Genetics, Vol. 163, 545-555, February 2003, Copyright © 2003

Short-Chain Fatty Acid Activation by Acyl-Coenzyme A Synthetases Requires SIR2 Protein Function in Salmonella enterica and Saccharomyces cerevisiae

Vincent J. Staraia, Hidekazu Takahashib, Jef D. Boekeb, and Jorge C. Escalante-Semerenaa
a Department of Bacteriology, University of Wisconsin, Madison, Wisconsin 53726-4087 and
b Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Corresponding author: Jorge C. Escalante-Semerena, University of Wisconsin, Madison, WI 53726-4087., escalante{at}bact.wisc.edu (E-mail)

Communicating editor: F. WINSTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

SIR2 proteins have NAD+-dependent histone deacetylase activity, but no metabolic role has been assigned to any of these proteins. In Salmonella enterica, SIR2 function was required for activity of the acetyl-CoA synthetase (Acs) enzyme. A greater than two orders of magnitude increase in the specific activity of Acs enzyme synthesized by a sirtuin-deficient strain was measured after treatment with homogeneous S. enterica SIR2 protein. Human SIR2A and yeast SIR2 proteins restored growth of SIR2-deficient S. enterica on acetate and propionate, suggesting that eukaryotic cells may also use SIR2 proteins to control the synthesis of acetyl-CoA by the level of acetylation of acetyl-CoA synthetases. Consistent with this idea, growth of a quintuple sir2 hst1 hst2 hst3 hst4 mutant strain of the yeast Saccharomyces cerevisiae on acetate or propionate was severely impaired. The data suggest that the Hst3 and Hst4 proteins are the most important for allowing growth on these short-chain fatty acids.


SHORT-CHAIN fatty acids (SCFAs) such as acetate and propionate are used as sources of carbon and energy by prokaryotes occupying diverse habitats such as soil, where acetate and propionate are the most abundant fatty acids (BUCKEL 1999 Down), or the gastrointestinal tract of humans, where the concentration of acetate and propionate can reach high levels (CUMMINGS et al. 1987 Down). All catabolic pathways for acetate and propionate require these SCFAs to be activated into their corresponding SCFAcyl-CoA forms before they can be converted into metabolites that can enter central metabolism. Acetyl-CoA feeds directly into the TCA cycle, whereas propionyl-CoA can be catabolized via a number of different pathways that convert it into pyruvate, acetate, or succinyl-CoA, which then enter the TCA cycle (HORSWILL and ESCALANTE-SEMERENA 1997 Down).

In enteric bacteria such as Escherichia coli and Salmonella enterica, acetate is activated into acetyl-CoA via either one of two pathways (Fig 1). The first pathway requires the involvement of the acetate kinase (AckA, EC 2.7.2.1) and phosphotransacetylase (Pta, EC 2.3.1.8) enzymes. In these bacteria AckA and Pta are responsible for the synthesis of acetyl-CoA when acetate is present in high concentrations in the environment (>=30 mM acetate). This pathway is considered to be the low-affinity pathway for acetate activation. The second pathway for the activation of acetate requires the activity of the ATP-dependent acetate:CoA ligase (AMP forming, EC 6.2.1.1; i.e., acetyl-CoA synthetase) encoded by the acs gene. Acetyl-CoA synthetase (Acs) is required when the concentration of acetate in the environment is low (<=10 mM acetate); thus this pathway is considered to be the high-affinity pathway for acetate activation. In S. enterica propionate can be activated to propionyl-CoA by the ATP-dependent propionate:CoA ligase (AMP forming, EC 6.2.1.17; i.e., propionyl-CoA synthetase) encoded by the prpE gene of the prpBCDE operon (HORSWILL and ESCALANTE-SEMERENA 1997 Down, HORSWILL and ESCALANTE-SEMERENA 1999A Down, HORSWILL and ESCALANTE-SEMERENA 2001 Down, HORSWILL and ESCALANTE-SEMERENA 2002 Down). The prpBCDE operon of this bacterium encodes functions needed for the catabolism of propionate via the 2-methylcitric acid cycle (HORSWILL and ESCALANTE-SEMERENA 1999B Down, HORSWILL and ESCALANTE-SEMERENA 2001 Down). In addition, S. enterica has two distinct propionate kinases (PduW, TdcD), but the genes encoding these enzymes (pduW, tdcD) are part of the propanediol utilization (pduABCDEGHJKLMNOPQSTUVWX) and threonine decarboxylation (tdcBCDEG) operons whose expression is induced only under specific growth conditions (HESSLINGER et al. 1998 Down; BOBIK et al. 1999 Down; S. PALACIOS and J. C. ESCALANTE-SEMERENA, unpublished results). Hence, under conditions where the pduW and tdcD genes are not expressed, propionate activation to propionyl-CoA occurs only via the high-affinity propionyl-CoA synthetase-dependent pathway (HORSWILL and ESCALANTE-SEMERENA 1999A Down).



View larger version (15K):
In this window
In a new window
Download PPT slide
 
Figure 1. Pathways for SCFAcyl-CoA synthesis in S. enterica. In the low-affinity pathway, acetate kinase (AckA, EC 2.7.2.1) catalyzes the synthesis of acetyl-phosphate, two propionate kinases (encoded by pduW and tdcD) catalyze the synthesis of propionyl-phosphate, and phosphotransacetylase (Pta, EC 2.3.1.8) converts acyl-phosphate to acyl-CoA. The high-affinity pathway of acyl-CoA synthesis involves AMP-forming acyl-CoA synthetases.

S. enterica mutant strains that carry a wild-type prpBCDE operon and are unable to grow on propionate as carbon and energy source have been isolated. One of these mutant strains is of particular interest because its inability to grow on propionate is due to the inactivation of the cobB gene, which encodes a homolog of the SIR2 family of eukaryotic regulatory proteins (i.e., sirtuins; TSANG and ESCALANTE-SEMERENA 1998 Down). Sirtuins from eukaryotes and prokaryotes are Zn-containing proteins with NAD+-dependent histone deacetylase activity that are implicated in the process of gene silencing and cell aging (FREY 1999 Down; TANNY et al. 1999 Down; IMAI et al. 2000 Down; LANDRY et al. 2000A Down, LANDRY et al. 2000B Down; SMITH et al. 2000 Down; TANNER et al. 2000 Down; TANNY and MOAZED 2000 Down; MCVEY et al. 2001 Down; MIN et al. 2001 Down; SAUVE et al. 2001 Down; TISSENBAUM and GUARENTE 2001 Down). The sirtuin protein of the archaeon Sulfolobus sulfataricus was recently shown to regulate the affinity of the major chromatin protein for DNA in this prokaryote by modulating the level of acetylation of this protein (BELL et al. 2002 Down).

In this article, we report results from experiments aimed at identifying a role for sirtuins in metabolism, with the ultimate goal of learning about how metabolic processes may affect cell aging. The data obtained indicate that in S. enterica CobB sirtuin function is required for the activation of the short-chain fatty acids acetate and propionate to their corresponding acyl-CoA derivatives by acyl-CoA synthetases (BROWN et al. 1977 Down; KUMARI et al. 1995 Down; HORSWILL and ESCALANTE-SEMERENA 1999A Down). Both human SIR2A and the yeast SIR2 proteins restored growth of sirtuin-deficient strains of S. enterica on acetate and propionate, suggesting that this newly identified metabolic role of sirtuins may be widely distributed or that the specificity of sirtuins for their substrates is not very high. The yeast Saccharomyces cerevisiae encodes five sirtuins in its genome. These include the founding member of the family, SIR2 itself, a closely related paralog, HST1, HST2, a more distantly related paralog, and a pair of genes, HST3 and HST4, that are the most distantly related to SIR2 but are closely related to each other. Previous studies show that hst3 hst4 mutants show a variety of synthetic phenotypes, including slow growth, temperature sensitivity, and a variety of cell cycle and chromosome instability phenotypes (BRACHMANN et al. 1995 Down). In support of the idea that the conclusions reached by studying S. enterica might have phylogenetically wider implications, a strain of S. cerevisiae lacking all five sirtuin functions was shown to grow poorly on acetate as carbon and energy source. Further analysis of these phenotypes suggested that the Hst3 and Hst4 sirtuins are most important for allowing growth on these SCFAs.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Bacterial and yeast strains, media, chemicals, and growth conditions:
All bacterial strains used in this study were derivatives of S. enterica serovar Typhimurium LT2. The genotypes of bacterial and yeast strains and plasmids used are listed in Table 1. S. enterica strains were grown on minimal medium (BERKOWITZ et al. 1968 Down) supplemented with MgSO4 (1 mM), L-methionine (0.5 mM), and a trace minerals solution (BALCH and WOLFE 1976 Down). Luria-Bertani broth (LB) was the rich medium used to grow S. enterica strains. Growth curves were performed in 96-well microtiter dishes (Becton-Dickinson, Cockeysville, MD) using a computer-controlled SpectraMAX PLUS spectrophotometer (Molecular Devices, Sunnyvale, CA), with the incubation chamber set at 37°. A 2-µl sample of an overnight culture of S. enterica was used to inoculate 198 µl of freshly prepared minimal medium in each well, supplemented with the appropriate carbon source at the indicated concentrations. Data points were collected every 5 min, with shaking for 240 sec between readings. Expression of genes under the control of the ParaBAD promoter was induced by including L-(+)-arabinose at a final concentration of 200 µM for propionate growth and 500 µM for acetate growth. Ampicillin was used at 100 µg/ml. All chemicals were purchased from Sigma (St. Louis), unless otherwise stated. [1-14C]Acetate (sp. act., 51 mCi/mmol) and [1-14C]propionate (sp. act., 55 mCi/mmol) were purchased from Moravek Biochemicals (Brea, CA). Yeast media were based on yeast peptone (YP) base, which is 10 g/liter yeast extract and 20 g/liter Bacto-peptone, and were supplemented with 0.32 g/liter L-tryptophan and 0.184 g/liter adenine hemisulfate (to suppress red pigment formation in ade2 mutants). YPD medium was prepared as described (ROSE et al. 1990 Down). YP0 medium contained no added carbon/energy source; YPD contained (111 mM or 2% w/v) dextrose; YPAc contained NaAcetate (244 mM or 2% w/v); YPPro contained Na propionate (50 mM) and glycerol (1 mM); YPGE contained glycerol (218 mM or 2% w/v) and ethanol (2% v/v).


 
View this table:
In this window
In a new window

 
Table 1. Strains and plasmid list

Construction of the quintuple mutant yeast strain:
A series of hst disruption mutations was generated in the YPH499/500 background (SIKORSKI and HIETER 1989 Down) or the FY2 background (WINSTON et al. 1995 Down). In the former background, the following alleles were constructed: hst1{Delta}2::LEU2, hst2{Delta}2::TRP1, hst3{Delta}3::HIS3, hst4{Delta}1::URA3, and sir2{Delta}1::URA3. In the latter background, hst1{Delta}3::TRP1, hst2{Delta}1::TRP1, hst3{Delta}3::TRP1, hst4{Delta}1::TRP1, and sir2{Delta}2::TRP1 were created. Details of alleles structures and strain construction have been published (BRACHMANN 1996 Down).

Plasmid constructions:
Construction of plasmid pACK3: The S. enterica ackA gene was PCR amplified from the chromosome, using the forward primer 5' GCTACGCTCTATGGCTCA 3' and the reverse primer 5' GAAATCAGGCAGTCAGAC 3'. The sequence used to obtain these primers was made available from the S. typhimurium genome sequencing project at Washington University at St. Louis (http://genome.wustl.edu/gsc/projects/S.typhimurium). The resulting 1.2-kb fragment containing ackA was A-tailed and ligated into pGEM-T (Promega, Madison, WI), according to manufacturer's instructions. The resulting plasmid contained the ackA gene in the orientation for expression from PlacZ. This intermediate vector was digested with SacI and SphI, and the 1.3-kb fragment containing the ackA gene was gel purified away from the linearized vector. This insert was ligated into the arabinose-inducible vector pBAD30 (GUZMAN et al. 1995 Down), which was digested with the same enzymes. The resulting 6.2-kb plasmid was named pACK3.

Construction of plasmid pCOBB8: The cobB gene was amplified from the S. enterica chromosome using the forward primer 5' TTACATCTTACCGACTAATC 3' and the reverse primer 5' CGTAACGTGAAATGTAGGC 3'. An 898-bp fragment was A-tailed and ligated into vector pGEM-T, according to manufacturer's instructions. This intermediate vector contained the cobB gene in the orientation for expression from the PlacZ promoter. This construct was digested with SacI and SphI enzymes, and the 968-bp cobB+ fragment was ligated into vector pBAD30 cut with the same enzymes. The resulting 5.9-kb plasmid was named pCOBB8.

Construction of plasmid pCAR325 (pGEX4T3-huSIR2A): Human Sir2A cDNA was obtained from an EST clone (GenBank accession no. T66100). The sequence was determined (S. DEVINE, C. B. BRACHMANN and J. D. BOEKE, unpublished data) and the insert was released by digestion with NcoI and filling in with Klenow fragment; following phenol extraction NotI was added. This insert was inserted into expression vector pGEX4T-3 (Pharmacia) between the SmaI and NotI sites, generating an in-frame glutathione S-transferase fusion. This protein has been expressed and purified and has NAD+-dependent histone deacetylase activity (SMITH et al. 2000 Down).

Phage P22 transductions: All transductional crosses were performed as previously described (DAVIS et al. 1980 Down) with phage P22 HT105/1 int-210 (SCHMIEGER 1971 Down; SCHMIEGER and BAKHAUS 1973 Down). Transductants were freed of phage as described (CHAN et al. 1972 Down).

Determination of the rates of accumulation of propionate and acetate:
A 50-µl sample of an overnight culture of the appropriate S. enterica strain grown in LB at 37° was used to inoculate 5 ml of minimal medium containing succinate (30 mM) as the carbon source (to allow growth of sirtuin mutant strains) and 15 mM of either acetate or propionate. These cultures were grown at 37° to an optical density (OD600) of 0.7. At this point, 1.5 ml of culture was harvested by centrifugation with an IEC Centra-M centrifuge (International Equipment, Needham Heights, MA) at 13,000 x g for 2 min. The supernatant was decanted, and the cell pellet was washed twice with minimal medium lacking a carbon source. After the second wash, the cell pellet was resuspended in 300 µl of NCE supplemented with MgSO4 and L-methionine. These suspensions were incubated at 37° in a Tropi-Cooler variable temperature block (Boekel Scientific, Feasterville, PA), until the start of the assay. The assay was started by the addition of 100 µl of prewarmed cell suspension to 2 ml of minimal medium in 13 x 100 mm test tubes, also prewarmed to 37°. Mixing was achieved by vortexing and tubes were placed in a shaking water bath set to 37° for 7 min, after which radiolabeled [1-14C]acetate or [1-14C]propionate was added to a final concentration of 200 µM. The specific activities of radiolabeled acetate or propionate in the medium were 9.2 mCi/mmol and 9.9 mCi/mmol, respectively. Samples (100 µl each) of the mixture were withdrawn at 1-min intervals over 10 min, filtered through 0.45-µm filter discs (Pall Life Sciences, Ann Arbor, MI) under vacuum and washed with 10 ml of ice-cold 50 mM sodium phosphate buffer, pH 7.0, containing 10 mM of nonradioactive acetate or propionate. The filter discs were then placed into 6 ml of Scinti-Safe scintillation fluid (Fisher Scientific, Pittsburgh) and counted in a Packard Tri-Carb 2100TR scintillation counter (Packard Instrument, Downers Grove, IL) for 1 min. Time zero time points included all components of the assay, except for the addition of cells. The remaining 200 µl of the cell suspension was used to determine protein concentration.

Determination of acetyl-CoA synthetase activity:
Five-ml overnight cultures of the appropriate S. enterica strains grown in LB at 37° were subcultured into 500 ml of minimal medium containing 30 mM succinate as a carbon and energy source. These cultures were allowed to grow overnight with shaking at 37°. The cells were harvested by centrifugation at 9000 x g for 15 min with a Sorvall RC-5B refrigerated centrifuge (Dupont Instruments, Wilmington, DE) fitted with a GSA rotor. The cell pellets were resuspended in 10 ml 50 mM HEPES buffer, pH 7.5, containing 200 µM Tris(2-carboxyethyl)phosphine (TCEP) hydrochloride (Pierce Chemical, Rockford, IL) as a reducing agent. Cells were broken in a French press (Aminco). Crude extracts were collected and immediately dialyzed in SnakeSkin 10,000 MWCO dialysis tubing (Pierce) against 500 ml of the original resuspension buffer at 4°. Each extract was allowed to dialyze for a minimum of 3 hr, with buffer changes each hour. Dialyzed cell-free extracts were collected, and protein concentration was determined (BRADFORD 1976 Down). Reaction mixtures (final volume, 100 µl) contained 50 mM HEPES buffer, pH 7.5, 200 µM TCEP, 236 µM radiolabeled [1-14C]acetate (specific activity, 8.1 mCi/mmol), 5 mM coenzyme A, and 5 mM Mg/ATP. Reactions were started by the addition of cell-free extract (100 µg of protein). Some reaction mixtures also contained 10 µg of purified S. enterica CobB sirtuin. When added, NAD+ was present at a final concentration of 5 mM. Reaction mixtures were incubated at 37° for 1 hr, stopped by the addition of 20 µl of 1 M formic acid, and filtered through 0.45-µm Spin-X centrifuge tube filters (Corning, Corning, NY) in an IEC Centra-M centrifuge (International Equipment Company) at 13,000 x g for 5 min. Components of the reaction mixtures were resolved by thin layer chromatography (TLC) on Whatman PE SIL G/UV silica gel TLC (Whatman, Maidstone, Kent, England). Five microliters from each mixture was spotted onto a 20 x 20-cm plate, allowed to dry, and developed with a chloroform:methanol (3:2) solvent system. Acetyl-coenzyme A was retained at the origin under these conditions. Free, underivatized acetate was clearly resolved from acetyl-CoA (Rf = 0.89). The amount of label retained at the origin was determined by scintillation counting using a Packard Tri-Carb 2100TR scintillation counter for 1 min. Background level was determined with reactions that lacked protein extract, but contained all other components of the reaction.

Protein determination:
Protein concentration in samples was determined using the Bradford Bio-Rad protein assay protocol (Bio-Rad Laboratories, Hercules, CA) with BSA as standard, according to manufacturer's instructions.

Purification of the CobB sirtuin:
Salmonella enterica strain JE4349 was used to overexpress cobB as described (TSANG and ESCALANTE-SEMERENA 1998 Down). Cells were harvested by centrifugation (10,415 x g) at 4° for 10 min with a Sorvall GSA rotor and RC-5B refrigerated centrifuge (DuPont). Cells were disrupted using a French pressure cell (Spectronic, Rochester, NY). For this purpose cell pellets were resuspended in 35 ml of 50 mM Tris-HCl buffer, pH 7.5 (at 4°), 1 mM EDTA, 200 µM phenylmethylsulfonyl fluoride, and 5 mM dithiothreitol (DTT) and broken with two passes in the French press at 1.034 x 108 kPa. Cell debris was discarded by centrifugation at 43,140 x g for 45 min at 4° using a Sorvall SS34 rotor (DuPont). CobB sirtuin was precipitated out of the resulting clarified cell-free extract (31 ml) with ammonium sulfate (41% saturation) on ice. Precipitated proteins were allowed to stand on ice for 10 min and were collected by centrifugation at 11,951 x g in a Sorvall SS34 rotor. The protein pellet was solubilized with 10 ml of 50 mM Tris-HCl buffer, pH 7.5 (at 4°), 1 mM EDTA, and 1 mM DTT. Purified CobB sirtuin was dialyzed overnight at 4° against 1 liter of the same buffer, loaded onto a 20-ml (1.5 x 11 cm) fast-flow DEAE-650M ToyoPearl anion exchange resin (Rhom & Haas) equilibrated with 50 mM Tris-HCl buffer, pH 7.5 (at 4°), 1 mM EDTA, and 1 mM DTT at a rate of 100 ml/hr. After loading the protein on the column, the latter was washed with 30 ml of the equilibration buffer, followed by a 200-ml gradient from zero to 0.25 M NaCl in the same equilibration buffer. Five-ml fractions were collected, and their protein contents were analyzed by SDS-PAGE (LAEMMLI 1970 Down) and Coomassie blue staining (SASSE 1991 Down). CobB sirtuin eluted between 0.1 to 0.2 M NaCl. Fractions containing CobB sirtuin were pooled and concentrated using Centricon concentrators (Millipore, Bedford, MA) to a final volume of 11 ml. Concentrated fractions were dialyzed overnight at 4° against 1 liter of equilibration buffer. Dialyzed CobB sirtuin was loaded onto a 10-ml (1.5 x 5.5 cm) Cibacron Blue 3GA (Sigma) column equilibrated with the same equilibration buffer at 15 ml/hr. After loading, the column was washed with 40 ml of the equilibration buffer, 3-ml fractions were collected, and CobB sirtuin was eluted in the wash step. Fractions containing the bulk of the CobB sirtuin were pooled and concentrated to ~2 ml. The concentrated protein was saved at -90° in 50% glycerol, 25 mM Tris-HCl buffer at pH 7.5 (at 4°), 1 mM EDTA, and 10 mM DTT.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Eukaryotic sirtuins compensate for the lack of CobB sirtuin function during growth of S. enterica on propionate:
Previous work showed that sirtuin-deficient strains of S. enterica grow very poorly on propionate as carbon and energy source, but the precise role of the sirtuin in propionate catabolism remained unclear (TSANG and ESCALANTE-SEMERENA 1996 Down). To investigate whether eukaryotic sirtuins could compensate for the lack of sirtuin activity in S. enterica cobB mutants during growth on propionate, plasmids carrying cDNA clones of either the human SIR2A gene (pCAR325-huSIR2A) or the S. cerevisiae SIR2 gene (pGEX-SIR2) were introduced into strain JE2445 [cobB1176::Tn10d(Tc)]. Fig 2 shows representative growth behavior data of the cobB mutant carrying the human sirtuin in trans. Low-level expression of the human SIR2A protein restored growth of the cobB mutant on propionate to almost wild-type rates (Fig 2, solid diamonds vs. solid squares). In contrast, increased expression of the human sirtuin resulted in the complete inhibition of growth (Fig 2, open diamonds). Similar observations were made when yeast Sir2p was overexpressed in yeast (HOLMES et al. 1997 Down). The mechanism of growth inhibition in S. cerevisiae was proposed to be defects in chromosome segregation resulting from altered histone acetylation. The reason for the observed growth inhibition in S. enterica is unclear. Expression of the S. cerevisiae gene failed to compensate for the lack of CobB sirtuin as efficiently as the human gene did (Fig 2, open circles), but the observed improvement measured in the presence of the yeast sirtuin was significant and reproducible. These results indicated that the eukaryotic sirtuins were able to perform whatever role the CobB sirtuin plays in propionate catabolism in S. enterica.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 2. Eukaryotic sirtuins restore growth of S. enterica sirtuin mutants on propionate. The concentration of propionate in the medium was 30 mM. Additional components of the medium are described in MATERIALS AND METHODS. JE4175 (cobB+/pBAD30), solid squares; strain JE4872 (cobB/pBAD30), solid triangles; JE5318 (cobB/pCOBB8), open squares; JE6557 (cobB/pGEX-huSIR2A), solid diamonds; JE6558 (cobB/pGEX-SIR2), open circles. Growth response upon induction of the pGEX plasmids by 50 µM isopropyl thiogalactoside is represented by open diamonds (strain JE6557).

Sirtuin-deficient strains of S. enterica grow poorly on low levels of acetate:
As shown in Fig 3, sirtuin mutants were also unable to use acetate as carbon and energy source. At a low concentration (10 mM), acetate failed to support growth of the sirtuin mutant (Fig 3A, triangles) in spite of the fact that the strain carried in its genome a wild-type allele of the acs gene encoding the high-affinity acetyl-CoA synthetase enzyme. The wild-type strain grew well under these conditions. In contrast, high concentrations of acetate in the medium (i.e., 30–50 mM) greatly improved growth of the sirtuin mutant (Fig 3B and Fig C). In medium containing 30 mM acetate the doubling time of the sirtuin mutant strain (doubling time, 9 hr, Fig 3B, triangles) almost matched the rate of the wild-type strain (doubling time, 7 hr, Fig 3B, squares). When the concentration of acetate was increased to 50 mM, the doubling times of the cobB- and cobB+ strains were almost identical (Fig 3C, doubling time, 5.7 hr, cobB+, squares vs. doubling time, 6 hr, cobB-, triangles) consistent with the idea that sirtuin function was needed for activation of acetate by the high-affinity Acs enzyme, but not for the activation of acetate by the low-affinity acetate kinase (AckA)/Pta enzyme system.



View larger version (20K):
In this window
In a new window
Download PPT slide
 
Figure 3. Growth of sirtuin-proficient and sirtuin-deficient strains of S. enterica on acetate. The concentration of acetate in the medium was as indicated. The growth behavior of strains TR6583 (cobB+) and JE2445 [cobB1176::Tn10d (Tc)] is shown by squares and triangles, respectively.

Growth of S. enterica sirtuin mutants on propionate or acetate is restored upon overexpression of an acetyl or propionyl kinase enzyme:
On the basis of the results presented above, it was predicted that expression of an acyl kinase would bypass the need for sirtuin function during growth on acetate or propionate. To test this idea, the propionate kinase enzyme encoded by tdcD and the acetate kinase enzyme encoded by ackA were cloned separately on a vector containing an arabinose-inducible promoter. Data in Table 2 show that overexpression of ackA allowed the sirtuin-deficient strain to reach a cell density similar to that of the wild-type strain (Table 2, column E, line 3 vs. 5) at approximately the same rate on acetate medium (Table 2, column D, line 3 vs. 5). Growth of the sirtuin mutant on propionate was restored by either a cobB+ or a tdcD+ allele in trans (Table 2, columns D and E, line 3 vs. 4). These data indicated that the synthesis of propionyl-phosphate by overproduced TdcD enzyme could bypass the need for sirtuin function. AckA only partially substituted for TdcD during growth on propionate (Table 2, column C, line 3 vs. 5). This was evidence that AckA could synthesize propionyl-phosphate in vivo. Similarly, the TdcD enzyme partially substituted for AckA during growth on acetate (Table 2, columns D and E, line 4 vs. 5).


 
View this table:
In this window
In a new window

 
Table 2. Acyl kinase-dependent growth rates of cobB mutant strains

Phosphotransacetylase enzyme activity is required for propionate kinase-dependent growth of an S. enterica sirtuin mutant on propionate:
The above results suggested that the low-affinity system of acyl-CoA synthesis was responsible for sirtuin-independent synthesis of acetyl- and propionyl-CoA. To investigate this possibility, the pta gene was inactivated in several genetic backgrounds, and growth of the mutant strains on acetate or propionate was assessed. As shown in Fig 4, the sirtuin mutant grew poorly on propionate as carbon and energy source, but this growth behavior was reproducible. The rate of growth of the sirtuin mutant was sixfold slower (Fig 4A, solid triangles, doubling time, 36 hr) than that of the wild-type strain (Fig 4A, solid squares, doubling time, 6 hr). The slow, but reproducible growth of the sirtuin-deficient strain on propionate was completely eliminated upon inactivation of the pta gene (Fig 4A, open triangles). Overexpression of the propionate kinase encoded by the tdcD+ allele (plasmid pTDCD1 (ParaBAD-tdcD+) failed to restore growth of strain JE4718 (cobB- pta-) on propionate (data not shown), a result consistent with the sirtuin-independent pathway of acyl-CoA synthesis being the low-affinity acyl-CoA synthesis pathway. Strain JE4597 (cobB+ pta-) grew as well as strain TR6583 (cobB+ pta+) on propionate (Fig 4A, open squares vs. solid squares), indicating that Pta function was not required for the sirtuin-dependent pathway. Similar results were obtained when the experiment was repeated with acetate as carbon and energy source (Fig 4B).



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 4. Evidence for sirtuin-dependent and sirtuin-independent activation of acetate and propionate. Growth behavior of strains on 30 mM propionate (A and C) and 30 mM acetate (B and D). Solid squares, TR6583 (cobB+ prpE+ acs+ pta+); solid triangles, JE2445 (cobB- prpE+ acs+ pta+); open squares, JE4597 (cobB+ prpE+ acs+ pta); solid triangles, JE4718 (cobB prpE+ acs+ pta); solid diamonds, JE4313 (cobB+ prpE acs pta+); and open diamonds, JE6290 (cobB+ prpE acs pta).

Sirtuin-dependent growth of S. enterica on acetate or propionate requires acetyl- or propionyl-CoA synthetase activity:
It was important to determine whether sirtuin function was required for the synthesis of acyl-CoA via the low-affinity acyl kinase/phosphotransacetylase system or via the high-affinity acyl-CoA synthetase-dependent pathway (Fig 1). Toward this end, genes encoding acyl-CoA synthetases capable of synthesizing propionyl-CoA (i.e., prpE, acs; HORSWILL and ESCALANTE-SEMERENA 1999A Down) were inactivated in a strain carrying the wild-type cobB+ allele. As seen in Fig 4C, strain JE4313 (cobB+ {Delta}1231acs prpE213::kan+) grew very poorly on propionate (solid diamonds; doubling time, 50 hr), but this growth was reproducible. Inactivation of the pta gene in strain JE4313 completely blocked growth on propionate (Fig 4C, open diamonds). Similar results were obtained when acetate was used as the sole source of carbon and energy. Unlike growth on propionate, however, growth of the acyl-CoA sythetase double mutant (prpE acs) on acetate was biphasic (Fig 4D, solid diamonds). The meaning of this behavior is unclear. These results indicated that sirtuin function was part of the high-affinity, acyl-CoA synthetase-dependent pathway of acyl-CoA synthesis.

In S. enterica, the lack of sirtuin or acyl-CoA synthetase (Acs/PrpE) activities result in a drastic decrease in the intracellular level of propionate or acetate:
The intracellular level of acetate and propionate was measured to determine if the observed lack of growth on these SCFAs was due to insufficient levels of substrate for the acyl-CoA synthetases. As seen in Fig 5A, the rate of intracellular accumulation of propionate in the sirtuin mutant was ~16-fold slower (0.93 ± 0.22 nmol of propionate accumulated per milligram of protein per minute) than the rate measured in the sirtuin-proficient strain (14.84 ± 0.50 nmol of propionate accumulated per milligram of protein per minute; Fig 5A, squares vs. triangles). An even more pronounced effect in the rate of propionate accumulation was measured in the strain lacking acyl-CoA synthetase activities (Acs, PrpE; 0.43 ± 0.09 nmol of propionate accumulated per milligram of protein per min; Fig 5A, squares vs. circles). Similar results were obtained when acetate accumulation was assessed (Fig 5B).



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 5. Kinetics of SCFA accumulation in wild-type and mutant strains. (A) Propionate accumulation. (B) Acetate accumulation. The kinetics of accumulation of SCFAs by the sirtuin-proficient, acyl-CoA synthetase-proficient (cobB+ prpE+ acs+) strain is shown by squares; the kinetics for the sirtuin mutant (cobB) strain is shown by triangles, and the kinetics for the acyl-CoA synthethase double mutant (prpE acs) strain is shown by circles.

Sirtuin function is required for growth of S. cerevisiae on acetate or propionate:
The yeast S. cerevisiae genome contains five sirtuins, SIR2 and HST1–4. We examined whether defects in SCFA metabolism were evident by examining the growth properties of yeast cells bearing mutations in SIR2 or its paralogues, HST1, HST2, HST3, and HST4. The growth of these mutants was analyzed on rich (YP) medium containing various carbon and energy sources, including acetate and propionate. No defects were noted in any of the single mutants (Fig 6A). However, quintuple sir2 hst1 hst2 hst3 hst4 mutant strains had significant growth defects on the SCFA-containing plates (Fig 6B, bottom). These growth defects became worse as the concentration of SCFA increased (not shown). These defects appeared to be specific to SCFAs because these growth defects were not observed when these strains were grown on plates with no additional carbon sources (Fig 6, YP0), with glycerol/ethanol (Fig 6, YPGE), or with glucose (data not shown). We tested the possibility that the closely related paralogous pairs, SIR2/HST1 or HST3/HST4, had similar functions in SCFA metabolism. To examine this possibility, we constructed and tested sir2 hst1 and hst3 hst4 double mutants (Fig 6B). The sir2 hst1 mutant grew well on acetate and propionate. The hst3 hst4 double mutant is more challenging to analyze due to its well-known genomic instability (BRACHMANN et al. 1995 Down; BRACHMANN 1996 Down). Many but not all isolates of hst3 hst4 mutants showed a defect in growth on acetate and propionate. The extent of the defect varied from colony to colony. We tested five different hst3 hst4 mutants from three different strain backgrounds (data not shown) and four of these showed growth defect on propionate. These experiments suggest that both HST3 and HST4 are involved in SCFA metabolism in yeast, as the corresponding single mutants showed no growth defects on SCFAs.



View larger version (78K):
In this window
In a new window
Download PPT slide
 
Figure 6. Yeast sirtuin mutants grow poorly on SCFA-containing media. (A) Single sir2 and hst mutants grow normally on SCFA-containing media. Yeast cells grown on YPD plates were resuspended in water, adjusted to OD600 of 0.1, and serially diluted fivefold in a 96-well tray. Three microliters of each suspension was spotted onto the yeast extract peptone media plates containing the following carbon sources: YP0, no additional carbon source; YPGE, glycerol and ethanol; YPAc, acetate; and YPPro, propionate (see MATERIALS AND METHODS). The plates were incubated for 1 week in a humidified chamber at 30°. Strains spotted were (top to bottom): YCB617 (SIR2+ HST+), YCB426 (sir2), YCB423 (hst1), YCB1097 (hst2), YCB470 (hst3), and YCB575 (hst4). These strains were all derived from FY2 strain background (WINSTON et al. 1995 Down). (B) The strains containing hst3 hst4 mutations grow poorly on SCFA-containing media. Strains spotted were (top to bottom): YCB173 (sir2), YCB515 (hst1), YCB405 (hst3), YCB523 (hst4), YCB235 (sir2 hst1), YCB538 (hst3 hst4), YCB547 (hst3 hst4), and YCB498 (sir2 hst1 hst2 hst3 hst4). These mutants were made in the YPH499/500 strain background (SIKORSKI and HIETER 1989 Down).

Sirtuin function is required to activate Acs in S. enterica:
Table 3 shows evidence of sirtuin-dependent control of acetyl-CoA synthetase activity in vitro. The activity of acetyl-CoA synthetase in a sirtuin-deficient strain was undetectable. A 42-fold increase in activity was observed when homogeneous CobB sirtuin was added to the reaction mixture. The activity increased to 490-fold when excess NAD+ was added to the sirtuin-containing reaction mixture. The level of acetyl-CoA synthetase activity obtained after treatment with CobB/NAD+ was equivalent to the level of enzyme activity measured in cell-free extracts of the sirtuin-proficient strain. A control experiment with cell-free extract from a sirtuin-proficient strain carrying a deletion of the acs gene showed no detectable acetyl-CoA synthetase activity (data not shown). These results suggested that acetyl-CoA synthetase is activated by the CobB sirtuin in a NAD+-dependent manner.


 
View this table:
In this window
In a new window

 
Table 3. Sirtuin-dependent activation of acetyl-CoA synthetase (Acs) enzyme function


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Data reported here support the conclusion that in S. enterica sirtuin function is required for the activation of acetate and propionate via the high-affinity acyl-CoA synthetase-dependent pathway of acyl-CoA synthesis. The data presented in Table 3 are consistent with the conclusion that the activity of acetyl-CoA synthetase and, by extension, propionyl-CoA synthetase, is controlled by their acetylation state. These data are consistent with the inability of sirtuin-deficient strains to use acetate or propionate as sources of carbon and energy. Evidence reported elsewhere shows that residue K609 of Acs is the site of acetylation. Residue K609 is an invariant residue in a motif that is conserved in many of the AMP-forming family of enzymes. In the case of Acs, K609 is essential for the formation of the acetyl-AMP intermediate, but is not required for the conversion of acetyl-AMP to acetyl-CoA (STARAI et al. 2002 Down). The effect that acetylation of K609 has on Acs activity is similar to the reported effect that a mutation in the residue equivalent to K609 of propionyl-CoA synthetase (i.e., K592) has on the formation of propionyl-AMP and the conversion of the latter to propionyl-CoA (HORSWILL and ESCALANTE-SEMERENA 2002 Down). On the basis of these results, we hypothesize that acetylation is a common feature in the post-translational control of the biochemical activities of members of the AMP-forming family of enzymes.

A role for sirtuins in short-chain fatty acid metabolism beyond activation is unlikely since the lack of sirtuin function was completely bypassed by increasing the level of activity of the low-affinity acyl kinase/phosphotransacetylase pathway of acyl-CoA synthesis. These results are consistent with the explanation that the lack of sirtuin function blocks the synthesis of short-chain fatty acyl-CoA, not its utilization. Since inactivation of the pta gene did not affect growth of the cobB+ acs+ and cobB+ prpE+ strains on acetate or propionate, we conclude that Pta function is not part of the sirtuin-dependent pathway of short-chain fatty acid activation.

The involvement of sirtuins in short-chain fatty acid metabolism, in particular acetate metabolism, is of interest because of the prominent role of acetylated histones in eukaryotic chromatin silencing (BRAUNSTEIN et al. 1993 Down; THOMPSON et al. 1994 Down). An effective way of controlling the degree of protein acetylation in the cell would be to control the level of acetyl-CoA substrate available to the acetyltransferase enzymes responsible for acetylation. It is reasonable to hypothesize that some substrate proteins for sirtuins may lose biological activity upon deacetylation; thus reactivation of these enzymes would depend on the level of acetyl-CoA available to the acetyltransferase enzymes. If this hypothesis is correct, then sirtuin-dependent stimulation of acetyl-CoA synthesis achieved by deacetylation of Acs becomes particularly important because active Acs enzyme would be essential to maintaining sufficient acetyl-CoA substrate concentration for the acetyltransferase enzymes to restore balanced levels of all the enzymatic activities under the control of this system.

The data reported here are consistent with the hypothesis that acetylated short-chain fatty acyl-CoA synthetases (PrpE and Acs) are inactive and that in the wild-type strain the deacetylase activity of sirtuins is responsible for keeping these enzymes active. It is also clear that in the absence of acetyl-CoA or propionyl-CoA synthetase activities, acetate and propionate are not retained inside the cell (Fig 5), suggesting that when the concentration of acetate or propionate in the environment is low, acyl-CoA synthetase activities are needed to retain these short-chain fatty acids inside the cell as their corresponding acyl-CoA derivatives.

Although there is no evidence in prokaryotes that sirtuins are involved in gene silencing or cell aging, sirtuins could still have a global effect on gene expression in prokaryotes. Downregulation of sirtuin activity under low-acetate growth conditions would result in low levels of acetyl-CoA with the concomitant reduction in the level of acetyl-phosphate, a known effector of gene expression (MCCLEARY et al. 1993 Down). The validity of the hypothesis presented above is under investigation.


*  ACKNOWLEDGMENTS

This work was supported by National Institutes of Health (NIH) grant GM-62203 to J.C.E.-S., by the Jerome Stefaniak Predoctoral Fellowship and the Pfizer Fellowship on Cell Physiology to V.J.S., by a Research Fellowship of the Japan Society for the Promotion of Science for Young Scientists to H.T., and by NIH grant GM-62385 to J.D.B.

Manuscript received August 21, 2002; Accepted for publication November 19, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BALCH, W. E. and R. S. WOLFE, 1976  New approach to the cultivation of methanogenic bacteria: 2-mercaptoethanesulfonic acid (HS-CoM)-dependent growth of Methanobacterium ruminantium in a pressurized atmosphere. Appl. Environ. Microbiol. 32:781-791.[Abstract/Free Full Text]

BELL, S. D., C. H. BOTTING, B. N. WARDLEWORTH, S. P. JACKSON, and M. F. WHITE, 2002  The interaction of Alba, a conserved archaeal chromatin protein, with Sir2 and its regulation by acetylation. Science 296:148-151.[Abstract/Free Full Text]

BERKOWITZ, D., J. M. HUSHON, H. J. WHITFIELD, J. ROTH, and B. N. AMES, 1968  Procedure for identifying nonsense mutations. J. Bacteriol. 96:215-220.[Abstract/Free Full Text]

BOBIK, T. A., G. D. HAVEMANN, R. J. BUSCH, D. S. WILLIAMS, and H. C. ALDRICH, 1999  The propanediol utilization (pdu) operon of Salmonella enterica serovar Typhimurium LT2 includes genes necessary for formation of polyhedral organelles involved in coenzyme B(12)-dependent 1, 2-propanediol degradation. J. Bacteriol. 181:5967-5975.[Abstract/Free Full Text]

BRACHMANN, C. B., 1996 The SIR2/HST gene family. Ph.D. Thesis, The Johns Hopkins University, Baltimore.

BRACHMANN, C. B., J. M. SHERMAN, S. E. DEVINE, E. E. CAMERON, and L. PILLUS et al., 1995  The SIR2 gene family, conserved from bacteria to humans, functions in silencing, cell cycle progression, and chromosomal stability. Genes Dev. 9:2888-2902.[Abstract/Free Full Text]

BRADFORD, M. M., 1976  A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-255.[Medline]

BRAUNSTEIN, M., A. B. ROSE, S. G. HOLMES, C. D. ALLIS, and J. R. BROACH, 1993  Transcriptional silencing in yeast is associated with reduced nucleosome acetylation. Genes Dev. 7:592-604.[Abstract/Free Full Text]

BROWN, T. D., M. C. JONES-MORTIMER, and H. L. KORNBERG, 1977  The enzymic interconversion of acetate and acetyl-coenzyme A in Escherichia coli. J. Gen. Microbiol. 102:327-336.[Abstract/Free Full Text]

BUCKEL, W., 1999 Anaerobic energy metabolism, pp. 278–326 in Biology of the Procaryotes, edited by H. G. CHLEGEL. Thieme, Stuttgart, Germany.

CASTILHO, B. A., P. OLFSON, and M. J. CASADABAN, 1984  Plasmid insertion mutagenesis and lac gene fusions with mini-Mu bacteriophage transposons. J. Bacteriol. 158:488-495.[Abstract/Free Full Text]

CHAN, R. K., D. BOTSTEIN, T. WATANABE, and Y. OGATA, 1972  Specialized transduction of tetracycline resistance by phage P22 in Salmonella typhimurium. II. Properties of a high transducing lysate. Virology 50:883-898.[Medline]

CUMMINGS, J. H., E. W. POMARE, W. J. BRANCH, C. P. NAYLOR, and G. T. MACFARLANE, 1987  Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 28:1221-1227.[Abstract/Free Full Text]

DAVIS, R. W., D. BOTSTEIN and J. R. ROTH, 1980 A Manual for Genetic Engineering: Advanced Bacterial Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

FREY, R. A., 1999  Characterization of five human cDNAs with homology to the SIR2 gene: SIR2-like proteins (Sirtuins) metabolize NAD and may have ADP-ribosyltransferase activity. Biochem. Biophys. Res. Commun. 260:273-279.[Medline]

GUZMAN, L.-M., D. BELIN, M. J. CARSON, and J. BECKWITH, 1995  Tight regulation, modulation, and high-level expression by vectors containing arabinose PBAD promoter. J. Bacteriol. 177:4121-4130.[Abstract/Free Full Text]

HESSLINGER, C., S. A. FAIRHURST, and G. SAWERS, 1998  Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol. Microbiol. 27:477-492.[Medline]

HOLMES, S. G., A. B. ROSE, K. STEUERLE, E. SAEZ, and S. SAYEGH et al., 1997  Hyperactivation of the silencing proteins, Sir2p and Sir3p, causes chromosome loss. Genetics 145:605-614.[Abstract]

HORSWILL, A. R. and J. C. ESCALANTE-SEMERENA, 1997  Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon. J. Bacteriol. 179:928-940.[Abstract/Free Full Text]

HORSWILL, A. R. and J. C. ESCALANTE-SEMERENA, 1999a  The prpE gene of Salmonella typhimurium LT2 encodes propionyl-CoA synthetase. Microbiology 145:1381-1388.[Abstract/Free Full Text]

HORSWILL, A. R. and J. C. ESCALANTE-SEMERENA, 1999b  Salmonella typhimurium LT2 catabolizes propionate via the 2-methylcitric acid cycle. J. Bacteriol. 181:5615-5623.[Abstract/Free Full Text]

HORSWILL, A. R. and J. C. ESCALANTE-SEMERENA, 2001  In vitro conversion of propionate to pyruvate by Salmonella enterica enzymes: 2-methylcitrate dehydratase (PrpD) and aconitase enzymes catalyze the conversion of 2-methylcitrate to 2-methylisocitrate. Biochemistry 40:4703-4713.[Medline]

HORSWILL, A. R. and J. C. ESCALANTE-SEMERENA, 2002  Characterization of the propionyl-CoA synthetase (PrpE) enzyme of Salmonella enterica: residue Lys592 is required for propionyl-AMP synthesis. Biochemistry 41:2379-2387.[Medline]

IMAI, S.-I., C. M. ARMSTRONG, M. KAEBERLEIN, and L. GUARENTE, 2000  Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795-800.[Medline]

KUMARI, S., R. TISHEL, M. EISENBACH, and A. J. WOLFE, 1995  Cloning, characterization, and functional expression of acs, the gene which encodes acetyl coenzyme A synthetase in Escherichia coli.. J. Bacteriol. 177:2878-2886.[Abstract/Free Full Text]

LAEMMLI, U. K., 1970  Cleavage and structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[Medline]

LANDRY, J., J. T. SLAMA, and R. STERNGLANZ, 2000a  Role of NAD(+) in the deacetylase activity of the SIR2-like proteins. Biochem. Biophys. Res. Commun. 278:685-690.[Medline]

LANDRY, J., A. SUTTON, S. T. TAFROV, R. C. HELLER, and J. STEBBINS et al., 2000b  The silencing protein SIR2 and its homologs are NAD-dependent protein deacetylases. Proc. Natl. Acad. Sci. USA 97:5807-5811.[Abstract/Free Full Text]

MCCLEARY, W. R., J. B. STOCK, and A. J. NINFA, 1993  Is acetyl phosphate a global signal in Escherichia coli? J. Bacteriol. 175:2793-2798.[Free Full Text]

MCVEY, M., M. KAEBERLEIN, H. A. TISSENBAUM, and L. GUARENTE, 2001  The short life span of Saccharomyces cerevisiae sgs1 and srs2 mutants is a composite of normal aging processes and mitotic arrest due to defective recombination. Genetics 157:1531-1542.[Abstract/Free Full Text]

MIN, J., J. LANDRY, R. STERNGLANZ, and R. M. XU, 2001  Crystal structure of a SIR2 homolog-NAD complex. Cell 105:269-279.[Medline]

ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SASSE, J., 1991 Detection of proteins, pp. 10.16.11–10.16.18 in Current Protocols in Molecular Biology, edited by K. STRUHL. Wiley Interscience, New York.

SAUVE, A. A., I. CELIC, J. AVALOS, H. DENG, and J. D. BOEKE et al., 2001  Chemistry of gene silencing: the mechanism of NAD(+)-dependent deacetylation reactions. Biochemistry 40:15456-15463.[Medline]

SCHMIEGER, H., 1971  A method for detection of phage mutants with altered transduction ability. Mol. Gen. Genet. 100:378-381.

SCHMIEGER, H. and H. BAKHAUS, 1973  The origin of DNA in transducing particles of P22 mutants with increased transduction frequencies (HT-mutants). Mol. Gen. Genet. 120:181-190.[Medline]

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27.[Abstract/Free Full Text]

SMITH, J. S., C. B. BRACHMANN, I. CELIC, M. A. KENNA, and S. MUHAMMAD et al., 2000  A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc. Natl. Acad. Sci. USA 97:6658-6663.[Abstract/Free Full Text]

STARAI, V. J., I. CELIC, R. N. COLE, J. D. BOEKE, and J. C. ESCALANTE-SEMERENA, 2002  Sir2-dependent activation of acetyl-CoA synthetase by deacetylation of active lysine. Science 298:2390-2392.[Abstract/Free Full Text]

TANNER, K. G., J. LANDRY, R. STERNGLANZ, and J. M. DENU, 2000  Silent information regulator family of NAD-dependent histone/protein deacetylases generates a unique product, 1-O-acetyl-ADP-ribose. Proc. Natl. Acad. Sci. USA 97:14178-14182.[Abstract/Free Full Text]

TANNY, J. C. and D. MOAZED, 2000  Coupling of histone deacetylation to NAD breakdown by the yeast silencing protein Sir2: evidence for acetyl transfer from substrate to an NAD breakdown product. Proc. Natl. Acad. Sci. USA 98:415-420.[Abstract/Free Full Text]

TANNY, J. C., G. J. DOWD, J. HUANG, H. HILZ, and D. MOAZED, 1999  An enzymatic activity in the yeast Sir2 protein that is essential for gene silencing. Cell 99:735-745.[Medline]

THOMPSON, J. S., X. LING, and M. GRUNSTEIN, 1994  Histone H3 amino terminus is required for telomeric and silent mating locus repression in yeast. Nature 369:245-247.[Medline]

TISSENBAUM, H. A. and L. GUARENTE, 2001  Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans.. Nature 410:227-230.[Medline]

TSANG, A. W. and J. C. ESCALANTE-SEMERENA, 1996  cobB function is required for the catabolism of propionate in Salmonella typhimurium LT2. Evidence for the existence of a substitute function for CobB within the 1,2-propanediol utilization (pdu) operon. J. Bacteriol. 178:7016-7019.[Abstract/Free Full Text]

TSANG, A. W. and J. C. ESCALANTE-SEMERENA, 1998  CobB, a new member of the SIR2 family of eucaryotic regulatory proteins, is required to compensate for the lack of nicotinate mononucleotide:5,6-dimethylbenzimidazole phosphoribosyltransferase activity in cobT mutants during cobalamin biosynthesis in Salmonella typhimurium LT2. J. Biol. Chem. 273:31788-31794.[Abstract/Free Full Text]

WINSTON, F., C. DOLLARD, and S. L. RICUPERO-HOVASSE, 1995  Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C. Yeast 11:53-55.[Medline]




This article has been cited by other articles:


Home page
J. Bacteriol.Home page
N. Altman-Price and M. Mevarech
Genetic Evidence for the Importance of Protein Acetylation and Protein Deacetylation in the Halophilic Archaeon Haloferax volcanii
J. Bacteriol., March 1, 2009; 191(5): 1610 - 1617.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
J. Zhang, R. Sprung, J. Pei, X. Tan, S. Kim, H. Zhu, C.-F. Liu, N. V. Grishin, and Y. Zhao
Lysine Acetylation Is a Highly Abundant and Evolutionarily Conserved Modification in Escherichia Coli
Mol. Cell. Proteomics, February 1, 2009; 8(2): 215 - 225.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. G. Gardner and J. C. Escalante-Semerena
Biochemical and Mutational Analyses of AcuA, the Acetyltransferase Enzyme That Controls the Activity of the Acetyl Coenzyme A Synthetase (AcsA) in Bacillus subtilis
J. Bacteriol., July 15, 2008; 190(14): 5132 - 5136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Garrity, J. G. Gardner, W. Hawse, C. Wolberger, and J. C. Escalante-Semerena
N-Lysine Propionylation Controls the Activity of Propionyl-CoA Synthetase
J. Biol. Chem., October 12, 2007; 282(41): 30239 - 30245.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Mead, R. McCord, L. Youngster, M. Sharma, M. R. Gartenberg, and A. K. Vershon
Swapping the Gene-Specific and Regional Silencing Specificities of the Hst1 and Sir2 Histone Deacetylases
Mol. Cell. Biol., April 1, 2007; 27(7): 2466 - 2475.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Schwer, J. Bunkenborg, R. O. Verdin, J. S. Andersen, and E. Verdin
From the Cover: Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2
PNAS, July 5, 2006; 103(27): 10224 - 10229.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. C. Hallows, S. Lee, and J. M. Denu
Sirtuins deacetylate and activate mammalian acetyl-CoA synthetases
PNAS, July 5, 2006; 103(27): 10230 - 10235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. J. Starai, J. G. Gardner, and J. C. Escalante-Semerena
Residue Leu-641 of Acetyl-CoA Synthetase is Critical for the Acetylation of Residue Lys-609 by the Protein Acetyltransferase Enzyme of Salmonella enterica
J. Biol. Chem., July 15, 2005; 280(28): 26200 - 26205.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
A. J. Wolfe
The Acetate Switch
Microbiol. Mol. Biol. Rev., March 1, 2005; 69(1): 12 - 50.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
M. E. Gardocki, M. Bakewell, D. Kamath, K. Robinson, K. Borovicka, and J. M. Lopes
Genomic Analysis of PIS1 Gene Expression
Eukaryot. Cell, March 1, 2005; 4(3): 604 - 614.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. W. Buck, C. M. Gallo, and J. S. Smith
Diversity in the Sir2 family of protein deacetylases
J. Leukoc. Biol., June 1, 2004; 75(6): 939 - 950.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X.-J. Yang
The diverse superfamily of lysine acetyltransferases and their roles in leukemia and other diseases
Nucleic Acids Res., February 11, 2004; 32(3): 959 - 976.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Jackson, M. T. Schmidt, N. J. Oppenheimer, and J. M. Denu
Mechanism of Nicotinamide Inhibition and Transglycosidation by Sir2 Histone/Protein Deacetylases
J. Biol. Chem., December 19, 2003; 278(51): 50985 - 50998.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
L. A. Maggio-Hall and J. C. Escalante-Semerena
{alpha}-5,6-Dimethylbenzimidazole adenine dinucleotide ({alpha}-DAD), a putative new intermediate of coenzyme B12 biosynthesis in Salmonella typhimurium
Microbiology, April 1, 2003; 149(4): 983 - 990.
[Abstract] [Full Text] [PDF]