- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Moore, R. C.
- Articles by Grant, S. R.
- Search for Related Content
- PUBMED
- Articles by Moore, R. C.
- Articles by Grant, S. R.
Genetic and Functional Analysis of DD44, a Sex-Linked Gene From the Dioecious Plant Silene latifolia, Provides Clues to Early Events in Sex Chromosome Evolution
Richard C. Moorea, Olga Kozyrevaa, Sabine Lebel-Hardenacka, Jiri Sirokyb, Roman Hobzab, Boris Vyskotb, and Sarah R. Grantaa Department of Biology, University of North Carolina, Chapel Hill, North Carolina 27599
b Institute of Biophysics, Czech Academy of Sciences, 612 62 Brno, Czech Republic
Corresponding author: Richard C. Moore, University of North Carolina, Coker 107, CB 3280, Chapel Hill, NC 27599., rcmoore{at}email.unc.edu (E-mail)
Communicating editor: C. S. GASSER
| ABSTRACT |
|---|
Silene latifolia is a dioecious plant with heteromorphic sex chromosomes. The sex chromosomes of S. latifolia provide an opportunity to study the early events in sex chromosome evolution because of their relatively recent emergence. In this article, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of a sex-linked gene from S. latifolia, DD44 (Differential Display 44). DD44 is homologous to the oligomycin sensitivity-conferring protein, an essential component of the mitochondrial ATP synthase, and is ubiquitously expressed in both sexes. We have been able to genetically map DD44 to a region of the Y chromosome that is genetically linked to the carpel-suppressing locus. Although we have physically mapped DD44 to the distal end of the long arm of the X chromosome using fluorescence in situ hybridization (FISH), DD44 maps to the opposite arm of the Y chromosome as determined by our genetic map. These data suggest that chromosomal rearrangements have occurred on the Y chromosome, which may have contributed to the genetic isolation of the Y chromosome. We discuss the implications of these results with respect to the structural and functional evolution of the S. latifolia Y chromosome.
THE presence of a heteromorphic Y chromosome defines males in the dioecious plant, Silene latifolia (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Preliminary evidence suggests that the sex chromosomes of S. latifolia are following a similar pattern of evolution to that of the human sex chromosomes. The inhibition of recombination between the proto-X and proto-Y chromosomes has already occurred in S. latifolia sex chromosomes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
However, there are some differences between S. latifolia and human sex chromosomes. The S. latifolia Y chromosome is clearly at an earlier stage of evolution and has not degenerated to the extent of the human Y chromosome. First of all, C-banding experiments and methylation analyses show that the S. latifolia Y chromosome is largely euchromatic with the exception of centromeric and subtelomeric DNA (![]()
![]()
![]()
![]()
![]()
![]()
We are interested in knowing whether the S. latifolia Y chromosome is in the process of evolving structural and functional coherence, much like the Y chromosome of humans (![]()
![]()
![]()
![]()
![]()
![]()
We began our study with a screen designed to identify sex-linked genes expressed specifically in male premeiotic floral meristems, because we are interested in addressing the hypothesis that the S. latifolia Y chromosome is functionally coherent. In this article, we present the genetic and molecular analysis of one of the genes identified from this screen, DD44 (Differential Display 44). DD44 has a simple sex-linkage pattern, with an X- and Y-linked allele, although it is ubiquitously expressed in males and females. This expression profile is not unexpected, as DD44 is homologous to the oligomycin sensitivity-conferring protein (OSCP), an essential component of the mitochondrial ATP synthase. Interestingly, genetic and physical mapping of DD44 suggests that the position of the Y-linked allele of DD44 is the result of a chromosomal rearrangement. We compare our findings with those for other sex-linked genes in S. latifolia and discuss the implications of these data for the functional coherence of the S. latifolia Y chromosome.
| MATERIALS AND METHODS |
|---|
Plant materials:
Male and female S. latifolia plants of the U9 and MR4X64 ecotypes (described in ![]()
![]()
![]()
Differential display:
Differential display (![]()
![]()
![]()
Extraction of nucleic acids:
DNA was isolated from young leaves by CsCl banding. Briefly, 510 g of ground frozen tissue was incubated in extraction buffer [0.1 M EDTA pH 8.0, 3x SSC, 0.1 M sodium diethyldithiocarbamic acid (Sigma, St. Louis)] at 37° for 15 min followed by two rounds of phenol:chloroform extraction and ethanol precipitation. Precipitated DNA was spooled and resuspended in 7.5 ml of TE buffer, pH 8.0, at 65° for 15 min with periodic agitation. CsCl (8.73 g) and 20 µl of ethidium bromide (20 mg/ml) were added to resuspended DNA and the sample was spun overnight at 55,000 rpm in an L7-55 Ultracentrifuge (Beckman, Palo Alto, CA). The genomic DNA band was removed with a pipette, the ethidium bromide was extracted multiple times with 7:1 (v/v) isopropanol:water, and the DNA was ethanol precipitated. Precipitated DNA was air dried, resuspended in TE, and stored at 4°.
Total RNA was isolated from open flowers, flower buds (<1 mm), young leaves of male and female S. latifolia, and isolated meristems of mixed male and female S. latifolia seedlings using TRIZOL reagent (Invitrogen Life Technologies). Poly (A)+ RNA was procured from total RNA using the Oligotex mRNA midi kit (QIAGEN, Valencia, CA) and treated with DNase I using the DNA-free kit (Ambion, Austin, TX).
Southern and Northern blot analyses:
Genomic DNA and RNA gel blots were made using standard techniques (![]()
-32P]ATP using the Prime-It II random primer labeling kit (Stratagene, La Jolla, CA). Standard conditions for Southern blot hybridization and washing were 2-hr preincubation in hybridization solution [1x SSPE, 1% (w/v) SDS, 10% (w/v) polyethylene glycol (PEG), 125 mg heparin, 50 mg herring sperm DNA] at 65°; overnight incubation in 10 ml hybridization solution with labeled probe; and 15-min wash with 2x SSC, 0.1% SDS at 65° followed by three 15-min washes with 0.5x SSC, 0.1% SDS at 65°. Standard conditions for Northern blot hybridization and washing were 2-hr pre-incubation in ULTRAhyb (Ambion) at 42°; overnight incubation with labeled probe in 10 ml of ULTRAhyb (Ambion) at 42°; and two 5-min washes with 2x SSC, 0.1% SDS followed by three 15-min washes with 0.1x SSC, 0.1% SDS at 42°.
Isolation of DD44 cDNA and genomic clones:
PCR was used to amplify a 214-bp DD44 partial cDNA clone isolated from differential display using primers DD44F1 and DD44R1 (see below). The resulting PCR product was gel purified using a QIAquick gel extraction kit (QIAGEN) and used to probe a male S. latifolia floral Lambda Zap II cDNA library (Stratagene, La Jolla CA) and a male S. latifolia Lambda FIX II genomic library (Stratagene) for DD44 cDNA and genomic clones, respectively. Plasmid containing the DD44 cDNA was rescued from positive cDNA clones using the Rapid Excision kit (Stratagene). A DD44 genomic clone was digested with NotI, and the resulting 18-kb insert was subcloned into linearized (EagI) pBR322 for ease of manipulation and labeling.
Primers and PCR reactions:
Unless otherwise noted, all products were amplified from 150 ng of template using Taq polymerase (Invitrogen Life Technologies), and all PCR reactions used the following conditions: 94° for 2 min; 30 cycles of 94° for 30 sec, X° for 45 sec, 72° for Y min (where X and Y are defined below for each reaction); followed by 72° for 5 min.
The 214-bp DD44 probe was amplified using primers DD44F1 (5' GTGTTCGACATGTCCATCAGAACC 3') and DD44R1 (5' CCATCACTTCTTATTTTATGCAGG 3') with a 54° annealing temperature and 45-sec extension. The same primers and conditions were used to amplify the male-specific doublet from genomic DNA, and products were run on a 4% agarose gel to visualize the doublet.
To obtain the complete genomic sequence and structure of the DD44 X- and Y-linked alleles (DD44X and DD44Y), we performed three sequential PCR amplifications of three regions of DD44. All PCR amplifications of DD44Y were performed from a U9 male, while all PCR amplifications of DD44X were performed from a U9 female. The first amplification was from exon 3 to the 3' flanking region using a DD44X- or DD44Y-specific reverse primer, DD44XR2 (5' GCCAACAAAATTAGCGTAGCG 3') or DD44YR2 (5' TCCGACGAAAACGAGGGAAG 3'), and a shared forward primer in exon 3, DD44F2 (5' CTGTCAGTGCCCTCGGATATAAGA 3'). DD44X and DD44Y products were amplified using a 56° annealing temperature and 2-min extension time. From these sequences, a hypervariable region was found in the middle of intron 3, and reverse primers specific to DD44X and DD44Y were designed: DD44XR3 (5' CCTTTGGTCTGGTATGGAGGGA 3') and DD44YR3 (5' GACAGAGAAATGAGAACTTCCACAATAAA 3'). For the second PCR amplification, these sequence-specific primers were used in conjunction with a common forward primer found in exon 2, DD44F3 (5' CGAAGAGCTTTGCTACCAAGGC 3'). This genomic segment of DD44X was amplified using a 57° annealing temperature and 3-min extension time. For amplification of this segment of DD44Y, long-range PCR was performed with the TaKaRa DNA polymerase (PanVera, Madison, WI) using the following conditions: 94° for 2 min; 30 cycles of 98° for 10 sec, 63° for 7 min; followed by 72° for 5 min. For the final PCR amplification, a hypervariable region in intron 2 was used to design one last set of reverse primers specific to DD44X and DD44Y: DD44XR4 (5' CCCAAACCACGGCATACATGTAG 3') and DD44YR4 (5' GGAGCTGAGGAGGCTTGGGA 3'). These primers were used in conjunction with a forward primer starting at the start codon, DD44F4 (5' ATGTCAATGGCGAACCGCAT 3'), to amplify the remaining genomic sequence. DD44X and DD44Y products were amplified using a 60° annealing temperature and 45-sec extension time. Primer pairs DD44F3/DD44XR3 and DD44F3/DD44XR4 amplified products from the U9 female and not the U9 male (data not shown), whereas primer pairs DD44F2/DD44YR2, DD44F3/DD44YR3, and DD44F3/DD44YR4 amplified products from the U9 male and not the U9 female (data not shown).
Amplification of DD44 Y-specific markers from genomic DNA isolated from Y-deletion mutants was performed using either DD44F1 or DD44R1 as described above, which amplifies a doublet in males, or DD44F1 and DD44YR2, which amplifies a band only in males, with a 54° annealing temperature and 1-min extension. Amplification of SlY1 from genomic DNA isolated from Y-deletion mutants was performed using SlY1 + 11 (![]()
![]()
![]()
Thermal asymmetric interlaced PCR:
Thermal asymmetric interlaced (TAIL) PCR was used to identify variable genomic sequences flanking the DD44 214-bp differential display sequence. TAIL PCR conditions were as described in ![]()
![]()
![]()
![]()
![]()
- DD44TAILF1 (5' aagtgttcgacatgtccatcagaaccag 3');
- DD44TAILF2 (5' accagggcaagacagatggagaggtt 3');
- DD44TAILF3 (5' tcaacatatgatggcactggtgctaca 3');
- DD44TAILF4 (5' tcccgtcattacagtttcccct 3');
- DD44TAILF5 (5' ctaagcgccctttttgtatctctca 3').
RT-PCR:
Poly(A)+ RNA was prepared from total RNA as described above. cDNA was prepared from poly(A)+ RNA using the M-MLV reverse transcriptase in conjunction with an oligo(dT) primer using the RETROscript kit (Ambion). PCR reactions were performed using DD44F1 and DD44R1 primers using conditions described above.
DNA sequencing and analysis:
Before sequencing, PCR products were cloned into the TOPO pCR2.1 cloning vector (Invitrogen Life Technologies). Sequencing of cDNA, genomic, and PCR-amplified clones of DD44 was performed by the University of North Carolina Automated DNA Sequencing Facility (Chapel Hill, NC). BLAST searches were performed with default settings using the National Center for Biotechnology (NCBI) search engine (http://www.ncbi.nlm.nih.gov/BLAST/). Sequence analyses and contig assemblies were performed using the programs Sequencher version 4.0.5 (Gene Codes Corporation, Ann Arbor, MI) and Vector NTI version 6.0 (InforMax, Bethesda, MD). Sequence alignments were performed by using the CLUSTALW algorithm of the Vector NTI program, AlignX.
Genomic sequences for DD44X (GenBank accession no.
AF543833) and DD44Y (GenBank accession no.
AF543834) were aligned manually and unalignable regions removed. The divergence between the DD44X and DD44Y was analyzed using DnaSP version 3.0 software (![]()
![]()
![]()
Statistical analysis:
Chi-square and Fisher's exact test analyses were performed using the SAS statistics package. Order of Y-linked genes with respect to previously described amplified fragment length polymorphism (AFLP) markers was predicted as described previously (![]()
![]()
Probe preparation and labeling for fluorescence in situ hybridization:
The 18-kb DD44 genomic clone in pBR322 was cut with SalI and the insert was separated by gel electrophoresis (0.5% agarose). DNA was extracted from the gel using the QIAquick gel extraction kit (QIAGEN). The probe was labeled by Cy3-dUTP (Amersham Pharmacia Biotech, Little Chalfont, England) in a standard nick translation reaction using Nick Translation Mix (Roche, Nutley, NJ). Labeled probe was purified by the QIAquick nucleotide removal kit (QIAGEN).
Preparation of metaphase chromosomes for fluorescence in situ hybridization:
Root tips from germinating seeds or hairy root cultures of S. latifolia (see above) were used as a source of chromosomes for mitotic spreads and prepared according to ![]()
![]()
Fluorescence in situ hybridization:
Slides were treated with RNAse (100 µg/ml in 2x SSC; QIAGEN), for 1 hr at 37° and washed three times with 2x SSC. Remnants of the cytoplasm were removed by 10 µg/ml Pepsin (Sigma) in 0.01 N HCl for 10 min at 37°, washed as before, dehydrated in ascending ethanol series, and air dried. The hybridization mixture (for one slide, 30 µl) consisted of 200 µg of labeled probe, 15 µl formamide, 6 µl of 50% dextran sulfate solution, and 3 µl of 20x SSC. The volume was brought to 30 µl by adding TE, pH 8. Heat-denatured (76°) hybridization mix was applied to slides, covered by a cover slip, and placed on a cycler equipped with a flat plate (cycler model PHC-3; Techne, Cambridge, England). Slides with probe mixes in them were denatured at 75° for 5 min and brought to 37° using stepwise cooling. The slides were hybridized for 40 hr. Posthybridization wash consisted of three washes in 2x SSC at 42°, two stringent washes (5 min each) in 0.1x SSC at 42°, and 4x SSC supplemented by 0.1% Tween 20 (0.1%; Sigma). Slides were mounted in Vectashield (Vector Laboratories, Burlingame, CA) containing 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI) as a counterstain and viewed under an Olympus AX 70 epifluorescent microscope equipped by filter sets for DAPI and Cy3. Images were captured by a CCD camera using ISIS software (Meta Systems GmBH, Altlussheim, Germany) as black and white figures and merged.
| RESULTS |
|---|
Identification of candidate sex-linked, male-specific genes in S. latifolia:
We used a twofold approach to identify sex-linked genes in S. latifolia. First, we performed differential display on mRNA isolated from male and female premeiotic floral buds (stages 16) to identify transcripts that were potentially expressed only during the initial stages of male floral differentiation and development. It is during these early stages of floral development, before there are any gross morphological differences in male and female floral development, that we expected to find genes involved in sex determination to be expressed. Second, we used the partial transcripts identified from differential display to probe a Southern blot of total genomic DNA pooled from either five males or five females and digested with EcoRI, BamHI, or HindIII. Transcripts that gave at least one male-specific restriction fragment length polymorphism (RFLP) were selected for a more detailed segregation analysis to confirm their chromosomal linkage and expression analyses to confirm whether they were expressed specifically in male tissues.
We identified 13 putative male-specific transcripts from our initial differential display analysis. Six of these showed at least one male-specific RFLP in our initial screen with Southerns of pooled male vs. female genomic DNA (data not shown), and two of these subsequently showed evidence of sex linkage in further segregation analyses (below and data not shown). Here, we present the genetic and physical mapping, expression analysis, and molecular evolutionary analysis of the gene that showed the simplest pattern of sex linkage, DD44.
DD44 is linked to the X and Y chromosomes:
We performed a segregation analysis of DD44 to verify the chromosomal linkage of male-specific RFLPs. We mated parents from two different S. latifolia populations that are polymorphic for DD44. The fate of male-specific RFLPs was followed in 10 male and 10 female F1 progeny (Fig 1). There were two male-specific RFLPs of DD44: one (>12 kb) was inherited by all female progeny, the X-linked allele; another (8 kb) was inherited by all male progeny, the Y-linked allele. Using the formula from ![]()
|
DD44 encodes the OSCP of the mitochondrial ATP synthase:
We screened a cDNA library derived from male floral mRNA with the 214-bp DD44 differential display product to identify a full-length cDNA for DD44. We obtained a 976-bp cDNA clone containing 639 bp of the 693-bp DD44 open reading frame (ORF) and 337 bp of the 3' flanking region. The initial 54 bp of the ORF was deduced from the genomic sequence of DD44 (detailed below). Our probe sequence was found in the region spanning the last 71 bp of the DD44 ORF into the 3' flanking sequence.
Blast alignment of the translated DD44 ORF against the GenBank nonredundant protein database yielded greatest similarity to the
-subunit of the mitochondrial F1-ATP synthase of the sweet potato, Ipomoea batatas (E value = 8 x 10-69; accession no. BAA77508), which is homologous to the OSCP from other eukaryotes (![]()
-subunit of I. batatas and 63% nucleotide identity with the A. thaliana sequence. At the protein level, DD44 is 62.9% identical (72.7% similar) to the I. batatas sequence and 53.1% identical (68% similar) to the A. thaliana sequence. DD44 contains the conserved functional domain of the OSCP family between aa55 and aa224 (34.5% identity, 46% similarity to the pfam00213 consensus domain). The presence of this domain, and the high degree of similarity with other plant OSCPs, places DD44 in this category of conserved proteins.
We tried to characterize the function of the OSCP in higher plants by screening for homozygous T-DNA insertion lines in the OSCP homolog of A. thaliana (At5g13450). BLAST analysis of At5g13450 against left border sequences of T-DNA insertion lines from the Salk Institute Genomic Analysis Library (SIGnAL; La Jolla, CA) identified a T-DNA insertion line (SALK_010674) with an insertion
68 bp upstream of the start codon of At5g13450. T3 seed was obtained from the Arabidopsis Biological Resource Center (ARBC; Columbus, OH). No T-DNA insertion lines were found in the coding region of the gene. We tested 17 T3 progeny harvested after kanamycin selection for insertions in the At5g13450 promoter and identified 14 individuals heterozygous for the insertion and no individuals homozygous for the insertion (data not shown). The lack of homozygous insertions suggests that the OSCP of A. thaliana, and by homology DD44, is essential for proper growth and development in plants. To determine whether the T-DNA insertion in the At5g13450 promoter was embryo lethal or gametophytic lethal, we germinated 375 seeds from one of the T3 heterozygous insertion lines on Gamborg B-5 media with 50 µg/ml kanamycin. There were 191 kanamycin-resistant plants and 184 kanamycin-sensitive plants. The observed ratio significantly varies (P < 0.001) from the expected ratio of 2:1 resistant-to-sensitive plants expected for an embryo-lethal insertion; however, this ratio does not significantly vary from the expected ratio of 1:1 resistant-to-sensitive plants expected if the insertion is lethal to one gametophyte (![]()
DD44 is expressed in male and female tissues:
We tested whether DD44 was expressed specifically in male tissues, as differential display is prone to false positives. We performed Northern analysis on total RNA isolated from either male or female leaves, mature flowers, and unopened floral buds, using the 214-bp DD44 differential display product as a probe (Fig 2A). The DD44 probe hybridized to a single 1.15-kb band that was present in all tissue types in both males and females. We also performed reverse transcription (RT)-PCR using primers designed to amplify the 214-bp DD44 differential display sequence on cDNA synthesized from poly(A)+ mRNA isolated from male and female leaves, mature flowers, and unopened floral buds, and also from apical meristems isolated from seedlings of mixed sex. DD44 was amplified from all tissue types and in both sexes (Fig 2B). No products were observed in controls processed without reverse transcriptase (data not shown). Thus, DD44 is expressed in males and females and expression is not tissue specific. This expression profile also suggests that DD44 is performing a general "housekeeping" function, necessary throughout male and female plant development.
|
The PCR primers used to amplify the DD44 differential display sequence also amplify a male-specific polymorphism from male genomic DNA. PCR from genomic DNA using these primers amplifies a doublet in males and only a single band in females (Fig 2B). The larger PCR product was determined to be linked to the Y chromosome by a segregation analysis of F1 progeny from a cross of polymorphic parents (Fig 3A). This same doublet was specifically amplified from cDNA from all male tissues in our RT-PCR analysis, while only the lower, shared band was amplified in females (Fig 2B). The size difference between the male-specific upper band and the shared lower band is small enough (<20 bp) that it is not resolved using Northern analysis. These data indicate that males express both the Y-linked allele and the shared, X-linked allele of DD44 in all tissues examined.
|
Genomic structure of DD44X and DD44Y:
Initially, we deduced the genomic structure of DD44 by sequencing an 8-kb region of an 18-kb genomic clone identified by screening a S. latifolia male genomic DNA phage library with the 214-bp DD44 differential display sequence. The DD44 sequence from the genomic clone contained six exons (totaling 693 bp) and five introns (totaling 3436 bp). However, we were interested in obtaining genomic sequence and structure for the DD44 X- and Y-linked alleles. Therefore, we used TAIL PCR from total male genomic DNA to walk both 5' and 3' from the 214-bp DD44 differential display sequence in hopes of identifying variable flanking sequences corresponding to the X and Y alleles of DD44.
We identified two alleles in the 3' flanking region of DD44 that were characterized by an
40-bp indel. Reverse primers specific to each allele were designed and tested in conjunction with the forward primer found in the shared DD44 partial cDNA sequence (DD44F1). One primer (DD44YR2) amplified a male-specific, 420-bp fragment that segregated only to F1 male progeny; therefore, it amplified the Y-linked allele (Fig 3B). The other primer (DD44XR2) amplified a 400-bp fragment from both males and females and segregated to all progeny regardless of sex; therefore, it amplified the X-linked allele (Fig 3C).
To obtain the complete genomic sequence and structure of the DD44 X- and Y-linked alleles (DD44X and DD44Y), we performed three sequential PCR amplifications of three regions of DD44 using DD44X- or DD44Y-specific primers as described in MATERIALS AND METHODS. Most of the genomic structure of DD44X and DD44Y is similar (Fig 4). However, there was surprising difference in the length of the intron 2 between DD44Y and DD44X. While intron 2 of DD44X was only 1.6 kb, it was 7.5 kb in DD44Y. Only the 5' and 3' flanking sequences of DD44Y intron 2 could be aligned with intron 2 sequence of DD44X. Blastx analysis of the 5' region of the internal region of intron 2 specific to DD44Y showed similarity (E value = 1 x 10-16) to a retrotransposon polyprotein from the flatworm, Schistosoma japonicum (accession no. AAK14815).
|
Deletion mapping of DD44, SlY1, and SlY4 on the Y chromosome:
We used the Y chromosome AFLP-deletion map developed by ![]()
![]()
![]()
|
For mapping DD44Y, we scored for the presence or absence of the two DD44 Y-linked PCR polymorphisms (Fig 3A and Fig B) in the Y-deletion mutants. Both Y-linked PCR polymorphisms were absent in 10 of the hermaphrodite mutants, but present in all sterile mutants. DD44 was significantly associated with the carpel-suppressing locus on the basis of chi-square and Fisher's exact test (Pr = 9.76 x 10-4), and DD44 has a LOD > 3 of being linked to the group A linkage group of markers, which contains the carpel-suppressing locus. Specifically, the DD44 Y-linked polymorphisms were missing in hermaphrodite H10, but present in mutant H115, thus placing DD44 between markers L10 and L9 on the AFLP deletion map (Fig 5). The carpel-suppressing locus is deleted from the Y chromosome of hermaphrodite mutants and dominantly inhibits carpel formation in males (![]()
![]()
![]()
![]()
![]()
For mapping SlY1, we first designed primers that amplified either a 1.4-kb band (primers SlY1 + 11 and SLY1_4551R) or a 1-kb band (primers SLY1_4505F and SLY1_5813R) only from males in our three S. latifolia ecotypes (data not shown). Both primer sets show the same amplification pattern from our population of Y-deletion mutants (Fig 5). SlY1 does not amplify from the hermaphrodite mutants UH15, UH4, and UH1, all of which are missing loci L7, L6, and L8 in the group B linkage group. Furthermore, SlY1 does not amplify from the early sterile mutant US2, which is missing L7, and the late steriles MS63 and MS57, which are missing group B markers, as well as the group C markers. SlY1 was not significantly associated with any sex-determination loci, although SlY1 has a LOD > 3 of being linked to the group B linkage group of markers (Fig 5). Group B markers are not linked to sex-determining loci, although they are missing from many of the large-deletion late-sterile mutants.
To map SlY4, we used previously published Y-specific primers (![]()
Both SlY1 and SlY4 map to the opposite end of the Y-deletion map from DD44; however, neither gene corresponds to a sex-determining locus, although SlY4 is deleted primarily in late-sterile mutants, the locus of which is thought to reside on the q arm of the Y chromosome (![]()
![]()
![]()
![]()
Physical mapping of DD44 on the sex chromosomes using fluorescence in situ hybridization:
We were able to physically map the location of DD44 on the S. latifolia sex chromosomes using the technique of fluorescence in situ hybridization (FISH), using the 18-kb DD44 genomic clone as a probe. A Southern blot of the genomic clone digested with EcoRI, HindIII, or BamHI probed with radioactively labeled total male genomic DNA gave only a weak hybridization signal (data not shown), indicating our clone did not contain highly repetitive DNA sequences. We subsequently subcloned the 18-kb genomic fragment into pBR322 for ease of manipulation and probe labeling. The 18-kb DD44 genomic clone was used as a probe for FISH in metaphase chromosome spreads prepared from protoplasts derived from mitotically synchronized root tips of either S. latifolia seedlings or S. latifolia HR cultures. The DD44X-specific PCR primer pair (DD44F1/DD44XR2) amplified a band from our DD44 genomic clone; thus our genomic clone represents an X-linked allele (data not shown).
The S. latifolia diploid genome consists of two pairs of 11 autosomal chromosomes and two larger sex chromosomes: Females have two submetacentric X chromosomes and males have one X and one larger, metacentric Y chromosome (![]()
|
In metaphase X chromosomes, the identification of the p and q arms is relatively straightforward, as the X chromosome is submetacentric (arm ratio = 1.44 ± 0.15; ![]()
|
Cytological identification of which arm the Y chromosome DD44 binds to is more difficult as it is metacentric (arm ratio = 1.09 ± 0.04; ![]()
To identify which arm remained in this Y-deletion HR line, we performed PCR from DNA isolated from the HR Y-deletion line, as well as the male line with no deletion, using four Y-specific markers: DD44Y, Bgl10, SlY1, and SlY4. PCR analysis using DD44Y-specific primers amplifies a Y-specific band from the Y-deletion HR line (Fig 8A and Fig B). Additionally, the Y-specific marker Bgl10, which is found in the same linkage group as the carpel-suppressing factor (![]()
![]()
![]()
|
Divergence of DD44X and DD44Y:
We were interested in assessing the nucleotide divergence between DD44X and DD44Y to see whether or not both of these alleles showed signs of selective constraint. We performed an alignment of all coding regions, introns (parts of intron 2 and intron 3 do not align and were removed from the analysis), and 311 bp of the 3' flanking region, to compare the DD44X and DD44Y sequences. Table 1 summarizes the total number of sites examined, the numbers of synonymous and nonsynonymous substitutions for each exon, the numbers of substitutions for each intron, and the nucleotide divergence for each region. The noncoding regions show a divergence of
7%. The results for the coding sequences can be summarized in terms of synonymous and nonsynonymous substitutions per site, Ks and Ka, respectively (Table 1). The exons show a silent site divergence of
9.6%, slightly higher than that for intron sites, and a nonsynonymous divergence of 2.5%. Exon 1 shows very high nucleotide divergence (KTotal = 0.15, Ks = 0.27) compared to the other exons.
|
The silent site divergence between DD44X and DD44Y is similar to that for the three other S. latifolia X/Y gene pairs compared (whose Ks values range from 4% for SlX/Y1 to 18% for SlX/Y4 and 20% for a short region of sequence that can be aligned between MROS3-X and -Y). This shows that DD44X and DD44Y have been separated by a similar evolutionary time to the other sex-linked gene pairs. The analysis also shows that DD44X and DD44Y are under selective constraint. Ka/Ks ratios for divergence between expressed genes in plants, either between homologous genes in different species or between similar paralogous genes in the same species, are commonly between 10 and 20% (e.g., ![]()
![]()
![]()
![]()
![]()
| DISCUSSION |
|---|
DD44 is a class 1, Y-linked gene:
The simple linkage pattern and universal expression patterns of DD44 are analogous to the class 1 group of genes of the nonrecombining region of human Y chromosome. These Y-linked genes are single-copy genes with functional X homologs, the expression of which is not developmentally restricted (![]()
![]()
Class 1 Y-linked genes are considered to be housekeeping genes and are thought to be involved in fundamental cellular processes (![]()
-subunit of the mitochondrial ATP synthase from the sweet potato, I. batatas, which is homologous to the OSCP in other eukaryotes (![]()
![]()
-subunit, which is homologous to the eukaryotic OSCP, is characterized by a six-
-helix bundle in the N terminus, which interacts with the F1 core, and a less-defined C-terminal domain, which is required for binding to the F0 structure (![]()
![]()
![]()
In plants, characterization of the structure and function of the mitochondrial OSCP has been examined in I. batatas, where the OSCP is represented by many isoforms encoded by multiple genes in the hexaploid genome (![]()
![]()
![]()
-1 and F1
-2, drive expression of the ß-glucuronidase (GUS) gene in transgenic tobacco in all tissues examined and that expression is strongest in the vascular tissue of leaves, stems, roots, and in the meristematic region of roots. These expression patterns correlate with cells with large numbers of mitochondria, such as the companion cells of phloem tissue (![]()
There are two other published Y-linked genes of S. latifolia with similar properties to DD44: SlY1 and SlY4 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Genetic and physical mapping of DD44 provides evidence for rearrangements on the S. latifolia Y chromosome:
We used two approaches to determine the position of DD44 on the Y chromosome. Physical and genetic mapping data support the localization of DD44Y to the distal region of the p arm of the Y and DD44X to the distal region of the q arm on the X. We hypothesize that this difference is due to a chromosomal rearrangement on the Y chromosome.
Chromosomal rearrangements are thought to have played a central role in the evolution of human sex chromosomes (![]()
![]()
![]()
![]()
Second, our analysis of the sequence divergence between DD44X and DD44Y does not support a large chromosomal rearrangement event leading to the isolation of DD44Y from SlY1 and SlY4. Specifically, the Ks value of DD44X/Y (0.095), a rough measure of evolutionary distance, is intermediate between that of SlX/Y1 (Ks = 0.04; ![]()
![]()
![]()
8 and 24 mya). Therefore, the S. latifolia sex-linked genes may have diverged at the same time due to a single isolation event, with the differences in Ka values being due to differences in functional constraint and with perhaps a second, more recent, event accounting for the low SlX/Y1 silent divergence. If these genes are part of the same evolutionary stratum, then the localization of DD44Y on the opposite arm of the Y from SlY1 and SlY4 may be due to a small-scale rearrangement event after the initial, large-scale chromosomal rearrangement.
Is the S. latifolia Y chromosome functionally coherent?
The human Y is considered by some to be functionally coherent (![]()
![]()
![]()
![]()
![]()
![]()
![]()
To date, only class 1 Y-linked genes have been characterized on the Y (DD44Y, SlY1, and SlY4). Importantly, no class 2 genes, those expressed specifically in males and that have no X homologs, have been identified for the S. latifolia Y chromosome. Other Y-linked genes reported for S. latifolia include MROS3, which has a Y-linked pseudogene (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. Valerie Laporte and Dr. Deborah Charlesworth (University of Edinburgh) for molecular divergence analysis as well as for insightful comments on the implications of these data and for critically reviewing the manuscript; Dr. Elizabeth Hauser (Duke University) for statistical analysis of deletion-mapping data; and Theresa Law, Johnathan Branch, Michael Lewis, Bryan Littlejohn, and Ashley McDaniel for their assistance in the lab and for care of our plants. This work was supported by a National Science Foundation grant (no. MCB-9816864), the National Institutes of Health (grant no. 1 F32 GM20891-01), and by the Grant Agency of the Czech Republic (grant no. 204/02/0417).
Manuscript received June 13, 2002; Accepted for publication October 14, 2002.
| LITERATURE CITED |
|---|
ATANASSOV, I., C. DELICHÈRE, D. A. FILATOV, D. CHARLESWORTH, and I. NEGRUTIU et al., 2001 Analysis and evolution of two functional Y-linked loci in a plant sex chromosome system. Mol. Biol. Evol. 18:2162-2168.
BARBACAR, N., S. HINNISDAELS, I. FARBOS, F. MONÉGER, and A. LARDON et al., 1997 Isolation of early genes expressed in reproductive organs of the dioecious white campion (Silene latifolia) by subtraction cloning using an asexual mutant. Plant J. 12:805-817.[Medline]
BOEHNKE, M., K. LANGE, and D. R. COX, 1991 Statistical methods for multipoint radiation hybrid mapping. Am. J. Hum. Genet. 49:1174-1188.[Medline]
CHARLESWORTH, D., 2002 Plant sex determination and sex chromosomes. Heredity 88:94-101.[Medline]
CHARLESWORTH, D., and D. S. GUTTMAN, 1999 The evolution of dioecy and plant sex chromosome systems, pp. 2550 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.
CIUPERCESCU, D. D., J. VEUSKENS, A. MOURAS, D. YE, and M. BRIQUET et al., 1990 Karyotyping Melandrium album, a dioecious plant with heteromorphic sex chromosomes. Genome 33:556-562.
DELBRIDGE, M. L. and J. A. M. GRAVES, 1999 Mammalian Y chromosome evolution and the male-specific functions of Y chromosome-borne genes. Rev. Reprod. 4:101-109.[Abstract]
DELICHÈRE, C., J. VEUSKENS, M. HERNOULD, N. BARBACAR, and A. MOURAS et al., 1999 SlY1, the first active gene cloned from a plant Y chromosome, encodes a WD-repeat protein. EMBO J. 18:4169-4179.[Medline]
DESFEUX, C., S. MAURICE, J. P. HENRY, B. LEJEUNE, and P. H. GOUYON, 1996 Evolution of reproductive systems in the genus Silene.. Proc. R. Soc. Lond. Ser. B 263:409-414.[Medline]
DONNISON, I. S., and S. GRANT, 1999 Male sex-specific DNA in Silene latifolia and other dioecious plant species, pp. 7387 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.
DONNISON, I. S., J. SIROKY, B. VYSKOT, H. SAEDLER, and S. R. GRANT, 1996 Isolation of Y chromosome-specific sequences from Silene latifolia and mapping male sex-determining genes using representational difference analysis. Genetics 144:1893-1901.[Abstract]
FARBOS, I., J. VEUSKENS, B. VYSKOT, M. OLIVEIRA, and S. HINNISDAELS et al., 1999 Sexual dimorphism in white campion: deletion on the Y chromosome results in a floral asexual phenotype. Genetics 151:1187-1196.
FILATOV, D. A., F. MONÉGER, I. NEGRUTIU, and D. CHARLESWORTH, 2000 Low variability in a Y-linked plant gene and its implications for Y-chromosome evolution. Nature 404:388-390.[Medline]
FILATOV, D. A., V. LAPORTE, C. VITTE, and D. CHARLESWORTH, 2001 DNA diversity in sex-linked and autosomal genes of the plant species Silene latifolia and Silene dioica.. Mol. Biol. Evol. 18:1442-1454.
GRABOWSKA-JOACHIMIAK, A. and A. JOACHIMIAK, 2002 C-banded karyotypes of two Silene species with heteromorphic sex chromosomes. Genome 45:243-252.[Medline]
GRANT, S., A. HOUBEN, B. VYSKOT, J. SIROKY, and W. PAN et al., 1994a Genetics of sex determination in flowering plants. Dev. Genet. 15:214-230.
GRANT, S., B. HUNKIRCHEN, and H. SAEDLER, 1994b Developmental differences between male and female flowers in the dioecious plant Silene latifolia.. Plant J. 6:471-480.
GRAVES, J. A. M., M. J. WAKEFIELD, and R. TODER, 1998 The origin and evolution of the pseudoautosomal regions of the human sex chromosomes. Hum. Mol. Genet. 7:1991-1996.
GUTTMAN, D. S. and D. CHARLESWORTH, 1998 An X-linked gene with a degenerate Y-linked homologue in a dioecious plant. Nature 393:263-266.[Medline]
HOWDEN, R., S. K. PARK, J. M. MOORE, J. ORME, and U. GROSSNIKLAUS et al., 1998 Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis. Genetics 149:621-631.
KIMURA, T., S. TAKEDA, T. ASAHI, and K. NAKAMURA, 1990 Primary structure of a precursor for the
-subunit of sweet potato mitochondrial F1-ATPase deduced from full length cDNA. J. Biol. Chem. 265:6079-6085.
LAGERCRANTZ, U. and T. AXELSSON, 2000 Rapid evolution of the CONSTANS LIKE genes in plants. Mol. Biol. Evol. 17:1499-1507.
LAHN, B. T. and D. C. PAGE, 1997 Functional coherence of the human Y chromosome. Science 278:675-680.
LAHN, B. T. and D. C. PAGE, 1999a Four evolutionary strata on the human X chromosome. Science 286:964-967.
LAHN, B. T. and D. C. PAGE, 1999b Retroposition of autosomal mRNA yielded testis-specific gene family on human Y chromosome. Nat. Genet. 21:429-433.[Medline]
LAHN, B. T., N. M. PEARSON, and K. JEGALIAN, 2001 The human Y chromosome, in the light of evolution. Nat. Rev. Genet. 2:207-216.[Medline]
LARDON, A., A. AGHMIR, S. GEORGIEV, F. MONÉGER and I. NEGRUTIU, 1999a The Y chromosome of white campion: sexual dimorphism and beyond, pp. 89100 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.
LARDON, A., S. GEORGIEV, A. AGHMIR, G. L. MERRER, and I. NEGRUTIU, 1999b Sexual dimorphism in white campion: complex control of carpel number is revealed by Y chromosome deletions. Genetics 151:1173-1185.
LEBEL-HARDENACK, S., D. YE, H. KOUTNIKOVA, H. SAEDLER, and S. R. GRANT, 1997 Conserved expression of a TASSELSEED2 homolog in the tapetum of the dioecious Silene latifolia and Arabidopsis thaliana.. Plant J. 12:515-526.[Medline]
LEBEL-HARDENACK, S., E. HAUSER, T. F. LAW, J. SCHMID, and S. R. GRANT, 2002 Mapping of sex determination loci on the white campion (Silene latifolia) Y chromosome using amplified fragment length polymorphism. Genetics 160:717-725.
LI, W. H., 1997 Principles of Molecular Evolution. Sinauer, Sunderland, MA.
LIANG, P. and A. B. PARDEE, 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257:967-971.
LIU, Y. G. and R. F. WHITTIER, 1995 Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674-681.[Medline]
LIU, Y. G., N. MITSUKAWA, T. OOSUMI, and R. F. WHITTIER, 1995 Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8:457-463.[Medline]
MAEO, K., A. MORIKAMI, M. SOGA, S. IMANISHI, and K. NAKAMURA, 1999 Expression patterns of two genes for the delta-subunit of mitochondrial F1-ATP synthase from sweet potato in transgenic tobacco plants and cells. Plant Cell Physiol. 40:866-873.
MARTIN, K. J. and A. B. PARDEE, 1999 Principles of differential display. Methods Enzymol. 303:234-258.[Medline]
MATSUNAGA, S. and S. KAWANO, 2001 Sex determination by sex chromosomes in dioecious plants. Plant Biol. 3:481-488.
MATSUNAGA, S., S. KAWANO, H. TAKANO, H. UCHIDA, and A. SAKAI et al., 1996 Isolation and developmental expression of male reproductive organ-specific genes in a dioecious campion, Melandrium album (Silene latifolia). Plant J. 10:679-689.[Medline]
MATSUNAGA, S., S. KAWANO, and T. KUROIWA, 1997 MROS1, a male stamen-specific gene in the dioecious campion Silene latifolia is expressed in mature pollen. Plant Cell Physiol. 38:499-502.
MONÉGER, F., N. BARBACAR, and I. NEGRUTIU, 2000 Dioecious Silene at the X-road: the reasons Y. Sex. Plant Reprod. 12:245-249.
MORIKAMI, A., K. AISO, T. ASAHI, and K. NAKAMURA, 1992 The
'-subunit of higher plant six-subunit mitochondrial F1-ATPase is homologous to the
-subunit of animal mitochondrial F1-ATPase. J. Biol. Chem. 267:72-76.
NAKAO, S., S. MATSUNAGA, A. SAKAI, T. KUROIWA, and S. KAWANO, 2002 RAPD isolation of a Y chromosome specific ORF in a dioecious plant, Silene latifolia.. Genome 45:413-420.[Medline]
NEGRUTIU, I., B. VYSKOT, N. BARBACAR, S. GEORGIEV, and F. MONÉGER, 2001 Dioecious plants. A key to the early events of sex chromosome evolution. Plant Physiol. 127:1418-1424.
PRESCOTT, M., N. C. BUSH, P. NAGLEY, and R. J. DEVENISH, 1994 Properties of yeast cells depleted of the OSCP subunit of mitochondrial ATP synthase by regulated expression of the ATP5 gene. Biochem. Mol. Biol. Int. 34:789-799.[Medline]
ROBERTSON, S. E., Y. LI, C. P. SCUTT, M. E. WILLIS, and P. M. GILMARTIN, 1997 Spatial expression dynamics of Men-9 delineate the third floral whorl in male and female flowers of dioecious Silene latifolia.. Plant J. 12:155-168.[Medline]
ROZAS, J. and R. ROZAS, 1999 DnaSP version 3.0: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SAXENA, R., L. G. BROWN, T. HAWKINS, R. K. ALAGAPPAN, and H. SKALETSKY et al., 1996 The DAZ gene cluster on the human Y chromosome arose from an autosomal gene that was transposed, repeatedly amplified and pruned. Nat. Genet. 14:292-299.[Medline]
SCUTT, C. P., Y. LI, S. E. ROBERTSON, M. E. WILLIS, and P. M. GILMARTIN, 1997 Sex determination in dioecious Silene latifolia: effects of the Y chromosome and the parasitic smut fungus (Ustilago violacea) on gene expression during flower development. Plant Physiol. 114:969-979.[Abstract]
SCUTT, C. P., T. JENKINS, M. FURUYA, and P. M. GILMARTIN, 2002 Male specific genes from dioecious white campion identified by fluorescent differential display. Plant Cell Physiol. 43:563-572.
SIROKY, J., M. R. CASTIGLIONE, and B. VYSKOT, 1998 DNA methylation patterns of Melandrium album chromosomes. Chromosome Res. 6:441-446.[Medline]
SIROKY, J., J. HODURKOVA, I. NEGRUTIU, and B. VYSKOT, 1999 Functional and structural chromosome analyses in autotetraploid Silene latifolia. Ann. Bot. 84:633-638.
SIROKY, J., M. LYSAK, J. DOLEZEL, E. KEJNOVSKY, and B. VYSKOT, 2001 Heterogeneity of rDNA distribution and genome size in Silene spp. Chromosome Res. 9:387-393.[Medline]
TERAUCHI, R. and G. KAHL, 2000 Rapid isolation of promoter sequences by TAIL-PCR: the 5'-flanking regions of Pal and Pgi genes from yams (Dioscorea). Mol. Gen. Genet. 263:554-560.[Medline]
UH, M., D. JONES, and D. M. MUELLER, 1990 The gene coding for the yeast oligomycin sensitivity-conferring protein. J. Biol. Chem. 265:19047-19052.
VYSKOT, B., 1999 The role of DNA methylation in plant reproductive development, pp. 101120 in Sex Determination in Plants, edited by C. C. AINSWORTH. BIOS Scientific Publishers, Oxford.
VYSKOT, B., A. ARAYA, J. VEUSKENS, I. NEGRUTIU, and A. MOURAS, 1993 DNA methylation of sex chromosomes in a dioecious plant, Melandrium album.. Mol. Gen. Genet. 239:219-224.[Medline]
WALKER, J. E. and I. R. COLLINSON, 1994 The role of the stalk in the coupling mechanism of F1F0-ATPases. FEBS Lett. 346:39-43.[Medline]
WESTERGAARD, M., 1958 The mechanism of sex determination in dioecious plants. Adv. Genet. 9:217-281.[Medline]
WILKENS, S., A. RODGERS, I. OGILVIE, and R. A. CAPALDI, 1997 Structure and arrangement of the
subunit in the E. coli ATP synthase (ECF1F0). Biophys. Chem. 68:95-102.[Medline]
YE, D., M. OLIVEIRA, J. VEUSKENS, Y. WU, and P. INSTALLE et al., 1991 Sex determination in the dioecious Melandrium. The X/Y chromosome system allows complementary cloning strategies. Plant Sci. 80:93-106.
This article has been cited by other articles:
![]() |
Y. Kazama, M. T. Fujiwara, A. Koizumi, K. Nishihara, R. Nishiyama, E. Kifune, T. Abe, and S. Kawano A SUPERMAN-like Gene is Exclusively Expressed in Female Flowers of the Dioecious Plant Silene latifolia Plant Cell Physiol., June 1, 2009; 50(6): 1127 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mrackova, M. Nicolas, R. Hobza, I. Negrutiu, F. Moneger, A. Widmer, B. Vyskot, and B. Janousek Independent Origin of Sex Chromosomes in Two Species of the Genus Silene Genetics, June 1, 2008; 179(2): 1129 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bergero, D. Charlesworth, D. A. Filatov, and R. C. Moore Defining Regions and Rearrangements of the Silene latifolia Y Chromosome Genetics, April 1, 2008; 178(4): 2045 - 2053. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Koizumi, Y. Amanai, K. Ishii, K. Nishihara, Y. Kazama, W. Uchida, and S. Kawano Floral Development of an Asexual and Female-Like Mutant Carrying Two Deletions in Gynoecium-Suppressing and Stamen-Promoting Functional Regions on the Y Chromosome of the Dioecious Plant Silene latifolia Plant Cell Physiol., October 1, 2007; 48(10): 1450 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zluvova, S. Georgiev, B. Janousek, D. Charlesworth, B. Vyskot, and I. Negrutiu Early Events in the Evolution of the Silene latifolia Y Chromosome: Male Specialization and Recombination Arrest Genetics, September 1, 2007; 177(1): 375 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Meagher Linking the Evolution of Gender Variation to Floral Development Ann. Bot., August 1, 2007; 100(2): 165 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bergero, A. Forrest, E. Kamau, and D. Charlesworth Evolutionary Strata on the X Chromosomes of the Dioecious Plant Silene latifolia: Evidence From New Sex-Linked Genes Genetics, April 1, 2007; 175(4): 1945 - 1954. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ming, J. Wang, P. H. Moore, and A. H. Paterson Sex chromosomes in flowering plants Am. J. Botany, February 1, 2007; 94(2): 141 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ironside and D. A. Filatov Extreme Population Structure and High Interspecific Divergence of the Silene Y Chromosome Genetics, October 1, 2005; 171(2): 705 - 713. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zluvova, B. Janousek, I. Negrutiu, and B. Vyskot Comparison of the X and Y Chromosome Organization in Silene latifolia Genetics, July 1, 2005; 170(3): 1431 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gorelick Theory for why dioecious plants have equal length sex chromosomes Am. J. Botany, June 1, 2005; 92(6): 979 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Filatov Evolutionary History of Silene latifolia Sex Chromosomes Revealed by Genetic Mapping of Four Genes Genetics, June 1, 2005; 170(2): 975 - 979. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Filatov Substitution Rates in a New Silene latifolia Sex-Linked Gene, SlssX/Y Mol. Biol. Evol., March 1, 2005; 22(3): 402 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanurdzic and J. A. Banks Sex-Determining Mechanisms in Land Plants PLANT CELL, June 1, 2004; 16(suppl_1): S61 - S71. [Full Text] [PDF] |
||||
![]() |
B. F. McAllister Sequence Differentiation Associated With an Inversion on the Neo-X Chromosome of Drosophila americana Genetics, November 1, 2003; 165(3): 1317 - 1328. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lengerova, R. C. Moore, S. R. Grant, and B. Vyskot The Sex Chromosomes of Silene latifolia Revisited and Revised Genetics, October 1, 2003; 165(2): 935 - 938. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Moore, R. C.
- Articles by Grant, S. R.
- Search for Related Content
- PUBMED
- Articles by Moore, R. C.
- Articles by Grant, S. R.













