Genetics, Vol. 163, 321-334, January 2003, Copyright © 2003

Genetic and Functional Analysis of DD44, a Sex-Linked Gene From the Dioecious Plant Silene latifolia, Provides Clues to Early Events in Sex Chromosome Evolution

Richard C. Moorea, Olga Kozyrevaa, Sabine Lebel-Hardenacka, Jiri Sirokyb, Roman Hobzab, Boris Vyskotb, and Sarah R. Granta
a Department of Biology, University of North Carolina, Chapel Hill, North Carolina 27599
b Institute of Biophysics, Czech Academy of Sciences, 612 62 Brno, Czech Republic

Corresponding author: Richard C. Moore, University of North Carolina, Coker 107, CB 3280, Chapel Hill, NC 27599., rcmoore{at}email.unc.edu (E-mail)

Communicating editor: C. S. GASSER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Silene latifolia is a dioecious plant with heteromorphic sex chromosomes. The sex chromosomes of S. latifolia provide an opportunity to study the early events in sex chromosome evolution because of their relatively recent emergence. In this article, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of a sex-linked gene from S. latifolia, DD44 (Differential Display 44). DD44 is homologous to the oligomycin sensitivity-conferring protein, an essential component of the mitochondrial ATP synthase, and is ubiquitously expressed in both sexes. We have been able to genetically map DD44 to a region of the Y chromosome that is genetically linked to the carpel-suppressing locus. Although we have physically mapped DD44 to the distal end of the long arm of the X chromosome using fluorescence in situ hybridization (FISH), DD44 maps to the opposite arm of the Y chromosome as determined by our genetic map. These data suggest that chromosomal rearrangements have occurred on the Y chromosome, which may have contributed to the genetic isolation of the Y chromosome. We discuss the implications of these results with respect to the structural and functional evolution of the S. latifolia Y chromosome.


THE presence of a heteromorphic Y chromosome defines males in the dioecious plant, Silene latifolia (GRANT et al. 1994A Down; MONEGER et al. 2000 Down; MATSUNAGA and KAWANO 2001 Down; NEGRUTIU et al. 2001 Down; CHARLESWORTH 2002 Down). An active-Y sex determination system also occurs in humans; however, while mammalian sex chromosomes diverged almost 300 mya (LAHN and PAGE 1999A Down), S. latifolia sex chromosomes appeared between 8 and 24 mya (DESFEUX et al. 1996 Down). Therefore, the X/Y chromosome pair in S. latifolia offers a unique opportunity to analyze the structure and function of sex chromosomes at an early stage of evolution (NEGRUTIU et al. 2001 Down). In particular, we want to answer two questions: (1) Are the same evolutionary events that helped shape human sex chromosomes occurring in S. latifolia and (2) to what extent have these events occurred in S. latifolia?

Preliminary evidence suggests that the sex chromosomes of S. latifolia are following a similar pattern of evolution to that of the human sex chromosomes. The inhibition of recombination between the proto-X and proto-Y chromosomes has already occurred in S. latifolia sex chromosomes (CHARLESWORTH and GUTTMAN 1999 Down). The S. latifolia Y chromosome can be divided into a nonpairing region (NPR) and a smaller pseudo-autosomal region (PAR) localized at the tip of the q arm (WESTERGAARD 1958 Down; LARDON et al. 1999A Down). Second, the observation that one of the X chromosomes in females is hypermethylated, a common hallmark of inactivated genes, suggests that an X-inactivation system may have evolved in S. latifolia to offset the decreased fitness caused by overexpression of X-linked genes (VYSKOT et al. 1993 Down; SIROKY et al. 1998 Down; VYSKOT 1999 Down). Finally, functional degradation of the Y is supported by the observation that YY progeny and androgenic haploid plants with only the Y chromosome are not viable (WESTERGAARD 1958 Down; YE et al. 1991 Down). Furthermore, decreased sequence variability of the Y-linked gene, SlY1, compared to its X-linked homolog, is a hallmark characteristic of degenerating Y chromosomes (FILATOV et al. 2000 Down, FILATOV et al. 2001 Down).

However, there are some differences between S. latifolia and human sex chromosomes. The S. latifolia Y chromosome is clearly at an earlier stage of evolution and has not degenerated to the extent of the human Y chromosome. First of all, C-banding experiments and methylation analyses show that the S. latifolia Y chromosome is largely euchromatic with the exception of centromeric and subtelomeric DNA (GRANT et al. 1994A Down; SIROKY et al. 1998 Down; GRABOWSKA-JOACHIMIAK and JOACHIMIAK 2002 Down). This, and the fact that the Y chromosome only recently diverged from the X, suggests that many actively transcribed genes may still be on the Y chromosome. Also, the Y chromosome has not degenerated in size relative to the X. In fact, the Y chromosome of S. latifolia is 1.4 times larger than the X (CIUPERCESCU et al. 1990 Down; GRABOWSKA-JOACHIMIAK and JOACHIMIAK 2002 Down). Preliminary evidence suggests that the increase in the size of the Y is at least partially due to the accumulation of repetitive DNA sequences (DONNISON and GRANT 1999 Down).

We are interested in knowing whether the S. latifolia Y chromosome is in the process of evolving structural and functional coherence, much like the Y chromosome of humans (LAHN and PAGE 1997 Down; DELBRIDGE and GRAVES 1999 Down), even though the X and Y chromosomes of S. latifolia only recently diverged. Clustering of genes with similar functions on the S. latifolia Y chromosome may indicate that the organization of the Y chromosome occurs rapidly after the divergence of the sex chromosomes from their autosomal ancestors. However, if the S. latifolia Y chromosome is not well ordered, it may mean more time is required to fine-tune this organization. Evidence derived from genetic and deletion mutant analysis indicates that at least the rudiments of functional units exist on the S. latifolia Y chromosome (WESTERGAARD 1958 Down; DONNISON et al. 1996 Down; FARBOS et al. 1999 Down; LARDON et al. 1999B Down). However, the genes located within these units have yet to be discovered and mapped. Thus, the structural and functional organization of genes on the S. latifolia Y chromosome remains enigmatic.

We began our study with a screen designed to identify sex-linked genes expressed specifically in male premeiotic floral meristems, because we are interested in addressing the hypothesis that the S. latifolia Y chromosome is functionally coherent. In this article, we present the genetic and molecular analysis of one of the genes identified from this screen, DD44 (Differential Display 44). DD44 has a simple sex-linkage pattern, with an X- and Y-linked allele, although it is ubiquitously expressed in males and females. This expression profile is not unexpected, as DD44 is homologous to the oligomycin sensitivity-conferring protein (OSCP), an essential component of the mitochondrial ATP synthase. Interestingly, genetic and physical mapping of DD44 suggests that the position of the Y-linked allele of DD44 is the result of a chromosomal rearrangement. We compare our findings with those for other sex-linked genes in S. latifolia and discuss the implications of these data for the functional coherence of the S. latifolia Y chromosome.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Plant materials:
Male and female S. latifolia plants of the U9 and MR4X64 ecotypes (described in LEBEL-HARDENACK et al. 2002 Down) as well as the 15X10 ecotype (gift of J. Antonovics, University of Virginia) were used for wild-type populations. Sterile and hermaphrodite plants were selected from M1 populations derived from X-ray-irradiated pollen as described in LEBEL-HARDENACK et al. 2002 Down. Families of 10 male and 10 female F1 progeny used for segregation analysis were obtained by cross-pollination of a female of each ecotype with a male from each of the other two ecotypes. Hairy root (HR) cultures were obtained by infecting plant leaf explants with an oncogenic Agrobacterium rhizogenes, strain A4RS, and culturing the explants on B5 medium without hormones. During prolonged cultivation, subclones with various deletions were isolated. HR cultures of a tetraploid female (SIROKY et al. 1999 Down), a female with a deletion of the distal region of the q arm, and a male with a deletion of one arm of the Y chromosome were used as sources of mitotic chromosomes.

Differential display:
Differential display (LIANG and PARDEE 1992 Down; MARTIN and PARDEE 1999 Down) was performed between mRNA populations isolated from male and female dissected floral meristems from developmental stages prior to or at the stage of sex determination (up to stage 6; GRANT et al. 1994B Down). Total RNA was prepared using the TRIZOL reagent (Invitrogen Life Technologies, Carlsbad, CA). Poly(A)+ RNA was isolated using Dynabeads (Dynal, Oslo). The differential display was carried out using the RNAimage kit 2 (Genhunter, Nashville, TN). Differential display fragments were cloned into the TOPO pCR2.1 cloning vector (Invitrogen Life Technologies) and sequenced with the M13 reverse primer.

Extraction of nucleic acids:
DNA was isolated from young leaves by CsCl banding. Briefly, 5–10 g of ground frozen tissue was incubated in extraction buffer [0.1 M EDTA pH 8.0, 3x SSC, 0.1 M sodium diethyldithiocarbamic acid (Sigma, St. Louis)] at 37° for 15 min followed by two rounds of phenol:chloroform extraction and ethanol precipitation. Precipitated DNA was spooled and resuspended in 7.5 ml of TE buffer, pH 8.0, at 65° for 15 min with periodic agitation. CsCl (8.73 g) and 20 µl of ethidium bromide (20 mg/ml) were added to resuspended DNA and the sample was spun overnight at 55,000 rpm in an L7-55 Ultracentrifuge (Beckman, Palo Alto, CA). The genomic DNA band was removed with a pipette, the ethidium bromide was extracted multiple times with 7:1 (v/v) isopropanol:water, and the DNA was ethanol precipitated. Precipitated DNA was air dried, resuspended in TE, and stored at 4°.

Total RNA was isolated from open flowers, flower buds (<1 mm), young leaves of male and female S. latifolia, and isolated meristems of mixed male and female S. latifolia seedlings using TRIZOL reagent (Invitrogen Life Technologies). Poly (A)+ RNA was procured from total RNA using the Oligotex mRNA midi kit (QIAGEN, Valencia, CA) and treated with DNase I using the DNA-free kit (Ambion, Austin, TX).

Southern and Northern blot analyses:
Genomic DNA and RNA gel blots were made using standard techniques (SAMBROOK et al. 1989 Down). Probes used for Southern or Northern blots were labeled with [{alpha}-32P]ATP using the Prime-It II random primer labeling kit (Stratagene, La Jolla, CA). Standard conditions for Southern blot hybridization and washing were 2-hr preincubation in hybridization solution [1x SSPE, 1% (w/v) SDS, 10% (w/v) polyethylene glycol (PEG), 125 mg heparin, 50 mg herring sperm DNA] at 65°; overnight incubation in 10 ml hybridization solution with labeled probe; and 15-min wash with 2x SSC, 0.1% SDS at 65° followed by three 15-min washes with 0.5x SSC, 0.1% SDS at 65°. Standard conditions for Northern blot hybridization and washing were 2-hr pre-incubation in ULTRAhyb (Ambion) at 42°; overnight incubation with labeled probe in 10 ml of ULTRAhyb (Ambion) at 42°; and two 5-min washes with 2x SSC, 0.1% SDS followed by three 15-min washes with 0.1x SSC, 0.1% SDS at 42°.

Isolation of DD44 cDNA and genomic clones:
PCR was used to amplify a 214-bp DD44 partial cDNA clone isolated from differential display using primers DD44F1 and DD44R1 (see below). The resulting PCR product was gel purified using a QIAquick gel extraction kit (QIAGEN) and used to probe a male S. latifolia floral Lambda Zap II cDNA library (Stratagene, La Jolla CA) and a male S. latifolia Lambda FIX II genomic library (Stratagene) for DD44 cDNA and genomic clones, respectively. Plasmid containing the DD44 cDNA was rescued from positive cDNA clones using the Rapid Excision kit (Stratagene). A DD44 genomic clone was digested with NotI, and the resulting 18-kb insert was subcloned into linearized (EagI) pBR322 for ease of manipulation and labeling.

Primers and PCR reactions:
Unless otherwise noted, all products were amplified from 150 ng of template using Taq polymerase (Invitrogen Life Technologies), and all PCR reactions used the following conditions: 94° for 2 min; 30 cycles of 94° for 30 sec, X° for 45 sec, 72° for Y min (where X and Y are defined below for each reaction); followed by 72° for 5 min.

The 214-bp DD44 probe was amplified using primers DD44F1 (5' GTGTTCGACATGTCCATCAGAACC 3') and DD44R1 (5' CCATCACTTCTTATTTTATGCAGG 3') with a 54° annealing temperature and 45-sec extension. The same primers and conditions were used to amplify the male-specific doublet from genomic DNA, and products were run on a 4% agarose gel to visualize the doublet.

To obtain the complete genomic sequence and structure of the DD44 X- and Y-linked alleles (DD44X and DD44Y), we performed three sequential PCR amplifications of three regions of DD44. All PCR amplifications of DD44Y were performed from a U9 male, while all PCR amplifications of DD44X were performed from a U9 female. The first amplification was from exon 3 to the 3' flanking region using a DD44X- or DD44Y-specific reverse primer, DD44XR2 (5' GCCAACAAAATTAGCGTAGCG 3') or DD44YR2 (5' TCCGACGAAAACGAGGGAAG 3'), and a shared forward primer in exon 3, DD44F2 (5' CTGTCAGTGCCCTCGGATATAAGA 3'). DD44X and DD44Y products were amplified using a 56° annealing temperature and 2-min extension time. From these sequences, a hypervariable region was found in the middle of intron 3, and reverse primers specific to DD44X and DD44Y were designed: DD44XR3 (5' CCTTTGGTCTGGTATGGAGGGA 3') and DD44YR3 (5' GACAGAGAAATGAGAACTTCCACAATAAA 3'). For the second PCR amplification, these sequence-specific primers were used in conjunction with a common forward primer found in exon 2, DD44F3 (5' CGAAGAGCTTTGCTACCAAGGC 3'). This genomic segment of DD44X was amplified using a 57° annealing temperature and 3-min extension time. For amplification of this segment of DD44Y, long-range PCR was performed with the TaKaRa DNA polymerase (PanVera, Madison, WI) using the following conditions: 94° for 2 min; 30 cycles of 98° for 10 sec, 63° for 7 min; followed by 72° for 5 min. For the final PCR amplification, a hypervariable region in intron 2 was used to design one last set of reverse primers specific to DD44X and DD44Y: DD44XR4 (5' CCCAAACCACGGCATACATGTAG 3') and DD44YR4 (5' GGAGCTGAGGAGGCTTGGGA 3'). These primers were used in conjunction with a forward primer starting at the start codon, DD44F4 (5' ATGTCAATGGCGAACCGCAT 3'), to amplify the remaining genomic sequence. DD44X and DD44Y products were amplified using a 60° annealing temperature and 45-sec extension time. Primer pairs DD44F3/DD44XR3 and DD44F3/DD44XR4 amplified products from the U9 female and not the U9 male (data not shown), whereas primer pairs DD44F2/DD44YR2, DD44F3/DD44YR3, and DD44F3/DD44YR4 amplified products from the U9 male and not the U9 female (data not shown).

Amplification of DD44 Y-specific markers from genomic DNA isolated from Y-deletion mutants was performed using either DD44F1 or DD44R1 as described above, which amplifies a doublet in males, or DD44F1 and DD44YR2, which amplifies a band only in males, with a 54° annealing temperature and 1-min extension. Amplification of SlY1 from genomic DNA isolated from Y-deletion mutants was performed using SlY1 + 11 (FILATOV et al. 2000 Down) and SlY1_4551R (5' GTAGAATGGCAATATAGTACTCCATAACTA 3'), which produce a band only in males, with a 56° annealing temperature and a 2-min extension time. A second set of SlY1-specific primers, SLY1_4505F (5' GGTTGAAACATGTTCATTAGTTATGGA 3') and SLY1_5813R (5' CATACTCCACCCAAGTATTCTTTCC 3'), was also used to map SlY1 in Y deletion mutants using a 56° annealing temperature and 2-min extension time. Amplification of SlY4 from genomic DNA isolated from Y-deletion mutants was performed using SlY4-specific primers with the previously published step-down PCR protocol (ATANASSOV et al. 2001 Down). Amplification of these same products from hairy root genomic DNA was performed as above, except 15 ng of template was used. The Y-specific marker, Bgl10, was amplified from genomic DNA of these hairy root lines using primers and conditions used in LEBEL-HARDENACK et al. 2002 Down.

Thermal asymmetric interlaced PCR:
Thermal asymmetric interlaced (TAIL) PCR was used to identify variable genomic sequences flanking the DD44 214-bp differential display sequence. TAIL PCR conditions were as described in LIU et al. 1995 Down and LIU and WHITTIER 1995 Down; however, we used a series of five nested primers instead of three, similar to an approach used by TERAUCHI and KAHL 2000 Down. The last round of PCR was divided into three reactions, each with a different nested primer. This aided in the identification of gene-specific bands, as these bands gave a characteristic "step ladder" of products of decreasing size in each of these reactions. Walking was performed in the 3' direction using the following gene-specific primers in combination with previously published degenerate primers (LIU and WHITTIER 1995 Down; LIU et al. 1995 Down):

  • DD44TAILF1 (5' aagtgttcgacatgtccatcagaaccag 3');

  • DD44TAILF2 (5' accagggcaagacagatggagaggtt 3');

  • DD44TAILF3 (5' tcaacatatgatggcactggtgctaca 3');

  • DD44TAILF4 (5' tcccgtcattacagtttcccct 3');

  • DD44TAILF5 (5' ctaagcgccctttttgtatctctca 3').

RT-PCR:
Poly(A)+ RNA was prepared from total RNA as described above. cDNA was prepared from poly(A)+ RNA using the M-MLV reverse transcriptase in conjunction with an oligo(dT) primer using the RETROscript kit (Ambion). PCR reactions were performed using DD44F1 and DD44R1 primers using conditions described above.

DNA sequencing and analysis:
Before sequencing, PCR products were cloned into the TOPO pCR2.1 cloning vector (Invitrogen Life Technologies). Sequencing of cDNA, genomic, and PCR-amplified clones of DD44 was performed by the University of North Carolina Automated DNA Sequencing Facility (Chapel Hill, NC). BLAST searches were performed with default settings using the National Center for Biotechnology (NCBI) search engine (http://www.ncbi.nlm.nih.gov/BLAST/). Sequence analyses and contig assemblies were performed using the programs Sequencher version 4.0.5 (Gene Codes Corporation, Ann Arbor, MI) and Vector NTI version 6.0 (InforMax, Bethesda, MD). Sequence alignments were performed by using the CLUSTALW algorithm of the Vector NTI program, AlignX.

Genomic sequences for DD44X (GenBank accession no. AF543833) and DD44Y (GenBank accession no. AF543834) were aligned manually and unalignable regions removed. The divergence between the DD44X and DD44Y was analyzed using DnaSP version 3.0 software (ROZAS and ROZAS 1999 Down). The coding regions were analyzed to estimate the synonymous and nonsynonymous divergence values per synonymous and nonsynonymous site (Ks and Ka; see LI 1997 Down). A low Ka/Ks ratio indicates that the sequence encodes a functional protein (see LI 1997 Down). Divergence between the sequences of the introns of DD44X and DD44Y was also estimated, to compare the extent of divergence in the DD44 gene with values for other X- and Y-linked loci in S. latifolia.

Statistical analysis:
Chi-square and Fisher's exact test analyses were performed using the SAS statistics package. Order of Y-linked genes with respect to previously described amplified fragment length polymorphism (AFLP) markers was predicted as described previously (LEBEL-HARDENACK et al. 2002 Down), using the RH2PT version 3.0 program of the RHMAP Radiation Hybrid analysis package (BOEHNKE et al. 1991 Down).

Probe preparation and labeling for fluorescence in situ hybridization:
The 18-kb DD44 genomic clone in pBR322 was cut with SalI and the insert was separated by gel electrophoresis (0.5% agarose). DNA was extracted from the gel using the QIAquick gel extraction kit (QIAGEN). The probe was labeled by Cy3-dUTP (Amersham Pharmacia Biotech, Little Chalfont, England) in a standard nick translation reaction using Nick Translation Mix (Roche, Nutley, NJ). Labeled probe was purified by the QIAquick nucleotide removal kit (QIAGEN).

Preparation of metaphase chromosomes for fluorescence in situ hybridization:
Root tips from germinating seeds or hairy root cultures of S. latifolia (see above) were used as a source of chromosomes for mitotic spreads and prepared according to SIROKY et al. 1999 Down, SIROKY et al. 2001 Down.

Fluorescence in situ hybridization:
Slides were treated with RNAse (100 µg/ml in 2x SSC; QIAGEN), for 1 hr at 37° and washed three times with 2x SSC. Remnants of the cytoplasm were removed by 10 µg/ml Pepsin (Sigma) in 0.01 N HCl for 10 min at 37°, washed as before, dehydrated in ascending ethanol series, and air dried. The hybridization mixture (for one slide, 30 µl) consisted of 200 µg of labeled probe, 15 µl formamide, 6 µl of 50% dextran sulfate solution, and 3 µl of 20x SSC. The volume was brought to 30 µl by adding TE, pH 8. Heat-denatured (76°) hybridization mix was applied to slides, covered by a cover slip, and placed on a cycler equipped with a flat plate (cycler model PHC-3; Techne, Cambridge, England). Slides with probe mixes in them were denatured at 75° for 5 min and brought to 37° using stepwise cooling. The slides were hybridized for 40 hr. Posthybridization wash consisted of three washes in 2x SSC at 42°, two stringent washes (5 min each) in 0.1x SSC at 42°, and 4x SSC supplemented by 0.1% Tween 20 (0.1%; Sigma). Slides were mounted in Vectashield (Vector Laboratories, Burlingame, CA) containing 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI) as a counterstain and viewed under an Olympus AX 70 epifluorescent microscope equipped by filter sets for DAPI and Cy3. Images were captured by a CCD camera using ISIS software (Meta Systems GmBH, Altlussheim, Germany) as black and white figures and merged.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Identification of candidate sex-linked, male-specific genes in S. latifolia:
We used a twofold approach to identify sex-linked genes in S. latifolia. First, we performed differential display on mRNA isolated from male and female premeiotic floral buds (stages 1–6) to identify transcripts that were potentially expressed only during the initial stages of male floral differentiation and development. It is during these early stages of floral development, before there are any gross morphological differences in male and female floral development, that we expected to find genes involved in sex determination to be expressed. Second, we used the partial transcripts identified from differential display to probe a Southern blot of total genomic DNA pooled from either five males or five females and digested with EcoRI, BamHI, or HindIII. Transcripts that gave at least one male-specific restriction fragment length polymorphism (RFLP) were selected for a more detailed segregation analysis to confirm their chromosomal linkage and expression analyses to confirm whether they were expressed specifically in male tissues.

We identified 13 putative male-specific transcripts from our initial differential display analysis. Six of these showed at least one male-specific RFLP in our initial screen with Southerns of pooled male vs. female genomic DNA (data not shown), and two of these subsequently showed evidence of sex linkage in further segregation analyses (below and data not shown). Here, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of the gene that showed the simplest pattern of sex linkage, DD44.

DD44 is linked to the X and Y chromosomes:
We performed a segregation analysis of DD44 to verify the chromosomal linkage of male-specific RFLPs. We mated parents from two different S. latifolia populations that are polymorphic for DD44. The fate of male-specific RFLPs was followed in 10 male and 10 female F1 progeny (Fig 1). There were two male-specific RFLPs of DD44: one (>12 kb) was inherited by all female progeny, the X-linked allele; another (8 kb) was inherited by all male progeny, the Y-linked allele. Using the formula from DELICHERE et al. 1999 Down, the probability that these RFLPs are not linked to the sex chromosomes is 9.5 x 10-7 [P = (1/2)n, where n = 20]. Thus, based on this RFLP segregation analysis, DD44 is sex linked.



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 1. Segregation analysis of male-specific RFLPs in a family of 10 female F1 and 10 male F1 progeny obtained by crossing a 15X10 female parent (F) to a U9 male parent (M). Genomic DNAs (20 µg) from each individual were digested with EcoRI, separated on a 0.7% gel, and blotted. The Southern blot was probed with the 214-bp partial DD44 differential display product. The Y-linked RFLP of DD44 is ~8 kb and is inherited by all 10 male F1 progeny. The X-linked RFLP of DD44 is >12 kb and is inherited by all females.

DD44 encodes the OSCP of the mitochondrial ATP synthase:
We screened a cDNA library derived from male floral mRNA with the 214-bp DD44 differential display product to identify a full-length cDNA for DD44. We obtained a 976-bp cDNA clone containing 639 bp of the 693-bp DD44 open reading frame (ORF) and 337 bp of the 3' flanking region. The initial 54 bp of the ORF was deduced from the genomic sequence of DD44 (detailed below). Our probe sequence was found in the region spanning the last 71 bp of the DD44 ORF into the 3' flanking sequence.

Blast alignment of the translated DD44 ORF against the GenBank nonredundant protein database yielded greatest similarity to the {delta}-subunit of the mitochondrial F1-ATP synthase of the sweet potato, Ipomoea batatas (E value = 8 x 10-69; accession no. BAA77508), which is homologous to the OSCP from other eukaryotes (KIMURA et al. 1990 Down) and to the OSCP of Arabidopsis thaliana (E value = 3 x 10-54; accession no. NP_196849). DD44 shares 65.6% nucleotide identity with the F1-ATPase {delta}-subunit of I. batatas and 63% nucleotide identity with the A. thaliana sequence. At the protein level, DD44 is 62.9% identical (72.7% similar) to the I. batatas sequence and 53.1% identical (68% similar) to the A. thaliana sequence. DD44 contains the conserved functional domain of the OSCP family between aa55 and aa224 (34.5% identity, 46% similarity to the pfam00213 consensus domain). The presence of this domain, and the high degree of similarity with other plant OSCPs, places DD44 in this category of conserved proteins.

We tried to characterize the function of the OSCP in higher plants by screening for homozygous T-DNA insertion lines in the OSCP homolog of A. thaliana (At5g13450). BLAST analysis of At5g13450 against left border sequences of T-DNA insertion lines from the Salk Institute Genomic Analysis Library (SIGnAL; La Jolla, CA) identified a T-DNA insertion line (SALK_010674) with an insertion ~68 bp upstream of the start codon of At5g13450. T3 seed was obtained from the Arabidopsis Biological Resource Center (ARBC; Columbus, OH). No T-DNA insertion lines were found in the coding region of the gene. We tested 17 T3 progeny harvested after kanamycin selection for insertions in the At5g13450 promoter and identified 14 individuals heterozygous for the insertion and no individuals homozygous for the insertion (data not shown). The lack of homozygous insertions suggests that the OSCP of A. thaliana, and by homology DD44, is essential for proper growth and development in plants. To determine whether the T-DNA insertion in the At5g13450 promoter was embryo lethal or gametophytic lethal, we germinated 375 seeds from one of the T3 heterozygous insertion lines on Gamborg B-5 media with 50 µg/ml kanamycin. There were 191 kanamycin-resistant plants and 184 kanamycin-sensitive plants. The observed ratio significantly varies (P < 0.001) from the expected ratio of 2:1 resistant-to-sensitive plants expected for an embryo-lethal insertion; however, this ratio does not significantly vary from the expected ratio of 1:1 resistant-to-sensitive plants expected if the insertion is lethal to one gametophyte (HOWDEN et al. 1998 Down). Therefore, the T-DNA insertion in the A. thaliana OSCP is gametophyte lethal, although this experiment does not differentiate between male and female lethality.

DD44 is expressed in male and female tissues:
We tested whether DD44 was expressed specifically in male tissues, as differential display is prone to false positives. We performed Northern analysis on total RNA isolated from either male or female leaves, mature flowers, and unopened floral buds, using the 214-bp DD44 differential display product as a probe (Fig 2A). The DD44 probe hybridized to a single 1.15-kb band that was present in all tissue types in both males and females. We also performed reverse transcription (RT)-PCR using primers designed to amplify the 214-bp DD44 differential display sequence on cDNA synthesized from poly(A)+ mRNA isolated from male and female leaves, mature flowers, and unopened floral buds, and also from apical meristems isolated from seedlings of mixed sex. DD44 was amplified from all tissue types and in both sexes (Fig 2B). No products were observed in controls processed without reverse transcriptase (data not shown). Thus, DD44 is expressed in males and females and expression is not tissue specific. This expression profile also suggests that DD44 is performing a general "housekeeping" function, necessary throughout male and female plant development.



View larger version (69K):
In this window
In a new window
Download PPT slide
 
Figure 2. Northern and RT-PCR expression analysis of DD44. (A) A Northern blot of total RNA isolated from male (M) and female (F) leaves, open flowers, and floral buds was probed with the 214-bp partial DD44 differential display product. A 1.15-kb band was recognized in all tissues examined, regardless of sex, indicating DD44 is not differentially expressed. (B) RT-PCR of the DD44 differential display sequence from cDNA prepared from poly(A)+ RNA from male and female leaves, mature flowers, floral buds, and mixed-sex seedling apical meristems amplifies a 214-bp band in all tissues regardless of sex. Furthermore, a doublet, the top band of which is male specific, is amplified in all samples from male tissue. Thus, both the X- and the Y-linked copies of DD44 are expressed in males, and only the X-linked allele is expressed in females.

The PCR primers used to amplify the DD44 differential display sequence also amplify a male-specific polymorphism from male genomic DNA. PCR from genomic DNA using these primers amplifies a doublet in males and only a single band in females (Fig 2B). The larger PCR product was determined to be linked to the Y chromosome by a segregation analysis of F1 progeny from a cross of polymorphic parents (Fig 3A). This same doublet was specifically amplified from cDNA from all male tissues in our RT-PCR analysis, while only the lower, shared band was amplified in females (Fig 2B). The size difference between the male-specific upper band and the shared lower band is small enough (<20 bp) that it is not resolved using Northern analysis. These data indicate that males express both the Y-linked allele and the shared, X-linked allele of DD44 in all tissues examined.



View larger version (62K):
In this window
In a new window
Download PPT slide
 
Figure 3. Segregation analysis of Y-linked and X-linked PCR polymorphisms of DD44. Products were amplified from genomic DNA of a family of 10 female F1 and 10 male F1 progeny obtained by crossing a 15X10 female parent (FP) to a MR4X64 male parent (MP). (A) PCR using the primers DD44F1 and DD44R1 amplifies a doublet in males, the upper band of which is Y-linked and segregates only to male progeny. (B) PCR using primers DD44F1 and DD44YR2 amplifies a male-specific band that is Y-linked and segregates only to male progeny. The DD44YR2 primer was used to amplify the 3' region of DD44Y from U9 male genomic DNA for sequencing. (C) PCR using primers DD44F1 and DD44XR2 amplifies a band in both the male and the female parent that is X-linked and segregates to all progeny. The DD44XR2 primer was used to amplify the 3' region of DD44X from U9 female genomic DNA for sequencing.

Genomic structure of DD44X and DD44Y:
Initially, we deduced the genomic structure of DD44 by sequencing an 8-kb region of an 18-kb genomic clone identified by screening a S. latifolia male genomic DNA phage library with the 214-bp DD44 differential display sequence. The DD44 sequence from the genomic clone contained six exons (totaling 693 bp) and five introns (totaling 3436 bp). However, we were interested in obtaining genomic sequence and structure for the DD44 X- and Y-linked alleles. Therefore, we used TAIL PCR from total male genomic DNA to walk both 5' and 3' from the 214-bp DD44 differential display sequence in hopes of identifying variable flanking sequences corresponding to the X and Y alleles of DD44.

We identified two alleles in the 3' flanking region of DD44 that were characterized by an ~40-bp indel. Reverse primers specific to each allele were designed and tested in conjunction with the forward primer found in the shared DD44 partial cDNA sequence (DD44F1). One primer (DD44YR2) amplified a male-specific, 420-bp fragment that segregated only to F1 male progeny; therefore, it amplified the Y-linked allele (Fig 3B). The other primer (DD44XR2) amplified a 400-bp fragment from both males and females and segregated to all progeny regardless of sex; therefore, it amplified the X-linked allele (Fig 3C).

To obtain the complete genomic sequence and structure of the DD44 X- and Y-linked alleles (DD44X and DD44Y), we performed three sequential PCR amplifications of three regions of DD44 using DD44X- or DD44Y-specific primers as described in MATERIALS AND METHODS. Most of the genomic structure of DD44X and DD44Y is similar (Fig 4). However, there was surprising difference in the length of the intron 2 between DD44Y and DD44X. While intron 2 of DD44X was only 1.6 kb, it was 7.5 kb in DD44Y. Only the 5' and 3' flanking sequences of DD44Y intron 2 could be aligned with intron 2 sequence of DD44X. Blastx analysis of the 5' region of the internal region of intron 2 specific to DD44Y showed similarity (E value = 1 x 10-16) to a retrotransposon polyprotein from the flatworm, Schistosoma japonicum (accession no. AAK14815).



View larger version (10K):
In this window
In a new window
Download PPT slide
 
Figure 4. Genomic structure of DD44X and DD44Y. DD44X and DD44Y each have six exons (numbered) and five introns. Interestingly, DD44Y has a 7.5-kb intron 2, whereas the corresponding intron is 1.6 kb in DD44X. The crosshatched area of intron 2 of DD44Y cannot be aligned with intron 2 of DD44X.

Deletion mapping of DD44, SlY1, and SlY4 on the Y chromosome:
We used the Y chromosome AFLP-deletion map developed by LEBEL-HARDENACK et al. 2002 Down to map the location of DD44 and the previously published Y-linked genes SlY1 and SlY4 (DELICHERE et al. 1999 Down; ATANASSOV et al. 2001 Down) on the Y chromosome with respect to the sex-determining loci. We performed PCR from genomic DNA isolated from the Y-deletion mutants using primers designed to amplify the Y-linked allele of each gene. We then scored for the presence or absence of the Y-specific PCR product in each mutant. This information was used to place the Y-specific allele onto the Y-deletion map with respect to the known AFLP markers (Fig 5).



View larger version (42K):
In this window
In a new window
Download PPT slide
 
Figure 5. AFLP deletion map of the S. latifolia Y chromosome showing relative positions of DD44Y, SlY1, and SlY4 as determined by PCR analysis from genomic DNA of Y-deletion mutants. The map is arranged according to LEBEL-HARDENACK et al. (2002), with mutant identifiers on the left vertical axis (M, MR4X64 ecotype; U, U9 ecotype; H, hermaphrodite; S, sterile), and AFLP loci (L nos.) on the top horizontal axis. To the right of the map are the PCR results for each Y-linked gene; Y deletion mutants were scored for the presence (+) or absence (-) of Y-linked PCR products. The most parsimonious positions of each gene with respect to AFLP loci are indicated at the top, as well as loci associated with sex determination. DD44 is missing from the majority of hermaphrodite mutants, but from none of the asexual mutants, and maps in linkage group A between markers L10 and L9. SlY1 is missing from 7 out of 10 mutants lacking the L7 locus, and therefore we placed it at this locus in linkage group B. SlY4 is predominantly absent in late-sterile mutants and maps between markers L8 and L5 of linkage groups B and C.

For mapping DD44Y, we scored for the presence or absence of the two DD44 Y-linked PCR polymorphisms (Fig 3A and Fig B) in the Y-deletion mutants. Both Y-linked PCR polymorphisms were absent in 10 of the hermaphrodite mutants, but present in all sterile mutants. DD44 was significantly associated with the carpel-suppressing locus on the basis of chi-square and Fisher's exact test (Pr = 9.76 x 10-4), and DD44 has a LOD > 3 of being linked to the group A linkage group of markers, which contains the carpel-suppressing locus. Specifically, the DD44 Y-linked polymorphisms were missing in hermaphrodite H10, but present in mutant H115, thus placing DD44 between markers L10 and L9 on the AFLP deletion map (Fig 5). The carpel-suppressing locus is deleted from the Y chromosome of hermaphrodite mutants and dominantly inhibits carpel formation in males (LARDON et al. 1999A Down). Classical cytological studies on Y-deletion mutants by WESTERGAARD 1958 Down, as well as more recent molecular investigations (DONNISON et al. 1996 Down; FARBOS et al. 1999 Down; LARDON et al. 1999B Down), have placed the carpel-suppressing locus on the p arm of the Y chromosome. Therefore, the association of DD44Y with the carpel-suppressing locus would place DD44Y on the p arm of the Y chromosome.

For mapping SlY1, we first designed primers that amplified either a 1.4-kb band (primers SlY1 + 11 and SLY1_4551R) or a 1-kb band (primers SLY1_4505F and SLY1_5813R) only from males in our three S. latifolia ecotypes (data not shown). Both primer sets show the same amplification pattern from our population of Y-deletion mutants (Fig 5). SlY1 does not amplify from the hermaphrodite mutants UH15, UH4, and UH1, all of which are missing loci L7, L6, and L8 in the group B linkage group. Furthermore, SlY1 does not amplify from the early sterile mutant US2, which is missing L7, and the late steriles MS63 and MS57, which are missing group B markers, as well as the group C markers. SlY1 was not significantly associated with any sex-determination loci, although SlY1 has a LOD > 3 of being linked to the group B linkage group of markers (Fig 5). Group B markers are not linked to sex-determining loci, although they are missing from many of the large-deletion late-sterile mutants.

To map SlY4, we used previously published Y-specific primers (ATANASSOV et al. 2001 Down) that amplify a 600-bp male-specific band in our three S. latifolia ecotypes (data not shown). Amplification of SlY4 from Y-deletion mutants was lacking in a number of late-sterile mutants (all but US9 and US11), which are missing group B and group C markers, as well as a group of early-to-intermediate mutants (US2, MS74, and MS10), two of which are missing group B markers. SlY4 was significantly associated with the late stamen development locus on the basis of chi-square and Fisher's exact test (Pr = 1.8 x 10-4), and its nearest neighbors are the group C linkage group markers (pairwise LOD is between 1.5 and 1.8). Therefore, SlY4 resides between markers L8 and L5 at the boundary of groups A and B (Fig 5).

Both SlY1 and SlY4 map to the opposite end of the Y-deletion map from DD44; however, neither gene corresponds to a sex-determining locus, although SlY4 is deleted primarily in late-sterile mutants, the locus of which is thought to reside on the q arm of the Y chromosome (WESTERGAARD 1958 Down; LARDON et al. 1999A Down). Both SlY1 and SlY4 were determined to be on the q arm of the Y chromosome on the basis of deletion mapping in an independent set of mutants (DELICHERE et al. 1999 Down; ATANASSOV et al. 2001 Down). This would physically place SlY1 and SlY4 on the opposite arm of the Y chromosome as DD44.

Physical mapping of DD44 on the sex chromosomes using fluorescence in situ hybridization:
We were able to physically map the location of DD44 on the S. latifolia sex chromosomes using the technique of fluorescence in situ hybridization (FISH), using the 18-kb DD44 genomic clone as a probe. A Southern blot of the genomic clone digested with EcoRI, HindIII, or BamHI probed with radioactively labeled total male genomic DNA gave only a weak hybridization signal (data not shown), indicating our clone did not contain highly repetitive DNA sequences. We subsequently subcloned the 18-kb genomic fragment into pBR322 for ease of manipulation and probe labeling. The 18-kb DD44 genomic clone was used as a probe for FISH in metaphase chromosome spreads prepared from protoplasts derived from mitotically synchronized root tips of either S. latifolia seedlings or S. latifolia HR cultures. The DD44X-specific PCR primer pair (DD44F1/DD44XR2) amplified a band from our DD44 genomic clone; thus our genomic clone represents an X-linked allele (data not shown).

The S. latifolia diploid genome consists of two pairs of 11 autosomal chromosomes and two larger sex chromosomes: Females have two submetacentric X chromosomes and males have one X and one larger, metacentric Y chromosome (CIUPERCESCU et al. 1990 Down). FISH, using the 18-kb DD44 genomic clone as a probe, shows fluorescent hybridization signals in the distal region of one arm of both the X and the Y chromosomes of males (Fig 6A), to both X chromosomes in a diploid female (Fig 6B), and to all four X chromosomes of a tetraploid female (Fig 6C). These results support the conclusion drawn from our segregation analysis that DD44 is sex linked. Furthermore, these FISH data physically map DD44 to the distal region of one arm of the sex chromosomes.



View larger version (31K):
In this window
In a new window
Download PPT slide
 
Figure 6. FISH using the 18-kb DD44 genomic probe on S. latifolia mitotic chromosomes. DD44 hybridization signals are in red, and chromosomes are counterstained with DAPI. Mitotic spreads from (A) a standard male, (B) a standard female, and (C) a tetraploid female with sex chromosomes indicated (X and Y) are shown. The DD44 genomic probe hybridizes to the distal end of one arm of either the X or the Y chromosome. A and B are mitotic spreads from root tips of germinating seedlings, and C is from the tetraploid female hairy root culture. Bar, 10 µm.

In metaphase X chromosomes, the identification of the p and q arms is relatively straightforward, as the X chromosome is submetacentric (arm ratio = 1.44 ± 0.15; CIUPERCESCU et al. 1990 Down). It is clear from Fig 6B and Fig C, that DD44 hybridizes to the longer arm, or q arm, of the X chromosome. This conclusion is further supported by FISH analysis of DD44 in the female diploid HR line that has a deletion of the distal end of the q arm, as determined by DAPI banding patterns (Fig 7A). In this line, DD44 does not hybridize to the X chromosome carrying the distal q deletion (Fig 7A).



View larger version (46K):
In this window
In a new window
Download PPT slide
 
Figure 7. FISH using the 18-kb DD44 genomic probe on S. latifolia mitotic chromosomes with deletions in parts of the X or Y chromosome (indicated by X' or Y'). DD44 hybridization signals are in red, and chromosomes are counterstained with DAPI. (A) Mitotic spread from the female hairy root culture with a deletion of the distal end of the q arm on one X chromosome (as determined by DAPI banding). The DD44 genomic probe hybridizes to the distal end of the q arm of one X chromosome, but not to the distal end of the arm of the X chromosome containing the deletion (see inset). (B) Mitotic spread from the male hairy root culture with a deletion of one arm of the Y chromosome and an intact X chromosome. The DD44 genomic probe hybridizes to the distal end of the intact X chromosome and to the distal end of the remaining arm of the Y chromosome. Bar, 10 µm.

Cytological identification of which arm the Y chromosome DD44 binds to is more difficult as it is metacentric (arm ratio = 1.09 ± 0.04; CIUPERCESCU et al. 1990 Down), and it is not possible upon visual inspection to differentiate the p and the q arms. FISH was performed in the male HR line where one arm of the Y is missing to address this issue. Our DD44 genomic probe hybridizes to the distal end of the remaining Y chromosome arm, suggesting that DD44Y is not deleted in this line (Fig 7B).

To identify which arm remained in this Y-deletion HR line, we performed PCR from DNA isolated from the HR Y-deletion line, as well as the male line with no deletion, using four Y-specific markers: DD44Y, Bgl10, SlY1, and SlY4. PCR analysis using DD44Y-specific primers amplifies a Y-specific band from the Y-deletion HR line (Fig 8A and Fig B). Additionally, the Y-specific marker Bgl10, which is found in the same linkage group as the carpel-suppressing factor (LEBEL-HARDENACK et al. 2002 Down), also amplifies from this Y-deletion mutant (Fig 8C). However, both SlY1 and SlY4 Y-specific primers do not amplify any bands from this Y-deletion HR line (Fig 8D and Fig E). We suggest that it is the p arm that remains in this Y-deletion HR line, as both SlY1 and SlY4 have previously been mapped to the q arm of the Y chromosome (DELICHERE et al. 1999 Down; ATANASSOV et al. 2001 Down). Thus, we predict that DD44Y hybridizes to the distal p arm of the Y, whereas DD44X hybridizes to the distal q arm of the X.



View larger version (53K):
In this window
In a new window
Download PPT slide
 
Figure 8. PCR amplification of Y-specific sequences for DD44, Bgl10, SlY1, and SlY4 from genomic DNAs isolated from an MR4X64 ecotype male (M) and female (F), the male HR line with a normal Y chromosome, and the male HR line that has a deletion of one arm of the Y chromosome. (A and B) PCR amplification with (A) the primers DD44F1/DD44R1 (DD44) or (B) DD44F1/DD44R2 (DD44Y) produces the characteristic male-specific band in all lines tested. (C) Similar results were obtained with the Y-specific PCR marker Bgl10. In contrast, both (D) SlY1 and (E) SlY4 amplified only from the male genomic DNA and from genomic DNA of the male HR line with a normal Y chromosome; neither amplified from genomic DNA of the male HR line with a deletion of one arm of the Y chromosome.

Divergence of DD44X and DD44Y:
We were interested in assessing the nucleotide divergence between DD44X and DD44Y to see whether or not both of these alleles showed signs of selective constraint. We performed an alignment of all coding regions, introns (parts of intron 2 and intron 3 do not align and were removed from the analysis), and 311 bp of the 3' flanking region, to compare the DD44X and DD44Y sequences. Table 1 summarizes the total number of sites examined, the numbers of synonymous and nonsynonymous substitutions for each exon, the numbers of substitutions for each intron, and the nucleotide divergence for each region. The noncoding regions show a divergence of ~7%. The results for the coding sequences can be summarized in terms of synonymous and nonsynonymous substitutions per site, Ks and Ka, respectively (Table 1). The exons show a silent site divergence of ~9.6%, slightly higher than that for intron sites, and a nonsynonymous divergence of 2.5%. Exon 1 shows very high nucleotide divergence (KTotal = 0.15, Ks = 0.27) compared to the other exons.


 
View this table:
In this window
In a new window

 
Table 1. Total number of sites examined, the number of silent and nonsynonymous substitutions, and sequence divergence between DD44X and DD44Y for each exon and intron region

The silent site divergence between DD44X and DD44Y is similar to that for the three other S. latifolia X/Y gene pairs compared (whose Ks values range from 4% for SlX/Y1 to 18% for SlX/Y4 and 20% for a short region of sequence that can be aligned between MROS3-X and -Y). This shows that DD44X and DD44Y have been separated by a similar evolutionary time to the other sex-linked gene pairs. The analysis also shows that DD44X and DD44Y are under selective constraint. Ka/Ks ratios for divergence between expressed genes in plants, either between homologous genes in different species or between similar paralogous genes in the same species, are commonly between 10 and 20% (e.g., LI 1997 Down; LAGERCRANTZ and AXELSSON 2000 Down). Values considerably <1 are expected if both genes were actively expressed, whereas if the Y-linked copy were not expressed as a functional protein, a value close to 1 could be found, as in the case of MROS3-Y vs. -X (GUTTMAN and CHARLESWORTH 1998 Down). For DD44X/Y, the Ka/Ks ratio is 0.26. Thus, the sequence analysis supports our results described above in suggesting that DD44Y is functional. The Ka/Ks for DD44X/Y is higher than that published for two other sex-linked genes, SlX/Y1 (Ka/Ks = 0.045; ATANASSOV et al. 2001 Down) and SlX/Y4 (Ka/Ks = 0.166; ATANASSOV et al. 2001 Down).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

DD44 is a class 1, Y-linked gene:
The simple linkage pattern and universal expression patterns of DD44 are analogous to the class 1 group of genes of the nonrecombining region of human Y chromosome. These Y-linked genes are single-copy genes with functional X homologs, the expression of which is not developmentally restricted (LAHN et al. 2001 Down). There are two other classes of Y-linked genes: class 2, which does not have functional X homologs, is typically multicopy, and is expressed specifically in developing male testis, and class 3, which does not fit either profile for the first two classes and includes the SRY sex-determining gene (LAHN et al. 2001 Down).

Class 1 Y-linked genes are considered to be housekeeping genes and are thought to be involved in fundamental cellular processes (LAHN et al. 2001 Down). We propose that DD44 encodes a presumptive housekeeping gene. DD44 is highly similar on the protein level to the {delta}-subunit of the mitochondrial ATP synthase from the sweet potato, I. batatas, which is homologous to the OSCP in other eukaryotes (KIMURA et al. 1990 Down). The OSCP is a component of the stalk of the ATP synthase complex and functions as a link between the F1 catalytic domain and the F0 proton channel (WALKER and COLLINSON 1994 Down). The Escherichia coli ATP synthase {delta}-subunit, which is homologous to the eukaryotic OSCP, is characterized by a six-{alpha}-helix bundle in the N terminus, which interacts with the F1 core, and a less-defined C-terminal domain, which is required for binding to the F0 structure (WILKENS et al. 1997 Down). Yeast with a null mutation in the OSCP cannot grow on media with a nonfermentable carbon source, suggesting the OSCP is necessary for oxidative phosphorylation and essential for proper growth and development (UH et al. 1990 Down; PRESCOTT et al. 1994 Down).

In plants, characterization of the structure and function of the mitochondrial OSCP has been examined in I. batatas, where the OSCP is represented by many isoforms encoded by multiple genes in the hexaploid genome (KIMURA et al. 1990 Down; MORIKAMI et al. 1992 Down). Expression studies by MAEO et al. 1999 Down show that the promoters of two OSCP isoforms from sweet potato, F1{delta}-1 and F1{delta}-2, drive expression of the ß-glucuronidase (GUS) gene in transgenic tobacco in all tissues examined and that expression is strongest in the vascular tissue of leaves, stems, roots, and in the meristematic region of roots. These expression patterns correlate with cells with large numbers of mitochondria, such as the companion cells of phloem tissue (MAEO et al. 1999 Down).

There are two other published Y-linked genes of S. latifolia with similar properties to DD44: SlY1 and SlY4 (DELICHERE et al. 1999 Down; ATANASSOV et al. 2001 Down). Both genes are single copy with functional X homologs (SlX1 and SlX4), and both are similar to genes with cellular housekeeping functions: SlY/X1 are members of the large WD-repeat family of proteins (DELICHERE et al. 1999 Down), and SlY/X4 are putative fructose-2,6-bisphosphatases (ATANASSOV et al. 2001 Down). Similarly to DD44, both the X and the Y alleles of SlX/Y1 and SlX/Y4 are expressed in males, and the X alleles are actively expressed in females (DELICHERE et al. 1999 Down; ATANASSOV et al. 2001 Down). However, SlX/Y1, unlike DD44 and SlX/Y4 (ATANASSOV et al. 2001 Down), show some tissue-specific expression patterns, being primarily expressed in the floral tissues, with only weak expression in vegetative tissues (DELICHERE et al. 1999 Down). Thus, both SlY1 and SlY4 fall into the class 1 class of Y-linked genes, similar to DD44. Interestingly, the Ka/Ks value of DD44X/Y (0.235) is greater than that of SlX/Y4 (Ka/Ks = 0.166; ATANASSOV et al. 2001 Down) and SlX/Y1 (Ka/Ks = 0.045; ATANASSOV et al. 2001 Down), although all values are relatively low. Low Ka/Ks values are indicative of functional constraint. Such low Ka/Ks values are characteristics of class I genes that have escaped genetic deterioration (LAHN and PAGE 1999A Down).

Genetic and physical mapping of DD44 provides evidence for rearrangements on the S. latifolia Y chromosome:
We used two approaches to determine the position of DD44 on the Y chromosome. Physical and genetic mapping data support the localization of DD44Y to the distal region of the p arm of the Y and DD44X to the distal region of the q arm on the X. We hypothesize that this difference is due to a chromosomal rearrangement on the Y chromosome.

Chromosomal rearrangements are thought to have played a central role in the evolution of human sex chromosomes (GRAVES et al. 1998 Down; LAHN and PAGE 1999A Down). In particular, a series of at least four chromosomal inversions are thought to have occurred over the 310 million years of human sex chromosome evolution (LAHN and PAGE 1999A Down). These inversion events have contributed to the genetic isolation and subsequent deterioration of the human Y chromosome (LAHN et al. 2001 Down). We do not think a large inversion event is responsible for the rearrangement of DD44Y relative to DD44X for two reasons. First, the X-linked copy of DD44 has been genetically mapped to a large interval between the X-linked markers, SlX1 and SlX4 (V. HYKELOVA and V. LAPORTE, personal communication). Our Y-mapping data separate DD44Y from SlY1 and SlY4 onto separate arms. Thus, it is possible that a small-scale chromosomal rearrangement, such as a transposition, may be responsible for the separation of DD44Y from SlY1 and SlY4.

Second, our analysis of the sequence divergence between DD44X and DD44Y does not support a large chromosomal rearrangement event leading to the isolation of DD44Y from SlY1 and SlY4. Specifically, the Ks value of DD44X/Y (0.095), a rough measure of evolutionary distance, is intermediate between that of SlX/Y1 (Ks = 0.04; ATANASSOV et al. 2001 Down) and SlX/Y4 (Ks = 0.181; ATANASSOV et al. 2001 Down). These data do not resolve clear evolutionary strata on the S. latifolia sex chromosomes, like those observed in human sex chromosomes (LAHN and PAGE 1999A Down), because the Ks values of these S. latifolia sex-linked genes are relatively low. These values fall within the range of Ks values of sex-linked genes of the most recently isolated stratum on the human X chromosomes (Ks < 0.23, estimated by a molecular clock to correspond to 30–50 mya). The S. latifolia sex chromosomes are either slightly or considerably (SlX/Y1) less diverged than this and probably younger (estimated age between ~8 and 24 mya). Therefore, the S. latifolia sex-linked genes may have diverged at the same time due to a single isolation event, with the differences in Ka values being due to differences in functional constraint and with perhaps a second, more recent, event accounting for the low SlX/Y1 silent divergence. If these genes are part of the same evolutionary stratum, then the localization of DD44Y on the opposite arm of the Y from SlY1 and SlY4 may be due to a small-scale rearrangement event after the initial, large-scale chromosomal rearrangement.

Is the S. latifolia Y chromosome functionally coherent?
The human Y is considered by some to be functionally coherent (LAHN and PAGE 1997 Down; LAHN et al. 2001 Down); it has accumulated and maintained genes involved in male sex differentiation and development, and these genes are arranged in discrete functional units along the Y. This hypothesis is largely supported by the identification and mapping of testis-specific genes on the Y chromosome that have no X homolog, also known as class 2 genes (LAHN and PAGE 1997 Down; LAHN et al. 2001 Down). Some of these genes are thought to have resided on an autosomal ancestor of the Y, while others, such as CDY and DAZ, translocated to the Y chromosome (SAXENA et al. 1996 Down; LAHN and PAGE 1999B Down; LAHN et al. 2001 Down). Has the evolutionarily young S. latifolia Y chromosome developed functional coherency, or is functional coherence a trait that is acquired only late in the evolution of the Y chromosome?

To date, only class 1 Y-linked genes have been characterized on the Y (DD44Y, SlY1, and SlY4). Importantly, no class 2 genes, those expressed specifically in males and that have no X homologs, have been identified for the S. latifolia Y chromosome. Other Y-linked genes reported for S. latifolia include MROS3, which has a Y-linked pseudogene (GUTTMAN and CHARLESWORTH 1998 Down); ORF285, which is not actively transcribed (NAKAO et al. 2002 Down) and is similar to a putative non-LTR reverse transcriptase in A. thaliana (E value = 1 x 10-12; accession no. NP_178768); and a number of sequences that share similarity to retrotransposons and repetitive elements from plants and animals (DONNISON and GRANT 1999 Down). Cytogenetic and molecular analyses of S. latifolia hermaphrodite and asexual mutants with Y deletions suggest at least three genes exist on the Y that are involved in the differentiation and development of male sex organs (WESTERGAARD 1958 Down; DONNISON et al. 1996 Down; FARBOS et al. 1999 Down; LARDON et al. 1999B Down); however, of the >50 male-specific genes that have been reported for S. latifolia, (MATSUNAGA et al. 1996 Down, MATSUNAGA et al. 1997 Down; BARBACAR et al. 1997 Down; LEBEL-HARDENACK et al. 1997 Down; ROBERTSON et al. 1997 Down; SCUTT et al. 1997 Down, SCUTT et al. 2002 Down), only two are potentially Y linked (SCUTT et al. 2002 Down). Also, there is evidence that a functional homolog of the carpel-suppressing locus exists on the autosomes (FARBOS et al. 1999 Down). Thus, current evidence suggests that the gene composition of the S. latifolia Y chromosome is not heavily weighted with genes involved in male development and does not fit the criteria for functional coherency. This is possibly because S. latifolia is evolutionarily young and that functional coherency is a trait acquired only late in the evolution of the Y chromosome. However, the final word on this issue can be made only after the identification and mapping of more sex-linked genes in S. latifolia.


*  ACKNOWLEDGMENTS

We thank Dr. Valerie Laporte and Dr. Deborah Charlesworth (University of Edinburgh) for molecular divergence analysis as well as for insightful comments on the implications of these data and for critically reviewing the manuscript; Dr. Elizabeth Hauser (Duke University) for statistical analysis of deletion-mapping data; and Theresa Law, Johnathan Branch, Michael Lewis, Bryan Littlejohn, and Ashley McDaniel for their assistance in the lab and for care of our plants. This work was supported by a National Science Foundation grant (no. MCB-9816864), the National Institutes of Health (grant no. 1 F32 GM20891-01), and by the Grant Agency of the Czech Republic (grant no. 204/02/0417).

Manuscript received June 13, 2002; Accepted for publication October 14, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ATANASSOV, I., C. DELICHÈRE, D. A. FILATOV, D. CHARLESWORTH, and I. NEGRUTIU et al., 2001  Analysis and evolution of two functional Y-linked loci in a plant sex chromosome system. Mol. Biol. Evol. 18:2162-2168.[Abstract/Free Full Text]

BARBACAR, N., S. HINNISDAELS, I. FARBOS, F. MONÉGER, and A. LARDON et al., 1997  Isolation of early genes expressed in reproductive organs of the dioecious white campion (Silene latifolia) by subtraction cloning using an asexual mutant. Plant J. 12:805-817.[Medline]

BOEHNKE, M., K. LANGE, and D. R. COX, 1991  Statistical methods for multipoint radiation hybrid mapping. Am. J. Hum. Genet. 49:1174-1188.[Medline]

CHARLESWORTH, D., 2002  Plant sex determination and sex chromosomes. Heredity 88:94-101.[Medline]

CHARLESWORTH, D., and D. S. GUTTMAN, 1999 The evolution of dioecy and plant sex chromosome systems, pp. 25–50 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.

CIUPERCESCU, D. D., J. VEUSKENS, A. MOURAS, D. YE, and M. BRIQUET et al., 1990  Karyotyping Melandrium album, a dioecious plant with heteromorphic sex chromosomes. Genome 33:556-562.

DELBRIDGE, M. L. and J. A. M. GRAVES, 1999  Mammalian Y chromosome evolution and the male-specific functions of Y chromosome-borne genes. Rev. Reprod. 4:101-109.[Abstract]

DELICHÈRE, C., J. VEUSKENS, M. HERNOULD, N. BARBACAR, and A. MOURAS et al., 1999  SlY1, the first active gene cloned from a plant Y chromosome, encodes a WD-repeat protein. EMBO J. 18:4169-4179.[Medline]

DESFEUX, C., S. MAURICE, J. P. HENRY, B. LEJEUNE, and P. H. GOUYON, 1996  Evolution of reproductive systems in the genus Silene.. Proc. R. Soc. Lond. Ser. B 263:409-414.[Medline]

DONNISON, I. S., and S. GRANT, 1999 Male sex-specific DNA in Silene latifolia and other dioecious plant species, pp. 73–87 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.

DONNISON, I. S., J. SIROKY, B. VYSKOT, H. SAEDLER, and S. R. GRANT, 1996  Isolation of Y chromosome-specific sequences from Silene latifolia and mapping male sex-determining genes using representational difference analysis. Genetics 144:1893-1901.[Abstract]

FARBOS, I., J. VEUSKENS, B. VYSKOT, M. OLIVEIRA, and S. HINNISDAELS et al., 1999  Sexual dimorphism in white campion: deletion on the Y chromosome results in a floral asexual phenotype. Genetics 151:1187-1196.[Abstract/Free Full Text]

FILATOV, D. A., F. MONÉGER, I. NEGRUTIU, and D. CHARLESWORTH, 2000  Low variability in a Y-linked plant gene and its implications for Y-chromosome evolution. Nature 404:388-390.[Medline]

FILATOV, D. A., V. LAPORTE, C. VITTE, and D. CHARLESWORTH, 2001  DNA diversity in sex-linked and autosomal genes of the plant species Silene latifolia and Silene dioica.. Mol. Biol. Evol. 18:1442-1454.[Abstract/Free Full Text]

GRABOWSKA-JOACHIMIAK, A. and A. JOACHIMIAK, 2002  C-banded karyotypes of two Silene species with heteromorphic sex chromosomes. Genome 45:243-252.[Medline]

GRANT, S., A. HOUBEN, B. VYSKOT, J. SIROKY, and W. PAN et al., 1994a  Genetics of sex determination in flowering plants. Dev. Genet. 15:214-230.

GRANT, S., B. HUNKIRCHEN, and H. SAEDLER, 1994b  Developmental differences between male and female flowers in the dioecious plant Silene latifolia.. Plant J. 6:471-480.

GRAVES, J. A. M., M. J. WAKEFIELD, and R. TODER, 1998  The origin and evolution of the pseudoautosomal regions of the human sex chromosomes. Hum. Mol. Genet. 7:1991-1996.[Abstract/Free Full Text]

GUTTMAN, D. S. and D. CHARLESWORTH, 1998  An X-linked gene with a degenerate Y-linked homologue in a dioecious plant. Nature 393:263-266.[Medline]

HOWDEN, R., S. K. PARK, J. M. MOORE, J. ORME, and U. GROSSNIKLAUS et al., 1998  Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis. Genetics 149:621-631.[Abstract/Free Full Text]

KIMURA, T., S. TAKEDA, T. ASAHI, and K. NAKAMURA, 1990  Primary structure of a precursor for the {delta}-subunit of sweet potato mitochondrial F1-ATPase deduced from full length cDNA. J. Biol. Chem. 265:6079-6085.[Abstract/Free Full Text]

LAGERCRANTZ, U. and T. AXELSSON, 2000  Rapid evolution of the CONSTANS LIKE genes in plants. Mol. Biol. Evol. 17:1499-1507.[Abstract/Free Full Text]

LAHN, B. T. and D. C. PAGE, 1997  Functional coherence of the human Y chromosome. Science 278:675-680.[Abstract/Free Full Text]

LAHN, B. T. and D. C. PAGE, 1999a  Four evolutionary strata on the human X chromosome. Science 286:964-967.[Abstract/Free Full Text]

LAHN, B. T. and D. C. PAGE, 1999b  Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nat. Genet. 21:429-433.[Medline]

LAHN, B. T., N. M. PEARSON, and K. JEGALIAN, 2001  The human Y chromosome, in the light of evolution. Nat. Rev. Genet. 2:207-216.[Medline]

LARDON, A., A. AGHMIR, S. GEORGIEV, F. MONÉGER and I. NEGRUTIU, 1999a The Y chromosome of white campion: sexual dimorphism and beyond, pp. 89–100 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.

LARDON, A., S. GEORGIEV, A. AGHMIR, G. L. MERRER, and I. NEGRUTIU, 1999b  Sexual dimorphism in white campion: complex control of carpel number is revealed by Y chromosome deletions. Genetics 151:1173-1185.[Abstract/Free Full Text]

LEBEL-HARDENACK, S., D. YE, H. KOUTNIKOVA, H. SAEDLER, and S. R. GRANT, 1997  Conserved expression of a TASSELSEED2 homolog in the tapetum of the dioecious Silene latifolia and Arabidopsis thaliana.. Plant J. 12:515-526.[Medline]

LEBEL-HARDENACK, S., E. HAUSER, T. F. LAW, J. SCHMID, and S. R. GRANT, 2002  Mapping of sex determination loci on the white campion (Silene latifolia) Y chromosome using amplified fragment length polymorphism. Genetics 160:717-725.[Abstract/Free Full Text]

LI, W. H., 1997 Principles of Molecular Evolution. Sinauer, Sunderland, MA.

LIANG, P. and A. B. PARDEE, 1992  Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967-971.[Abstract/Free Full Text]

LIU, Y. G. and R. F. WHITTIER, 1995  Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674-681.[Medline]

LIU, Y. G., N. MITSUKAWA, T. OOSUMI, and R. F. WHITTIER, 1995  Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8:457-463.[Medline]

MAEO, K., A. MORIKAMI, M. SOGA, S. IMANISHI, and K. NAKAMURA, 1999  Expression patterns of two genes for the delta-subunit of mitochondrial F1-ATP synthase from sweet potato in transgenic tobacco plants and cells. Plant Cell Physiol. 40:866-873.[Abstract/Free Full Text]

MARTIN, K. J. and A. B. PARDEE, 1999  Principles of differential display. Methods Enzymol. 303:234-258.[Medline]

MATSUNAGA, S. and S. KAWANO, 2001  Sex determination by sex chromosomes in dioecious plants. Plant Biol. 3:481-488.

MATSUNAGA, S., S. KAWANO, H. TAKANO, H. UCHIDA, and A. SAKAI et al., 1996  Isolation and developmental expression of male reproductive organ-specific genes in a dioecious campion, Melandrium album (Silene latifolia). Plant J. 10:679-689.[Medline]

MATSUNAGA, S., S. KAWANO, and T. KUROIWA, 1997  MROS1, a male stamen-specific gene in the dioecious campion Silene latifolia is expressed in mature pollen. Plant Cell Physiol. 38:499-502.[Abstract/Free Full Text]

MONÉGER, F., N. BARBACAR, and I. NEGRUTIU, 2000  Dioecious Silene at the X-road: the reasons Y. Sex. Plant Reprod. 12:245-249.

MORIKAMI, A., K. AISO, T. ASAHI, and K. NAKAMURA, 1992  The {delta}'-subunit of higher plant six-subunit mitochondrial F1-ATPase is homologous to the {delta}-subunit of animal mitochondrial F1-ATPase. J. Biol. Chem. 267:72-76.[Abstract/Free Full Text]

NAKAO, S., S. MATSUNAGA, A. SAKAI, T. KUROIWA, and S. KAWANO, 2002  RAPD isolation of a Y chromosome specific ORF in a dioecious plant, Silene latifolia.. Genome 45:413-420.[Medline]

NEGRUTIU, I., B. VYSKOT, N. BARBACAR, S. GEORGIEV, and F. MONÉGER, 2001  Dioecious plants. A key to the early events of sex chromosome evolution. Plant Physiol. 127:1418-1424.[Free Full Text]

PRESCOTT, M., N. C. BUSH, P. NAGLEY, and R. J. DEVENISH, 1994  Properties of yeast cells depleted of the OSCP subunit of mitochondrial ATP synthase by regulated expression of the ATP5 gene. Biochem. Mol. Biol. Int. 34:789-799.[Medline]

ROBERTSON, S. E., Y. LI, C. P. SCUTT, M. E. WILLIS, and P. M. GILMARTIN, 1997  Spatial expression dynamics of Men-9 delineate the third floral whorl in male and female flowers of dioecious Silene latifolia.. Plant J. 12:155-168.[Medline]

ROZAS, J. and R. ROZAS, 1999  DnaSP version 3.0: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.[Abstract/Free Full Text]

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SAXENA, R., L. G. BROWN, T. HAWKINS, R. K. ALAGAPPAN, and H. SKALETSKY et al., 1996  The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nat. Genet. 14:292-299.[Medline]

SCUTT, C. P., Y. LI, S. E. ROBERTSON, M. E. WILLIS, and P. M. GILMARTIN, 1997  Sex determination in dioecious Silene latifolia: effects of the Y chromosome and the parasitic smut fungus (Ustilago violacea) on gene expression during flower development. Plant Physiol. 114:969-979.[Abstract]

SCUTT, C. P., T. JENKINS, M. FURUYA, and P. M. GILMARTIN, 2002  Male specific genes from dioecious white campion identified by fluorescent differential display. Plant Cell Physiol. 43:563-572.[Abstract/Free Full Text]

SIROKY, J., M. R. CASTIGLIONE, and B. VYSKOT, 1998  DNA methylation patterns of Melandrium album chromosomes. Chromosome Res. 6:441-446.[Medline]

SIROKY, J., J. HODURKOVA, I. NEGRUTIU, and B. VYSKOT, 1999  Functional and structural chromosome analyses in autotetraploid Silene latifolia. Ann. Bot. 84:633-638.[Abstract/Free Full Text]

SIROKY, J., M. LYSAK, J. DOLEZEL, E. KEJNOVSKY, and B. VYSKOT, 2001  Heterogeneity of rDNA distribution and genome size in Silene spp. Chromosome Res. 9:387-393.[Medline]

TERAUCHI, R. and G. KAHL, 2000  Rapid isolation of promoter sequences by TAIL-PCR: the 5'-flanking regions of Pal and Pgi genes from yams (Dioscorea). Mol. Gen. Genet. 263:554-560.[Medline]

UH, M., D. JONES, and D. M. MUELLER, 1990  The gene coding for the yeast oligomycin sensitivity-conferring protein. J. Biol. Chem. 265:19047-19052.[Abstract/Free Full Text]

VYSKOT, B., 1999 The role of DNA methylation in plant reproductive development, pp. 101–120 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.

VYSKOT, B., A. ARAYA, J. VEUSKENS, I. NEGRUTIU, and A. MOURAS, 1993  DNA methylation of sex chromosomes in a dioecious plant, Melandrium album.. Mol. Gen. Genet. 239:219-224.[Medline]

WALKER, J. E. and I. R. COLLINSON, 1994  The role of the stalk in the coupling mechanism of F1F0-ATPases. FEBS Lett. 346:39-43.[Medline]

WESTERGAARD, M., 1958  The mechanism of sex determination in dioecious plants. Adv. Genet. 9:217-281.[Medline]

WILKENS, S., A. RODGERS, I. OGILVIE, and R. A. CAPALDI, 1997  Structure and arrangement of the {delta} subunit in the E. coli ATP synthase (ECF1F0). Biophys. Chem. 68:95-102.[Medline]

YE, D., M. OLIVEIRA, J. VEUSKENS, Y. WU, and P. INSTALLE et al., 1991  Sex determination in the dioecious Melandrium. The X/Y chromosome system allows complementary cloning strategies. Plant Sci. 80:93-106.




This article has been cited by other articles:


Home page
Plant Cell PhysiolHome page
Y. Kazama, M. T. Fujiwara, A. Koizumi, K. Nishihara, R. Nishiyama, E. Kifune, T. Abe, and S. Kawano
A SUPERMAN-like Gene is Exclusively Expressed in Female Flowers of the Dioecious Plant Silene latifolia
Plant Cell Physiol., June 1, 2009; 50(6): 1127 - 1141.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Mrackova, M. Nicolas, R. Hobza, I. Negrutiu, F. Moneger, A. Widmer, B. Vyskot, and B. Janousek
Independent Origin of Sex Chromosomes in Two Species of the Genus Silene
Genetics, June 1, 2008; 179(2): 1129 - 1133.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Bergero, D. Charlesworth, D. A. Filatov, and R. C. Moore
Defining Regions and Rearrangements of the Silene latifolia Y Chromosome
Genetics, April 1, 2008; 178(4): 2045 - 2053.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
A. Koizumi, Y. Amanai, K. Ishii, K. Nishihara, Y. Kazama, W. Uchida, and S. Kawano
Floral Development of an Asexual and Female-Like Mutant Carrying Two Deletions in Gynoecium-Suppressing and Stamen-Promoting Functional Regions on the Y Chromosome of the Dioecious Plant Silene latifolia
Plant Cell Physiol., October 1, 2007; 48(10): 1450 - 1461.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zluvova, S. Georgiev, B. Janousek, D. Charlesworth, B. Vyskot, and I. Negrutiu
Early Events in the Evolution of the Silene latifolia Y Chromosome: Male Specialization and Recombination Arrest
Genetics, September 1, 2007; 177(1): 375 - 386.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
T. R. Meagher
Linking the Evolution of Gender Variation to Floral Development
Ann. Bot., August 1, 2007; 100(2): 165 - 176.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Bergero, A. Forrest, E. Kamau, and D. Charlesworth
Evolutionary Strata on the X Chromosomes of the Dioecious Plant Silene latifolia: Evidence From New Sex-Linked Genes
Genetics, April 1, 2007; 175(4): 1945 - 1954.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
R. Ming, J. Wang, P. H. Moore, and A. H. Paterson
Sex chromosomes in flowering plants
Am. J. Botany, February 1, 2007; 94(2): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. E. Ironside and D. A. Filatov
Extreme Population Structure and High Interspecific Divergence of the Silene Y Chromosome
Genetics, October 1, 2005; 171(2): 705 - 713.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zluvova, B. Janousek, I. Negrutiu, and B. Vyskot
Comparison of the X and Y Chromosome Organization in Silene latifolia
Genetics, July 1, 2005; 170(3): 1431 - 1434.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
R. Gorelick
Theory for why dioecious plants have equal length sex chromosomes
Am. J. Botany, June 1, 2005; 92(6): 979 - 984.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. A. Filatov
Evolutionary History of Silene latifolia Sex Chromosomes Revealed by Genetic Mapping of Four Genes
Genetics, June 1, 2005; 170(2): 975 - 979.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. A. Filatov
Substitution Rates in a New Silene latifolia Sex-Linked Gene, SlssX/Y
Mol. Biol. Evol., March 1, 2005; 22(3): 402 - 408.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Tanurdzic and J. A. Banks
Sex-Determining Mechanisms in Land Plants
PLANT CELL, June 1, 2004; 16(suppl_1): S61 - S71.
[Full Text] [PDF]


Home page
GeneticsHome page
B. F. McAllister
Sequence Differentiation Associated With an Inversion on the Neo-X Chromosome of Drosophila americana
Genetics, November 1, 2003; 165(3): 1317 - 1328.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Lengerova, R. C. Moore, S. R. Grant, and B. Vyskot
The Sex Chromosomes of Silene latifolia Revisited and Revised
Genetics, October 1, 2003; 165(2): 935 - 938.
[Abstract] [Full Text] [PDF]