- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lankenau, S.
- Articles by Lankenau, D.-H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lankenau, S.
- Articles by Lankenau, D.-H.
Knockout Targeting of the Drosophila Nap1 Gene and Examination of DNA Repair Tracts in the Recombination Products
Susanne Lankenaua,b, Thorsten Barnickela, Joachim Marholdc, Frank Lykob, Bernard M. Mechlerc, and Dirk-Henner Lankenaua,ca Department of Zoology, University of Heidelberg, D-69120 Heidelberg, Germany
b Research Group Epigenetics, Deutsches Krebsforschungszentrum, D-69120 Heidelberg, Germany
c Department of Developmental Genetics, Deutsches Krebsforschungszentrum, D-69120 Heidelberg, Germany
Corresponding author: Dirk-Henner Lankenau, Im Neuenheimer Feld 230, D-69120 Heidelberg, Germany., d.lankenau{at}uni-hd.de (E-mail)
Communicating editor: K. GOLIC
| ABSTRACT |
|---|
We used ends-in gene targeting to generate knockout mutations of the nucleosome assembly protein 1 (Nap1) gene in Drosophila melanogaster. Three independent targeted null-knockout mutations were produced. No wild-type NAP1 protein could be detected in protein extracts. Homozygous Nap1KO knockout flies were either embryonic lethal or poorly viable adult escapers. Three additional targeted recombination products were viable. To gain insight into the underlying molecular processes we examined conversion tracts in the recombination products. In nearly all cases the I-SceI endonuclease site of the donor vector was replaced by the wild-type Nap1 sequence. This indicated exonuclease processing at the site of the double-strand break (DSB), followed by replicative repair at donor-target junctions. The targeting products are best interpreted either by the classical DSB repair model or by the break-induced recombination (BIR) model. Synthesis-dependent strand annealing (SDSA), which is another important recombinational repair pathway in the germline, does not explain ends-in targeting products. We conclude that this example of gene targeting at the Nap1 locus provides added support for the efficiency of this method and its usefulness in targeting any arbitrary locus in the Drosophila genome.
THE completion of the genome sequence provides unlimited access to all genes of Drosophila melanogaster (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Three additional targeted Nap1KO recombinants were viable. To understand the molecular differences between the six targeted Nap1KO mutants we performed a detailed molecular analysis of these recombination products. We constructed the targeting vector such that the Nap1 donor gene included protein-function-destroying mutations, which simultaneously introduced five molecular repair-tract markers. Because ends-in targeting produces target-gene duplications, each Nap1 copy and the five corresponding tract markers were duplicated at each targeted event. Thus from the six targeting events we monitored 60 marker positions. The 18-bp I-SceI endonuclease site where the Nap1 donor was cleaved for double-strand break (DSB)-induced targeting was in all but one case replaced by wild-type Nap1 sequence. This indicated that exonuclease processing at the DSB and replicative repair at the donor-target junctions had taken place. The results are discussed mechanistically with relation to major models of recombinational DNA repair. Either the classical DSB repair model involving double Holliday junctions (![]()
![]()
| MATERIALS AND METHODS |
|---|
Drosophila:
Genetic symbols are defined in standard reference works (![]()
![]()
![]()
![]()
![]()
- y w; P{ry+, 70 FLP}4 P{v+, 70 I-SceI}2B Sco/S2 CyO
- w1118; P{ry+ 70 FLP}10; + (strong constitutive expression of FLP).
All experimental fly stocks were tested for absence of endosymbiotic, cytoplasmically inherited Wolbachia bacteria using published Wolbachia pipientis-specific 16S RNA PCR primers (![]()
Construction of donor plasmid and microinjection:
On the basis of the genome DNA sequence of Drosophila, recombinant PCR (![]()
- (Acc65I) 5' CGCGGTACCaagcagcaaaggcaacgcaaaatgac 3'
- (NotI) 5' CGCGCGGCCGCacgcataaaattactgattccgcgctaag 3'
- (I-SceI) 5' TAGGGATAACAGGGTAATccttgccctcgatgatctcc 3'
- (I-SceI) 5' ATTACCCTGTTATCCCTAtggacccgccgaggagaag 3'
- (HindIII) 5' GTTGCAGGACTCGGGGTCAACGTGaagCTTCGGCTGGGGCGTCCATTG 3'
- (HindIII) 5' CAATGGACGCCCCAGCCGAAGcttCACGTTGACCCCGAGTCCTGCAAC 3'
- (BclI) 5' GCTTCTTGCGGATGGTCTgaTCACAGTAAGGTTCATC 3'
- (BclI) 5' GATGAACCTTACTGTGAtcAGACCATCCGCAAGAAGC 3'.
The isolated DNA fragment finally encompassed five molecular markers (XhoI-, HindIII+, I-SceI+, BclI+, and SalI-), which destroyed the open reading frame (ORF) structure to the left and right of the I-SceI site such that a Nap1-targeted knockout duplicate could be not functional. The mutated Nap1 fragment was cloned into the Acc65I/NotI sites of the pTV2 vector obtained from Kent Golic (![]()
2-3}99B embryos. An insertion of pTV2-Nap1mut into the TM6 Ubx balancer chromosome was further used in a screen for Nap1 knockout mutations (Fig 1B).
|
Analysis of recombinant flies:
Polytene in situ hybridization:
The whs gene from the pTV2-vector (![]()
![]()
|
Southern blot:
Southern blots were performed according to standard protocols (alkaline transfer onto positively charged nylon membranes; ![]()
PCR analysis: Genomic DNA of heterozygous flies was used to track the molecular markers by performing PCR with three different primer combinations and subsequent restriction digests (Fig 4A and Fig B). Primer pI primes specifically to the 5' genomic region upstream of the distal Nap1 duplicate; the PCR product of primers pI and pII is therefore used to follow the markers on the distal (i.e., telomeric) side. Primer pIV is specific for the 3' genomic region downstream of the proximal Nap1 duplicate, so that the PCR product of pIII and pIV serves to characterize the proximal Nap1 duplicate. Primers II and III hybridize to all three different Nap1 copies (distal, proximal, and wild type). This PCR product was analyzed by a subsequent double digest with HindIII and BclI to prove the presence of the introduced restriction sites and to show the absence of the donor construct at the same time. Primers are as follows:
- pI: CTCGAATTCTAGCACCCATGATACCATCTTATGG;

View larger version (52K):
In this window
In a new window
Download PPT slide
Figure 3. Analysis of NAP1 protein in targeted flies. (A) Western blot analysis of wild-type and homozygous Nap1KO1 knockout flies. Total protein extracts were obtained from adult female flies and anti-NAP1 antibody was used ( LI et al. 1999 ). Anti-p40 antibody served to control for equal loading (bottom;
TOROK et al. 1999 ). (B) Western blot analysis of ovaries from wild-type and homozygous Nap1KO mutant flies. The genotypes were confirmed by PCR using genomic DNA from the carcasses as substrate. (C) Comparative immunolocalization of NAP1 protein (green) in the follicle cell layer surrounding egg chambers of wild-type and Nap1 knockout mutant ovarioles. DNA is stained with propidium iodide (red). Egg chambers were stained with Alexa488-labeled phalloidin to reveal actin-rich structures (blue). (D) The same antibody applied to the follicle cell layer of egg chambers from a wild-type and a Nap1 knockout mutant fly. Actin (here, red) reveals the apical part of the follicle cells. In the knockout mutant the basal concentration of NAP1 protein (green) observed in wild-type cells is absent (arrowheads).

View larger version (34K):
In this window
In a new window
Download PPT slide
Figure 4. Recombination tract analysis. (A) PCR analysis of genomic DNA from heterozygous recombinant KO flies. The boxed area shows the predicted genomic structure of two alleles of the Nap1 locus. The top map designates the wild-type Nap1 allele, the bottom map designates a full knockout allele. w-hs represents the white-hs positive selection marker gene. H and B designate the restriction enzymes HindIII and BclI. Open circles indicate the presence and solid circles the absence of these sites. Diagnostic primer combinations (pIpIV) are outside of the boxed area. The expected PCR products and their restriction digest products using BclI and HindIII are indicated. Italic letters (al) indicate restriction fragments corresponding to sizes in B. (B) Detection of all predicted fragments. Here, only results for Nap1KO1 are shown. Italic letters correspond to predicted fragment sizes in A. The internal structure of Nap1-targeting events was confirmed by a BclI/HindIII double digest (lane 1); lane 2 is a control from a fly containing the Nap1 donor construct on the third chromosome. The 0.9-kb fragment (fragment e in B) diagnostic for the donor construct is missing in all KO flies (except KO4 where it derives from the proximal Nap1 duplication). The distal region of the knockout rearrangement was diagnosed using BclI (lane 3, fragments h and i) and the proximal region was confirmed using HindIII (lane 4, fragments k and l). (C) Structure and recombination tracts of six knockout events at the Nap1 locus. Recombination tract analysis was performed as described in A and B. Restriction enzyme markers were introduced into the donor vector, which are reciprocal to the wild-type Nap1 target gene (X, XhoI; H, HindIII; I, I-SceI; B, BclI; S, SalI). Markers correspond to wild-type (solid circle) and mutagenized (open circle) Nap1 sequences. Presence (open star) or absence (solid star) of the I-SceI cutting site is indicated. Primer combinations pV and pVI were used to amplify each I-SceI site for subsequent sequencing. (a) Knockout alleles Nap1KO1 and Nap1KO2 revealed identical recombination tracts. These recombination products represent the predicted knockout structure. (b) Nap1KO3 represents the third complete knockout event. The proximal duplication is completely derived from the donor construct except for the I-SceI cutting sequence. (c) Incomplete knockout allele Nap1KO4. The distal duplication is wild type. The proximal duplication is identical to the donor construct. (d) Nap1KO5 and Nap1KO6 represent partial knockout alleles. The proximal duplication is entirely wild type. - pII: CGCTCTAGAAATCCAGCCACATCAACCTACTGA;
- pIII: CGCGCGGCCGCACGCATAAAATTACTGATTCCGCGCTAAG;
- pIV: CGCTCTAGAATTGATGGAACGCACTCGAAACTG.
Sequencing: Distal- and proximal-specific PCR fragments (see PCR analysis) were gel purified and PCR fragments spanning the region of the Nap1 construct containing the I-SceI site were generated using primers pV and pVI (pV, CTCGAATTCACTATTGGCCAGCAAACTCA; pVI, CTCTCTAGACTACAGCTGCAGCACCTGAATATCGA). The PCR fragments were directly sequenced using an ALF sequencer.
Western analysis:
Protein extracts were prepared from Drosophila Oregon-R wild-type females and from homozygous mutant Nap1 females or dissected ovaries. Equal amounts of protein were separated on a 15% polyacrylamide gel and blotted using standard procedures. As primary antibody we used anti-NAP1 (![]()
![]()
Immunostaining of ovaries and confocal laser scanning microscopy: Ovaries were dissected from wild-type (Oregon-R) and homozygous mutant Nap1 females and the tissue was fixed for 40 min in 4% formaldehyde, 0.5% Tween 20, and 1x PBS followed by three washes in 1x PBS. After blocking in 1x PBS, 1% BSA, 0.1% Tween 20, ovaries were incubated with anti-NAP1 antibody. After three washes with blocking solution, incubation with the secondary antibody (anti-rabbit Cy5; Dianova) followed in combination with 10 µg/µl propidium iodide and 100 µg/µl RNase A to visualize DNA and phalloidin FITC to visualize F-actin. Finally, ovaries were washed in blocking solution, in 1x PBS, 1% BSA, and in Slow Fade Light Component C (Molecular Probes, Eugene, OR). Preparations were mounted in Slow Fade Light Component A and analyzed with a Zeiss LSM410 confocal microscope (Fig 3C and Fig D).
| RESULTS |
|---|
Design of the Nap1 knockout construct and the genetic screen:
We used the D. melanogaster Nap1 gene mRNA sequence (GenBank accession no.
U39553; ![]()
- The isolation of a 4.3-kb PCR fragment from genomic DNA of wild-type Drosophila flies containing the Nap1 gene in a central position.
- The introduction of mutations into the wild-type Nap1-coding region, which destroys the function of its protein product. The mutations flank an introduced I-SceI endonuclease cutting site on both sides (Fig 1A).
- The mutations further introduced HindIII and BclI as artificial restriction endonuclease cutting sites and a XhoI and a SalI site were destroyed. These sites were used to track the DNA repair activities responsible for targeted gene knockout events in vivo (Fig 1A).
With these eight primers we isolated and simultaneously mutagenized a 4.3-kb Nap1 fragment from genomic DNA by recombinant PCR (![]()
![]()
![]()
![]()
We carried out three targeting screens as shown in Fig 1B, each using slightly different heat-shock conditions. Table 1 shows the results of the screens. With the red eye-color phenotype as a positive marker we identified eight recombination events with six targeted events and three independent null-mutation Nap1 knockout products.
|
Verification of targeted knockout events:
Two of the eight recombination events genetically segregated with the X chromosome and were not further analyzed. The six remaining recombination events segregated with the second chromosome where the Nap1 gene is located. None of them expressed a mosaic red/white eye-color phenotype when combined with a constitutively expressed FLP recombinase source (![]()
Absence of NAP1 56-kD protein in knockout mutants leads to lethality:
We performed Western blot analyses to further confirm successful targeting and to show if Nap1 knockout flies expressed NAP1 protein (Fig 3A and Fig B). The proximal construct of the targeted Nap1 duplication was designed by introduction of a HindIII site such that the ORF of the Nap1 knockout product would be destroyed close to the initial methionine, thus resulting in no protein product (Fig 1A and Fig C). The distal part of the knockout duplication introduced a BclI site to destroy the ORF in the middle of the Nap1 gene and to damage its nuclear localization signal (Fig 1A and Fig C). By Western blot analysis, we found that no 56-kD wild-type NAP1 protein can be detected either in whole fly protein extracts or in ovaries of homozygous Nap1KO1 and Nap1KO2 knockout flies (Fig 3A and Fig B). Nap1KO3 and Nap1KO4 were not further analyzed because too few homozygous offspring were obtained, which is possibly due to second-site mutations elsewhere in the genome. Homozygous Nap1KO5 and Nap1KO6, however, produced wild-type NAP1 protein (Fig 3B). Southern and repair tract analyses (see below) revealed that these alleles as well as Nap1KO4 were targeted recombination events in which one of the two Nap1 duplicates remained wild type (Fig 2B and Fig C, and Fig 4).
The Drosophila ortholog of Nap1 in humans was identified as a chaperone factor involved in the assembly of nucleosomes (![]()
![]()
![]()
![]()
We further performed immunofluorescence microscopy (Fig 3C and Fig D). NAP1 protein is known to be abundant in the follicle cells of ovaries. Fig 3C and Fig D, shows a confocal laser-scan analysis of the localization of NAP1 in wild-type and homozygous Nap1KO1 mutant ovaries. NAP1 protein levels are specifically concentrated at the basal pole of follicle cells of wild-type ovaries. This accumulation of NAP1 protein was absent in the homozygous Nap1KO1 mutant.
Recombination tracts of knockout alleles:
Southern blot analysis of targeted genomes indicated differences between the molecular structure of individual Nap1 loci (Fig 2B and Fig C). These results encouraged a more detailed investigation of the introduced recombination tract markers. We analyzed conversion tracts that included five markers (X, H, I, B, and S; Fig 4C) in each copy of the Nap1 gene of the six recombinant knock-in duplications by means of PCR with genomic DNA and subsequent restriction analysis. Fig 4A and Fig B, shows an example of this study. First we used a systematic set of side-specific PCR primers to amplify the distal and proximal duplication fragments. We identified four tract classes (Fig 4C). Confirming the Southern blot results (Fig 2), the alleles Nap1KO1 and Nap1KO2 represented the predicted recombination tracts. Nap1KO3 was another true knockout allele, but it possessed a nearly complete donor-derived repair tract except that the I-SceI site was absent. Nap1KO4 was a targeted recombination event but it contained one complete wild-type Nap1 copy at its distal duplication while the proximal duplication was identical to the sequence of the Nap1 donor construct. Nap1KO5 and Nap1KO6 contained the same predicted recombination tracts as Nap1KO1Nap1KO3 on the distal half whereas the proximal replica was completely wild type. ![]()
|
| DISCUSSION |
|---|
The induction of mutations within genes is tightly coupled to our basic understanding of gene function. Precisely defined mutations are therefore a prerequisite to analyze the function of genes and their phenotypic impacts. Unfortunately, although the Drosophila genome has been mutated at very high density, no mutants are known for a significant fraction of genes. The Nap1 gene is one such example where a mutant null allele has not been available. While traditional mutagenesis procedures are based on phenotypic screening (with complex and time-consuming genetic crosses to look for recessive phenotypes), gene targeting requires no prediction of the mutant phenotype. There are convincing arguments that the technique of RNAi (which also does not require knowledge of a phenotype) is simpler on a practical level and therefore is better suited than targeted mutagenesis to overcome the lack of mutants (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Generation of targeted Nap1 mutant alleles:
A mutant null allele for the Drosophila Nap1 gene has not been available so far. Starting from genomic DNA of Canton-S wild-type flies, we used recombinant PCR (![]()
![]()
![]()
![]()
![]()
1 in 16,000 gametes) matched the reported efficiencies (
1 in 500 gametes to
1 in 30,000 gametes) of ![]()
In addition to the six targeted events captured in our screen, we found only two donor integrations that did not map to the Nap1 locus (at polytene-chromosome map position 60A of the second chromosome) but did map to the X chromosome. Neither of these integrations were targeted events at the endogenous white locus caused by homologous recombination with donor-internal white sequences. Targeting in mouse ES cells is often accompanied by high ratios of nontargeted insertions. Actually, when positive-negative selection is not used in ES cell transformation, the bulk of positively selected ES cell clones contain nontargeted insertions outnumbering targeted events by orders of magnitude (![]()
![]()
![]()
A drawback of the insertional targeting procedure (also called "knock-in targeting") is that the mutated gene as well as upstream and downstream regulatory sequences are duplicated. This might affect gene function in an unpredictable manner. Phenotypic and functional analysis of a targeted gene may be impaired further if the gene is small (e.g., 1 kb) and tightly flanked by neighboring genes. Because the donor sequence should be long (e.g., 45 kb) for homology requirements during recombinational DNA repair, it cannot always be avoided that the flanking genes are duplicated as well. This would make functional studies unreliable. These difficulties are now overcome by the use of a meganuclease cutting site (I-CreI) within the integrated pTV2-vector (![]()
![]()
A partial functional analysis of NAP1:
Because the Nap1 gene is large, the donor did not possess additional genes whose altered expression pattern might affect a functional analysis of Nap1. Homozygous Nap1 flies did not express detectable amounts of NAP1 protein (Fig 3). We found that first-generation homozygous mutant Nap1 flies (derived from heterozygous parents) developed until the adult stage, albeit at sub-Mendelian frequencies. These flies showed reduced viability, but they were weakly fertile and gave rise to a second generation of homozygous flies. In these flies, the phenotype became much stronger and more penetrant. The few escaper flies that developed to the adult stage showed impaired development and died a few days after eclosion. A functionally strong maternal component of Nap1 expression at low concentrations (undetectable by Western blot) is probably sufficient to sustain relatively normal development in a significant fraction of homozygous mutant flies derived from heterozygous parents. Only after depletion of the maternally supplied components does the lethal phenotype become fully penetrant. The lethal phenotypes therefore were similar to the phenotype of other gene products thought to be important in nucleosome remodeling. For example, imitation switch (ISWI) homozygotes, where ISWI is the catalytic subunit of three essential chromatin-remodeling complexes NURF, ACF, and CHRAC, die as late larvae or early pupae (![]()
![]()
Recombination tract analysis:
In this study we engineered frameshift point mutations within the coding sequence of the Nap1 gene, which blocked protein expression in the three knockout alleles Nap1KO1, Nap1KO2, and Nap1KO3. Simultaneously these mutations served as markers so that we could monitor conversion tracts in the recombination products over a sequence distance of 1.5 kb. Because ends-in targeting generates a duplication of the donor DNA at the target locus, all markers are represented twice in a given targeting product. With the aid of the markers we identified four different types of recombinant flies among the six targeted recombination events that needed explanation (Fig 4C): Ends-in targeting is triggered by a linearized donor episome, whose DNA ends are sensed by the cell as double-strand DNA damage. The artificial, I-SceI-induced break is thought to stimulate the DNA repair machinery of the cell. The donor construct contained the I-SceI cutting sequence located in the center of the Nap1 gene. Only one of the eight individual recombinant donor duplicates (Fig 4C) still contained an intact I-SceI site (Nap1KO4), but not a single nucleotide of the I-SceI recognition sequence was found in the other seven copies. This result indicated that cellular exonucleolytic activities enlarge the DSB made by I-SceI at least beyond the length of this sequence (18 bp). Both single-strand DNA as well as dsDNA from the staggered I-SceI site cut were removed. This necessitated some trimming activity of both the 3' ssDNA overhang and the 5' double-strand end of the break. Resection of ends is known to occur by 5'-to-3' exonucleases or by an endonuclease associated with a helicase producing long 3'-ended tails (![]()
![]()
![]()
How do the recombination tracts observed in the Nap1 recombination products match known DSB repair pathways? Four prominent DSB repair pathways are relevant for this study: (1) nonhomologous end joining (NHEJ; ![]()
![]()
![]()
![]()
NHEJ is unlikely to play a role during targeted donor integrations. The most frequent DSB repair mechanism of metazoans, NHEJ was first recognized by Barbara McClintock in the early 1940s (![]()
Most likely, recombinational repair mechanisms are responsible for the targeted recombinants. Currently, the classical DSB repair model (![]()
![]()
|
Are there alternative explanations for the targeted recombinants?
A key question is whether the processed free ends of the linearized donor episome invade the target gene in a concerted manner, or whether both ends invade rather independently into template DNA. P-element-induced gap repair in Drosophila established that ectopic template DNA can be efficiently copied into target DNA located on a different chromosome (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
While SDSA is not the mechanism for targeted (knock-in) mutagenesis in Drosophila, the fact that the ends of a DSB undergo a genomewide homology search (![]()
![]()
![]()
![]()
![]()
![]()
|
| ACKNOWLEDGMENTS |
|---|
We thank Kent Golic for the targeting kit fly stocks and the pTV2 vector DNA; David Kuttenkeuler, Julia Zander, Tobias Jursch, Kirsten Schubert, and Mingfa Li for discussions and technical help; and Carlos Flores for critically reading an early version of the manuscript. We also thank two anonymous referees for constructive suggestions on the classical DSB repair model. This work was supported by an EU grant (B.M.M., QLRI-CT-2000-00915), a DFG Emmy Noether fellowship (F.L.), a former HFSP research fellowship (D.-H.L.), and a DFG grant (D.-H.L., LA711/3-1).
Manuscript received September 10, 2002; Accepted for publication November 1, 2002.
| LITERATURE CITED |
|---|
ADAIR, G. M., and R. S. NAIRN, 1995 Gene targeting, pp. 301328 in DNA Repair Mechanisms: Impact on Human Diseases and Cancer, edited by J.-M. H. VOS. Springer-Verlag, Heidelberg, Germany.
ADAMS, M. D. and J. J. SEKELSKY, 2002 From sequence to phenotype: reverse genetics in Drosophila melanogaster. Nat. Rev. Genet. 3:189-198.[Medline]
ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000 The genome sequence of Drosophila melanogaster. Science 287:2185-2195.
AUSUBEL, F., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. (Editors), 1995 Short Protocols in Molecular Biology. John Wiley & Sons, New York.
BALLINGER, D. G. and S. BENZER, 1989 Targeted gene mutations in Drosophila. Proc. Natl. Acad. Sci. USA 86:9402-9406.
BOLLAG, R. J., A. S. WALDMAN, and R. M. LISKAY, 1989 Homologous recombination in mammalian cells. Annu. Rev. Genet. 23:199-225.[Medline]
CAPECCHI, M. R., 1989a Altering the genome by homologous recombination. Science 244:1288-1292.
CAPECCHI, M. R., 1989b The new mouse genetics: altering the genome by gene targeting. Trends Genet. 5:70-76.[Medline]
CARTHEW, R. W., 2001 Gene silencing by double-stranded RNA. Curr. Opin. Cell Biol. 13:244-248.[Medline]
CURTIS, D., S. H. CLARK, A. CHOVNICK, and W. BENDER, 1989 Molecular analysis of recombination events in Drosophila. Genetics 122:653-661.
DEURING, R., L. FANTI, J. A. ARMSTRONG, M. SARTE, and O. PAPOULAS et al., 2000 The ISWI chromatin-remodeling protein is required for gene expression and the maintenance of higher order chromatin structure in vivo. Mol. Cell 5:355-365.[Medline]
ENGELS, W. R., 2000 Reversal of fortune for Drosophila geneticists? Science 288:1973-1975.
ENGELS, W. R., C. R. PRESTON, and D. M. JOHNSON-SCHLITZ, 1994 Long-range cis preference in DNA homology search over the length of a Drosophila chromosome. Science 263:1623-1625.
FLYBASE,, 1999 The FlyBase database of the Drosophila genome projects and community literature. Nucleic Acids Res. 27:85-88. http://flybase.bio.indiana.edu/(.
GLOOR, G. B., N. A. NASSIF, D. M. JOHNSON-SCHLITZ, C. R. PRESTON, and W. R. ENGELS, 1991 Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253:1110-1117.
HIGUCHI, R. (Editor), 1990 Recombinant PCR. Academic Press, San Diego/New York/London.
ISHIMI, Y., J. HIROSUMI, W. SATO, K. SUGASAWA, and S. YOKOTA et al., 1984 Purification and initial characterization of a protein which facilitates assembly of nucleosome-like structure from mammalian cells. Eur. J. Biochem. 142:431-439.[Medline]
ITO, T., M. BULGER, R. KOBAYASHI, and J. T. KADONAGA, 1996 Drosophila NAP1 is a core histone chaperone that functions in ATP-facilitated assembly of regularly spaced nucleosomal arrays. Mol. Cell. Biol. 16:3112-3124.[Abstract]
JOYNER, A. L. (Editor), 1995 Gene Targeting: A Practical Approach. IRL Press/Oxford University Press, Oxford/New York/Tokyo.
KAISER, K. and S. F. GOODWIN, 1990 "Site-selected" transposon mutagenesis of Drosophila. Proc. Natl. Acad. Sci. USA 87:1686-1690.
KELLOGG, D. R. and A. W. MURRAY, 1995 NAP1 acts with Clb1 to perform mitotic functions and to suppress polar bud growth in budding yeast. J. Cell Biol. 130:675-685.
KENNERDELL, J. R. and R. W. CARTHEW, 1998 Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled2 act in the wingless pathway. Cell 95:1017-1026.[Medline]
KRAUS, E., W. Y. LEUNG, and J. E. HABER, 2001 Break-induced replication: a review and an example in budding yeast. Proc. Natl. Acad. Sci. USA 98:8255-8262.
LANKENAU, D.-H., 1995 Genetics of genetics in Drosophila: P elements serving the study of homologous recombination, gene conversion and targeting. Chromosoma 103:659-668.[Medline]
LANKENAU, D.-H. and G. B. GLOOR, 1998 In vivo gap repair in Drosophila: a one-way street with many destinations. Bioessays 20:317-327.[Medline]
LANKENAU, D.-H., V. G. CORCES, and W. R. ENGELS, 1996 Comparison of targeted-gene replacement frequencies in Drosophila melanogaster at the forked and white loci. Mol. Cell. Biol. 16:3535-3544.[Abstract]
LANKENAU, D.-H., M. V. PELUSO, and S. LANKENAU, 2000 The Su(Hw) chromatin insulator protein alters double strand-break repair frequencies in the Drosophila germ line. Chromosoma 109:148-160.[Medline]
LI, M., D. STRAND, A. KREHAN, W. PYERIN, and H. HEID et al., 1999 Casein kinase 2 binds and phosphorylates the nucleosome assembly protein-1 (NAP1) in Drosophila melanogaster. J. Mol. Biol. 293:1067-1084.[Medline]
LIM, J., 1993 In situ hybridization with biotinylated DNA. Dros. Inf. Serv. 72:73-77.
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.
MALKOVA, A., E. L. IVANOV, and J. E. HABER, 1996 Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136.
MANSOUR, S. L., K. R. THOMAS, and M. R. CAPECCHI, 1988 Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336:348-352.[Medline]
MCCLINTOCK, B., 1987 The Discovery and Characterization of Transposable Elements. Garland Publishing, New York/London.
MYERS, E. W., G. G. SUTTON, A. L. DELCHER, I. M. DEW, and D. P. FASULO et al., 2000 A whole-genome assembly of Drosophila. Science 287:2196-2204.
NASSIF, N., J. PENNEY, S. PAL, W. R. ENGELS, and G. B. GLOOR, 1994 Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol. Cell. Biol. 14:1613-1625.
O'NEILL, S. L., R. GIORDANO, A. M. COLBERT, T. L. KARR, and H. M. ROBERTSON, 1992 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. USA 89:2699-2702.
PAQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404.
PAQUES, F., W. Y. LEUNG, and J. E. HABER, 1998 Expansions and contractions in a tandem repeat induced by double-strand break repair. Mol. Cell. Biol. 18:2045-2054.
PRESTON, C. R. and W. R. ENGELS, 1996 P-element-induced male recombination and gene conversion in Drosophila. Genetics 144:1611-1622.[Abstract]
RONG, Y. S. and K. G. GOLIC, 2000 Gene targeting by homologous recombination in Drosophila. Science 288:2013-2018.
RONG, Y. S. and K. G. GOLIC, 2001 A targeted gene knockout in Drosophila. Genetics 157:1307-1312.
RONG, Y. S., S. W. TITEN, H. B. XIE, M. M. GOLIC, and M. BASTIANI et al., 2002 Targeted mutagenesis by homologous recombination in D. melanogaster. Genes Dev. 16:1568-1581.
ROTH, D. B., and J. WILSON, 1988 Illegitimate recombination in mammalian cells, pp. 621654 in Genetic Recombination, edited by R. KULCHERLAPATI and G. R. SMITH. American Society for Microbiology, Washington, DC.
SEUM, C., D. PAULI, M. DELATTRE, Y. JAQUET, and A. SPIERER et al., 2002 Isolation of Su(var)3-7 mutations by homologous recombination in Drosophila melanogaster. Genetics 161:1125-1136.
SILBERMAN, R. and M. KUPIEC, 1994 Plasmid-mediated induction of recombination in yeast. Genetics 137:41-48.[Abstract]
SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999 The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177.
SZOSTAK, J. W., T. L. ORR-WEAVER, R. J. ROTHSTEIN, and F. W. STAHL, 1983 The double-strand-break repair model for recombination. Cell 33:25-35.[Medline]
THOMAS, K. R. and M. R. CAPECCHI, 1987 Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51:503-512.[Medline]
TOROK, I., D. HERRMANN-HORLE, I. KISS, G. TICK, and G. SPEER et al., 1999 Down-regulation of RpS21, a putative translation initiation factor interacting with P40, produces viable minute imagos and larval lethality with overgrown hematopoietic organs and imaginal discs. Mol. Cell. Biol. 19:2308-2321.
VARGA-WEISZ, P. D. and P. B. BECKER, 1998 Chromatin-remodeling factors: Machines that regulate? Curr. Opin. Cell Biol. 10:346-353.[Medline]
WHITE, C. I. and J. E. HABER, 1990 Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. EMBO J. 9:663-673.[Medline]
ZHANG, P., M. Z. LI, and S. J. ELLEDGE, 2002 Towards genetic genome projects: genomic library screening and gene-targeting vector construction in a single step. Nat. Genet. 30:31-39.[Medline]
ZHANG, Y., F. BUCHHOLZ, J. P. MUYRERS, and A. F. STEWART, 1998 A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20:123-128.[Medline]
This article has been cited by other articles:
![]() |
J. Gill, M. Yogavel, A. Kumar, H. Belrhali, S. K. Jain, M. Rug, M. Brown, A. G. Maier, and A. Sharma Crystal Structure of Malaria Parasite Nucleosome Assembly Protein: DISTINCT MODES OF PROTEIN LOCALIZATION AND HISTONE RECOGNITION J. Biol. Chem., April 10, 2009; 284(15): 10076 - 10087. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Stevens, S. Phan, M. G. Frid, D. Alvarez, E. Herzog, and K. R. Stenmark Lung Vascular Cell Heterogeneity: Endothelium, Smooth Muscle, and Fibroblasts Proceedings of the ATS, September 15, 2008; 5(7): 783 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Clark, D. F. Alvarez, M. Alexeyev, J. A. C. King, L. Huang, M. C. Yoder, and T. Stevens Regulatory role for nucleosome assembly protein-1 in the proliferative and vasculogenic phenotype of pulmonary endothelium Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L431 - L439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zlatanova, C. Seebart, and M. Tomschik Nap1: taking a closer look at a juggler protein of extraordinary skills FASEB J, May 1, 2007; 21(7): 1294 - 1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Galichet and W. Gruissem Developmentally Controlled Farnesylation Modulates AtNAP1;1 Function in Cell Proliferation and Cell Expansion during Arabidopsis Leaf Development Plant Physiology, December 1, 2006; 142(4): 1412 - 1426. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhu, A. Dong, D. Meyer, O. Pichon, J.-P. Renou, K. Cao, and W.-H. Shen Arabidopsis NRP1 and NRP2 Encode Histone Chaperones and Are Required for Maintaining Postembryonic Root Growth PLANT CELL, November 1, 2006; 18(11): 2879 - 2892. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Friedeberg, G. Scarlett, J. McGeeghan, A. Abu-daya, M. Guille, and G. Kneale Identification of a structural and functional domain in xNAP1 involved in protein-protein interactions Nucleic Acids Res., October 18, 2006; 34(17): 4893 - 4899. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Hekmat-Scafe, M. Y. Lundy, R. Ranga, and M. A. Tanouye Mutations in the K+/Cl- Cotransporter Gene kazachoc (kcc) Increase Seizure Susceptibility in Drosophila. J. Neurosci., August 30, 2006; 26(35): 8943 - 8954. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Navadgi, B. R. Chandra, P. C. Mishra, and A. Sharma The Two Plasmodium falciparum Nucleosome Assembly Proteins Play Distinct Roles in Histone Transport and Chromatin Assembly J. Biol. Chem., June 23, 2006; 281(25): 16978 - 16984. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Okuwaki, K. Kato, H. Shimahara, S.-i. Tate, and K. Nagata Assembly and Disassembly of Nucleosome Core Particles Containing Histone Variants by Human Nucleosome Assembly Protein I Mol. Cell. Biol., December 1, 2005; 25(23): 10639 - 10651. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Abu-Daya, W. M. Steer, A. F. Trollope, C. E. Friedeberg, R. K. Patient, A. W. Thorne, and M. J. Guille Zygotic nucleosome assembly protein-like 1 has a specific, non-cell autonomous role in hematopoiesis Blood, July 15, 2005; 106(2): 514 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dong, Z. Liu, Y. Zhu, F. Yu, Z. Li, K. Cao, and W.-H. Shen Interacting Proteins and Differences in Nuclear Transport Reveal Specific Functions for the NAP1 Family Proteins in Plants Plant Physiology, July 1, 2005; 138(3): 1446 - 1456. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Park, J. V. Chodaparambil, Y. Bao, S. J. McBryant, and K. Luger Nucleosome Assembly Protein 1 Exchanges Histone H2A-H2B Dimers and Assists Nucleosome Sliding J. Biol. Chem., January 21, 2005; 280(3): 1817 - 1825. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Marhold, K. Kramer, E. Kremmer, and F. Lyko The Drosophila MBD2/3 protein mediates interactions between the MI-2 chromatin complex and CpT/A-methylated DNA Development, December 15, 2004; 131(24): 6033 - 6039. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Gong and K. G. Golic Genomic Deletions of the Drosophila melanogaster Hsp70 Genes Genetics, November 1, 2004; 168(3): 1467 - 1476. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Xie and K. G. Golic Gene Deletions by Ends-In Targeting in Drosophila melanogaster Genetics, November 1, 2004; 168(3): 1477 - 1489. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lankenau, S.
- Articles by Lankenau, D.-H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lankenau, S.
- Articles by Lankenau, D.-H.
















