneity test (
2 = 3.67) indicated that the rate of YA polyadenylation sites in rcy/Mu7 at the 95% confidence level is not significantly different from that in other maize genes.
|
| DISCUSSION |
|---|
Mu suppression occurs at a high frequency:
Mu transposons are widely used for the functional analysis of the maize genome, including gene tagging, gene discovery, and reverse genetics. It has been known for over a decade that in the absence of Mu activity, some Mu-insertion alleles lose the capacity to condition a mutant phenotype (![]()
Of the thousands of mutant alleles derived from Mu stocks, only 12 have been described as suppressible (![]()
![]()
![]()
![]()
![]()
![]()
In this study a collection of five Mu-derived rf2a mutant alleles originally obtained via a phenotypic screen was backcrossed to a non-Mu inbred line (Ky21) for at least three generations. Two alleles (rf2a-m9390 and rf2a-m8110) with Mu insertions in noncoding regions exhibited low penetrance early in this backcrossing program. A third allele, rf2a-m9437, exhibited low penetrance in later generations (data not shown). The low penetrance of these three alleles is not the result of DNA rearrangements and at least rf2a-m8110 and rf2a-m9390 can be reactivated by the introduction of Mu activity. The Mu1 transposon in rf2a-m9390 is methylated in fertile plants, further confirming the relationship between the low penetrance and the absence of Mu activity. Furthermore, on the basis of its low penetrance and Mu insertion site, rf2a-m9437 is also likely to be a suppressible allele. Thus three of the five Mu-insertion alleles analyzed appear to be Mu suppressible. Hence, it is clear that Mu-suppressible alleles arise frequently enough to seriously impact the outcome of genetic experiments. In retrospect, suppression probably accounts for our lack of success in identifying a Mu-containing DNA fragment that cosegregated with any of the five Mu-induced rf2a alleles except rf2a-m8122 (![]()
![]()
It has previously been established that the insertion of Mu transposons into promoter regions, 5' UTRs, and introns can generate suppressible alleles. By determining the structure of the Rf2a-B73 allele and the insertion sites of the Mu transposons responsible for four of five rf2a-m alleles, this study not only identified two suppressible alleles with Mu insertions in the 5' UTR of the rf2a gene (rf2a-m9390 and rf2a-m9437), but also for the first time demonstrated that a Mu insertion into a 3' UTR can result in a suppressible allele (rf2a-m8110). Only the apparently nonsuppressible rf2a-m8122 allele arose via a Mu insertion in an exon.
The Rf2a-B73 allele spans >17 kb (Fig 1) and contains many small exons and introns as well as two large introns (the largest of which is >7 kb). It is worth noting that if a reverse genetic screen that depends upon PCR-based detection of Mu insertions (![]()
Suppressible alleles described previously arose via the insertion of a variety of Mu transposons: Mu1, Mu3, Mu8, and MuDR deletion derivatives (![]()
![]()
![]()
![]()
![]()
Mu suppression occurs to alleles that have a Mu insertion in the 5' UTR:
Three mutant alleles that arose via Mu transposon insertions in 5' UTRs recruit alternative transcription initiation sites during suppression. The hcf106::Mu1, Lg3-Or422, and rf2a-m9390 alleles have Mu1, Mu3, and Mu1 insertions at positions -34 (![]()
![]()
The rf2a-m9437 allele also arose via a Mu insertion in the 5' UTR. Unlike rf2a-m9390, which exhibited evidence of suppression very early in the backcrossing program, rf2a-m9437 did not begin to exhibit evidence of suppression until after three generations of backcrossing to the inbred line Ky21 (Table 1 and data not shown). Interestingly, the position of the Mu10 insertion responsible for rf2a-m9437 (base pair -35 relative to the presumed translation start codon) precludes the use of all but one of the alternative transcription initiation sites used by rf2a-m9390.
Mu suppression affects an allele that has a Mu insertion in its 3' UTR:
Analysis of rf2a-m8110 revealed a novel mechanism of Mu suppression. This allele has an rcy/Mu7 transposon insertion 30 bp downstream of the stop codon in the 3' UTR. Sequence analysis of cloned 3' RACE products revealed that during suppression the rf2a-m8110 allele recruits novel polyadenylation sites from within the TIR of the rcy/Mu7 transposon. This is the first report that rcy/Mu7 contains polyadenylation sites. Because the TIRs of the 10 classes of Mu transposons are well conserved, analysis of the rf2a-m8110 allele suggests that the recruitment of alternative polyadenylation sites might be a general mechanism by which mutants containing other classes of Mu insertions in their 3' UTRs could be suppressed. This is similar to the finding that the long terminal repeats of retroviruses can provide polyadenylation sites for human cellular transcripts (![]()
![]()
Polyadenylation sites in Mu1 were identified previously following the analysis of truncated transcripts produced by the adh1-s3034 allele, which contains a Mu1 insertion in its first intron (![]()
In eukaryotes, polyadenylation occurs following the cleavage of the hnRNA, which produces a 3' -OH. The positions at which cleavage, and hence polyadenylation, occur are controlled by cis-acting elements that are usually located between the stop codon and the cleavage site. In mammals, the polyadenylation signals consist of the AAUAAA positioning element (PE) and the U- or UG-rich downstream element (DE; ![]()
![]()
![]()
![]()
![]()
![]()
Seven polyadenylation sites were detected in Rf2a alleles (VIXII in Fig 6). Each of these sites is 2050 bases downstream of an AAUAAA-like PE and in the vicinity of a U-rich flanking region (each
50% U). No obvious UE was detected in the rf2a gene. Similarly, all five polyadenylation sites in the TIR of rcy/Mu7 (IV in Fig 6) are located in the vicinity of U-rich regions and 2050 bp downstream of one of the three AAUAAA-like PE elements that exist in this TIR.
The fact that only the TIR polyadenylation sites are used in suppressed rf2a-m8110 plants indicates either that transcription does not proceed through the rcy/Mu7 transposon to the native polyadenylation sites or that the TIR sites are preferred over the native sites by the polyadenylation machinery. One hypothesis to explain such a preference would be the presence of an as-yet-unidentified polyadenylation signal upstream of the position of the rcy/Mu7 insertion. The spatial separation between this upstream signal and the native sites caused by the 2.2-kb rcy/Mu7 insertion in the rf2a-m8110 allele might cause such an upstream signal to interact more efficiently with the nearby TIR sites than with the native sites.
In vitro and in vivo polyadenylation experiments demonstrated that cleavage occurs preferentially at the 3' end of a YA (i.e., UA, CA, or GA) sequence (reviewed by ![]()
![]()
70 of 100 polyadenylation sites (![]()
![]()
![]()
60% of sites (![]()
| FOOTNOTES |
|---|
1 Present address: The Jackson Laboratory, 600 Main St., Bar Harbor, ME 40609. ![]()
2 Present address: The University of Texas Health Science Center San Antonio, 7703 Floyd Curl Dr., San Antonio, TX 78229. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Ms. Weijun Chen for assistance in sequencing the rf2-DNA1 genomic clone; Steve Briggs, who, while at Pioneer Hi-Bred International, provided the two B73 genomic libraries; and Alfons Gierl (Technische Universitat, Munchen, Germany) for the GAPDH clone. This research was partially supported by a USDA/NRI grant (9600804) to P.S.S. and R.P.W., USDA/NRI grants (98001805, 0001478, 0201414) to P.S.S., a Human Frontiers in Science program grant (RG0067) to Cris Kuhlemeier (Institute of Plant Physiology, University of Berne, Switzerland) and P.S.S., a National Science Foundation grant (DBI-9975868) to P.S.S. and D.A., and Hatch Act and State of Iowa funds. This is journal paper no. J-18707 of the Iowa Agriculture and Home Economics Experiment Station (Ames, IA); project numbers are 3368, 3390, 3485, and 3554.
Manuscript received March 1, 2002; Accepted for publication November 4, 2002.
| LITERATURE CITED |
|---|
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1999 Current Protocols in Molecular Biology. John Wiley & Sons, New York.
BARKAN, A. and R. A. MARTIENSSEN, 1991 Inactivation of maize transposon Mu suppresses a mutant phenotype by activating an outward-reading promoter near the end of Mu1.. Proc. Natl. Acad. Sci. USA 88:3502-3506.
BAUST, C., W. SEIFARTH, H. GERMAIER, R. HEHLMANN, and C. LEIB-MJOSCH, 2000 HERV-K-T47D-related long terminal repeats mediate polyadenylation of cellular transcripts. Genomics 66:98-103.[Medline]
BENITO, M. I. and V. WALBOT, 1997 Characterization of the maize Mutator transposable element MURA transposase as a DNA-binding protein. Mol. Cell. Biol. 17:5165-5175.
BENNETZEN, J. L., 1996 The Mutator transposable element system of maize. Curr. Top. Microbiol. Immunol. 204:195-229.[Medline]
BENNETZEN, J. L., P. S. SPRINGER, A. D. CRESSE, and M. HENDRICKX, 1993 Specificity and regulation of the Mutator transposable element system of maize. Crit. Rev. Plant Sci. 12:57-95.
BENSEN, R. J., G. S. JOHAL, V. C. CRANE, J. T. TOSSBERG, and P. S. SCHNABLE et al., 1995 Cloning and characterization of the maize An1 gene. Plant Cell 7:75-84.[Abstract]
CHANDLER, V. L. and K. J. HARDEMAN, 1992 The Mu elements of Zea mays.. Adv. Genet. 30:77-122.[Medline]
CHANDLER, V. L. and V. WALBOT, 1986 DNA modification of a maize transposable element correlates with loss of activity. Proc. Natl. Acad. Sci. USA 83:1767-1771.
CHOMET, P., D. LISCH, K. J. HARDEMAN, V. L. CHANDLER, and M. FREELING, 1991 Identification of a regulatory transposon that controls the Mutator transposable element system in maize. Genetics 129:261-270.[Abstract]
CUI, X., R. P. WISE, and P. S. SCHNABLE, 1996 The rf2 nuclear restorer gene of male sterile T-cytoplasm maize. Science 272:1334-1336.[Abstract]
DEAN, C., P. VAN DEN ELZEN, S. TAMAKI, P. DUNSMUIR, and J. BEDBROOK, 1985 Differential expression of the eight genes of the petunia ribulose bisphosphate carboxylase small subunit multi-gene family. EMBO J. 4:3055-3061.[Medline]
DIETRICH, C. R., F. CUI, M. L. PACKILA, J. LI, and D. A. ASHLOCK et al., 2002 Maize Mu transposons are targeted to the 5' untranslated region of the gl8 gene and sequences flanking Mu target-site duplications exhibit nonrandom nucleotide composition throughout the genome. Genetics 160:697-716.
DONLIN, M. J., D. LISCH, and M. FREELING, 1995 Tissue-specific accumulation of MURB, a protein encoded by MuDR, the autonomous regulator of the Mutator transposable element family. Plant Cell 7:1989-2000.[Abstract]
EISEN, J. A., M. I. BENITO, and V. WALBOT, 1994 Sequence similarity of putative transposases links the maize Mutator autonomous element and a group of bacterial insertion sequences. Nucleic Acids Res. 22:2634-2636.
FEDOROFF, N. V., 1999 The suppressor-mutator element and the evolutionary riddle of transposons. Genes Cells 4:11-19.[Abstract]
FOWLER, J. E., G. J. MUEHLBAUER, and M. FREELING, 1996 Mosaic analysis of the liguleless3 mutant phenotype in maize by coordinate suppression of Mutator-insertion alleles. Genetics 143:489-503.[Abstract]
GIRARD, L. and M. FREELING, 2000 Mutator-suppression alleles of rough sheath1 and liguleless3 in maize reveal multiple mechanisms for suppression. Genetics 154:437-446.
GRABER, J. H., C. R. CANTOR, S. C. MOHR, and T. F. SMITH, 1999 In silico detection of control signals: mRNA 3'-end-processing sequences in diverse species. Proc. Natl. Acad. Sci. USA 96:14055-14060.
GREENE, B., R. WALKO, and S. HAKE, 1994 Mutator insertions in an intron of the maize knotted1 gene result in dominant suppressible mutations. Genetics 138:1275-1285.[Abstract]
GUO, Z. and F. SHERMAN, 1995 3'end-forming signals of yeast mRNA. Mol. Cell. Biol. 15:5983-5990.
HERSHBERGER, R. J., C. A. WARREN, and V. WALBOT, 1991 Mutator activity in maize correlates with the presence and expression of the Mu transposable element Mu9.. Proc. Natl. Acad. Sci. USA 88:10198-10202.
HSIA, A.-P. and P. S. SCHNABLE, 1996 DNA sequence analyses support the role of interrupted gap repair in the origin of internal deletions of the maize transposon, MuDR.. Genetics 142:603-618.[Abstract]
HU, G., N. YALPANI, S. P. BRIGGS, and G. S. JOHAL, 1998 A porphyrin pathway impairment is responsible for the phenotype of a dominant disease lesion mimic mutant of maize. Plant Cell 10:1095-1105.
HUNT, A. G., and J. MESSING, 1998 mRNA polyadenylation in plants, pp. 2939 in A Look Beyond Transcription: Mechanisms Determining mRNA Stability and Translation in Plants, edited by J. BAILEY-SERRES and D. R. GALLIE. American Society of Plant Physiologists, Rockville, MD.
JAMES, M. G., M. J. SCANLON, M. QIN, D. S. ROBERTSON, and A. M. MYERS, 1993 DNA sequence and transcript analysis of transposon MuA2, a regulator of Mutator transposable element activity in maize. Plant Mol. Biol. 21:1181-1185.[Medline]
KONIECZNY, A., D. F. VOYTAS, M. P. CUMMINGS, and F. M. AUSUBEL, 1991 A superfamily of Arabidopsis thaliana retrotransposons. Genetics 127:801-809.[Abstract]
KUNZE, R., 1996 The maize transposable element activator (Ac). Curr. Top. Microbiol. Immunol. 204:161-194.[Medline]
LISCH, D., L. GIRARD, M. DONLIN, and M. FREELING, 1999 Functional analysis of deletion derivatives of the maize transposon MuDR delineates roles for the MURA and MURB proteins. Genetics 151:331-341.
LIU, F., X. CUI, H. T. HOMER, H. WEINER, and P. S. SCHNABLE, 2001 Mitochondrial aldehyde dehydrogenase activity is required for male fertility in maize (Zea mays L.). Plant Cell 13:1063-1078.
LOWE, B., J. MATHERN, and S. HAKE, 1992 Active Mutator elements suppress the Knotted phenotype and increase recombination at the Kn1-0 tandem duplication. Genetics 132:813-822.[Abstract]
MAGER, D. L., D. G. HUNTER, M. SCHERTZER, and J. D. FREEMAN, 1999 Endogenous retroviruses provide the primary polyadenylation signal for two new human genes (HHLA2 and HHLA3). Genomics 59:255-263.[Medline]
MARTIENSSEN, R. and A. BARON, 1994 Coordinate suppression of mutations caused by Robertson's Mutator transposons in maize. Genetics 136:1157-1170.[Abstract]
MARTIENSSEN, R. A., A. BARKAN, M. FREELING, and W. C. TAYLOR, 1989 Molecular cloning of a maize gene involved in photosynthetic membrane organization that is regulated by Robertson's Mutator.. EMBO J. 8:1633-1639.[Medline]
MARTIENSSEN, R., A. BARKAN, W. C. TAYLOR, and M. FREELING, 1990 Somatically heritable switches in the DNA modification of Mu transposable elements monitored with a suppressible mutant in maize. Genes Dev. 4:331-343.
MASSON, P., J. A. BANKS, and N. FEDOROFF, 1991 Structure and function of the maize Spm transposable element. Biochimie 73:5-8.[Medline]
MCCLINTOCK, B., 1964 Aspects of gene regulation in maize. Carnegie Inst. Wash. Year Book 63:592-602.
MCCLINTOCK, B., 1967 Genetic systems regulating gene expression during development. Dev. Biol. Suppl. 1:84-112.
ORTIZ, D. F. and J. N. STROMMER, 1990 The Mu1 maize transposable element induces tissue-specific aberrant splicing and polyadenylation in two Adh1 mutants. Mol. Cell. Biol. 10:2090-2095.
PRELICH, G., 1999 Suppression mechanisms: themes from variations. Trends Genet. 15:261-266.[Medline]
QIN, M., D. S. ROBERTSON, and A. H. ELLINGBOE, 1991 Cloning of the Mutator transposable element MuA2, a putative regulator of somatic mutability of the a1-Mum2 allele in maize. Genetics 129:845-854.[Abstract]
RAIZADA, M. N. and V. WALBOT, 2000 The late developmental pattern of Mu transposon excision is conferred by a cauliflower mosaic virus 35S-driven MURA cDNA in transgenic maize. Plant Cell 12:5-21.
ROBERTSON, D. S., 1978 Characterization of a mutator system in maize. Mutat. Res. 5:21-28.
ROBERTSON, D. S. and P. S. STINARD, 1989 Genetic analyses of putative two-element system regulating somatic mutability in mutator-induced aleurone mutants of maize. Dev. Genet. 10:482-506.
ROBERTSON, D. S., D. W. MORRIS, P. S. STINARD and B. A. ROTH, 1988 Germline and somatic Mutator activity: Are they functionally related? pp. 1742, in Plant Transposable Elements, edited by O. NELSON. Plenum Press, New York/London.
ROTHNIE, H. M., 1996 Plant mRNA 3'-end formation. Plant Mol. Biol. 32:43-61.[Medline]
SAGHAI-MAROOF, M. A., K. M. SOLIMAN, R. A. JORGENSEN, and R. W. ALLARD, 1984 Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA 81:8014-8018.
SCHNABLE, P. S. and P. A. PETERSON, 1986 Distribution of genetically active Cy elements among diverse maize lines. Maydica 31:59-82.
SCHNABLE, P. S. and R. P. WISE, 1994 Recovery of heritable, transposon-induced, mutant alleles of the rf2 nuclear restorer of T-cytoplasm maize. Genetics 136:1171-1185.[Abstract]
SCHNABLE, P. S. and R. P. WISE, 1998 The molecular basis of cytoplasmic male sterility and fertility restoration. Trends Plant Sci. 3:175-180.
SCHNABLE, P. S., P. A. PETERSON, and H. SAEDLER, 1989 The bz-rcy allele of the Cy transposable element system of Zea mays contains a Mu-like element insertion. Mol. Gen. Genet. 217:459-463.[Medline]
SHEETS, M. D., S. C. OGG, and M. P. WICKENS, 1990 Point mutations in AAUAAA and the poly (A) addition site: effects on the accuracy and efficiency of cleavage and polyadenylation in vitro.. Nucleic Acids Res. 18:5799-5805.
SKIBBE, D. S., F. LIU, T. J. WEN, M. D. YANDEAU, and X. CUI et al., 2002 Characterization of the aldehyde dehydrogenase gene families of Zea mays and Arabidopsis. Plant. Mol. Biol. 48:751-764.[Medline]
STEEL, R. G., and J. H. TORRIE, 1980 Principles and Procedures of Statistics: A Biometrical Approach. McGraw-Hill, New York.
STRATHMANN, M., B. A. HAMILTON, C. A. MAYEDA, M. I. SIMON, and E. M. MEYEROWITZ et al., 1991 Transposon-facilitated DNA sequencing. Proc. Natl. Acad. Sci. USA 88:1247-1250.
WAHLE, E. and U. RUEGSEGGER, 1999 3'-end processing of pre-mRNA in eukaryotes. FEMS Microbiol. Rev. 23:277-295.[Medline]
WALBOT, V., 1999 Genes, genomes, genomics. What can plant biologists expect from the 1998 National Science Foundation Plant Genome Research Program? Plant Physiol. 119:1151-1156.
WISE, R. P., C. R. BRONSON, P. S. SCHNABLE, and H. T. HORNER, 1999 The genetics, pathology, and molecular biology of T-cytoplasm male sterility in maize. Adv. Agronomy 65:79-130.
WU, L., T. UEDA, and J. MESSING, 1995 The formation of mRNA 3'-ends in plants. Plant J. 8:323-329.[Medline]
XU, X., C. R. DIETRICH, M. DELLEDONNE, Y. XIA, and T. J. WEN et al., 1997 Sequence analysis of the cloned glossy8 gene of maize suggests that it may code for a beta-ketoacyl reductase required for the biosynthesis of cuticular waxes. Plant Physiol. 115:501-510.[Abstract]
ZHAO, J., L. HYMAN, and C. MOORE, 1999 Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol. Mol. Biol. Rev. 63:405-445.
This article has been cited by other articles:
![]() |
W. J. Haun, O. N. Danilevskaya, R. B. Meeley, and N. M. Springer Disruption of Imprinting by Mutator Transposon Insertions in the 5' Proximal Regions of the Zea mays Mez1 Locus Genetics, April 1, 2009; 181(4): 1229 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Robbins, R. S. Sekhon, R. Meeley, and S. Chopra A Mutator Transposon Insertion Is Associated With Ectopic Expression of a Tandemly Repeated Multicopy Myb Gene pericarp color1 of Maize Genetics, April 1, 2008; 178(4): 1859 - 1874. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, T.-J. Wen, and P. S. Schnable Role of RAD51 in the Repair of MuDR-Induced Double-Strand Breaks in Maize (Zea mays L.) Genetics, January 1, 2008; 178(1): 57 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, L. C. Harper, I. Golubovskaya, C. R. Wang, D. Weber, R. B. Meeley, J. McElver, B. Bowen, W. Z. Cande, and P. S. Schnable Functional Analysis of Maize RAD51 in Meiosis and Double-Strand Break Repair Genetics, July 1, 2007; 176(3): 1469 - 1482. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. May, H. Liu, E. Vollbrecht, L. Senior, P. D. Rabinowicz, D. Roh, X. Pan, L. Stein, M. Freeling, D. Alexander, et al. Maize-targeted mutagenesis: A knockout resource for maize PNAS, September 30, 2003; 100(20): 11541 - 11546. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Cui, X.
- Articles by Schnable, P. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Cui, X.
- Articles by Schnable, P. S.







