- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kniazeva, M.
- Articles by Han, M.
- Search for Related Content
- PUBMED
- Articles by Kniazeva, M.
- Articles by Han, M.
Suppression of the ELO-2 FA Elongation Activity Results in Alterations of the Fatty Acid Composition and Multiple Physiological Defects, Including Abnormal Ultradian Rhythms, in Caenorhabditis elegans
Marina Kniazevaa, Matt Siebera, Scott McCauleya, Kang Zhangb, Jennifer L. Wattsc, and Min Hanaa Howard Hughes Medical Institute and Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado 80309,
b Eccles Institute of Human Genetics, Salt Lake City, Utah 84112
c Institute of Biological Chemistry, Washington State University, Pullman, Washington 99164
Corresponding author: Marina Kniazeva, University of Colorado, Boulder, CO 80309., marinak{at}colorado.edu (E-mail)
Communicating editor: P. ANDERSON
| ABSTRACT |
|---|
While the general steps of fatty acid (FA) biosynthesis are well understood, the individual enzymes involved in the elongation of long chain saturated and polyunsaturated FA (PUFA) are largely unknown. Recent research indicates that these enzymes might be of considerable physiological importance for human health. We use Caenorhabditis elegans to study FA elongation activities and associated abnormal phenotypes. In this article we report that the predicted C. elegans F11E6.5/ELO-2 is a functional enzyme with the FA elongation activity. It is responsible for the elongation of palmitic acid and is involved in PUFA biosynthesis. RNAi-mediated suppression of ELO-2 causes an accumulation of palmitate and an associated decrease in the PUFA fraction in triacylglycerides and phospholipid classes. This imbalance in the FA composition results in multiple phenotypic defects such as slow growth, small body size, reproductive defects, and changes in rhythmic behavior. ELO-2 cooperates with the previously reported ELO-1 in 20-carbon PUFA production, and at least one of the enzymes must function to provide normal growth and development in C. elegans. The presented data indicate that suppression of a single enzyme of the FA elongation machinery is enough to affect various organs and systems in worms. This effect resembles syndromic disorders in humans.
FATTY acids (FAs) are exceptionally versatile compounds. Most cellular FAs exist as components of various lipids and proteins, although a small quantity is present in a free form. In the form of triacylglycerides (TAG) FAs are involved in energy storage, and as components of phospholipids (PL) they constitute the principal structural material of cells.
FAs have numerous specialized functions, including protein activation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Changes in FA compositions accompany various human disorders including diabetes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Our interest in studying FA biosynthesis and homeostasis was induced by our previous genetic work on human macular dystrophy (MD; ![]()
![]()
![]()
![]()
Little is known about the genetic and physiological importance of the individual enzymes involved in FA biosynthesis. Several animal enzymes with the FA elongation activities have been biochemically characterized (![]()
![]()
![]()
![]()
Eight protein sequences homologous to the human ELOVL4 are in the C. elegans database. In this article, we report that one of them is a functional protein that we have designated ELO-2. ELO-2 utilizes C16:0 as a substrate in the first step of long chain FA elongation. Directly or indirectly, ELO-2 regulates 18-carbon PUFA elongation and, with condensing enzyme ELO-1 (![]()
| MATERIALS AND METHODS |
|---|
Worm strains:
Strains used in this study include Bristol N2, fat-2(wa17), and fat-3(wa22) (![]()
![]()
Vectors and constructs:
The elo-2::GFP reporter used in the expression pattern analysis was prepared as follows: A 3.794-kb genomic fragment containing 2.575 kb upstream of the first predicted codon and part of the coding sequence truncated at the 3' end (this cuts out the presumable ER-retention signal of the protein) was PCR amplified from an N2 worm with the following primers: F, 5'-SphI-AACGGTCCATATAAACTGGAACATTTTGC-3', and R, 5'-SmaI-TCGAACAAATAACTAGTGTACATAGGTCCTCC-3'. The fragment was cloned in frame with the green fluorescent protein (GFP) gene into the pPD95.77 vector (gift from A. Fire).
A total of 10 ng/µl of this plasmid DNA was injected into the gonad of N2 worms. Transgenic animals were selected and maintained by monitoring green fluorescence under a dissecting scope.
The elo-2 overexpression construct was made by cloning a genomic fragment, generated with F, 5'-SphI-AACGGTCCATATAAACTGGAACATTTTGC-3', and R, 5'-SmaI-TTCACAATGTTTATCTACTCCTGC-3' primers, into the pPD95.77 vector (no GFP fusion). The fragment contains 2.575 kb upstream of the first predicted ATG codon and predicted coding sequence, including the stop codon. A total of 10 ng/µl of the plasmid DNA was coinjected with the gut-specific, selective marker KQT1::GFP (M. KNIAZEVA, unpublished data) into the N2 worms.
The RNAi feeding vectors were based on pPD129.36 (gift of A. Fire). RNAi primers were as follows:
- F11E6.5: F, atggcagcagcacaaacaagtccag; R, actgatgtacatgagtcctccgatcga
- F56H11.4: F, atggctcagcatccgctcgttcaac; R, cgacaattcctttgttggcaatggt
- F56H11.3: F, atgtatttgaattatttcgcgacgg; R, tcaaagcaaatgtagagtgtagga
- D2024.3: F, atggcaaaatacgactacaatccga; R, cagacgaagagtggtgtgtccagtt
- F41H10.7: F, atgtcatcggacgatcgtggcgtga; R, cagtgcatgaaaataagtggtctct
- F41H10.8: F, atgccacagggagaagtctca; R, ccacggctgaagaactcgtgga
- C40H1.4: F, atggagcttgccgagttctgga; R, cgcaatatatcacgcctgggc
- Y53F4B.2: F, atgtcggccgaagtgtccgaacgatt; R, cagccaggcagatcgaatcgatg
RNAi experiments:
RNAi experiments were performed by feeding N2 worms the HT115 E. coli strain transformed with the RNAi vector or the control vector pPD129.36. The RNAi feeding conditions were as described in protocol 1 (optimal; ![]()
Evaluation of elo-2(RNAi) phenotypes:
elo-2(RNAi) animals were maintained on the RNAi plates at 20°. F2-F3 generations were used for comparative estimations of the growth rates and the number of eggs. Adult N2 and elo-2(RNAi) worms were left to lay eggs for 23 hr and then were removed from the plates. These progeny were then followed up until they started to lay eggs themselves. Young adults of each type were scored for the number of eggs in their uterus.
Rhythmic behavior analysis:
In each experiment, at least 10 adult hermaphrodites were scored for at least 10 posterior body wall muscle contraction (pBoc) cycles. All counts were carried out at room temperature under the dissecting scope. These data were presented as an average of intervals with standard deviations or as a relation of the intervals' frequencies to the length of the intervals (in seconds). We scored the F2-F3 generations of the supplemented and RNAi-fed worms.
Fatty acid supplements:
Palmitic and stearic acid sodium salts (Supelco, Bellefonte, PA) were dissolved in 1% NP40 at 80° and added to agar plates containing IPTG and ampicillin (![]()
Gas chromatography analysis:
A mixed population of well-fed worms were washed off plates with water, rinsed three or four times, and, after complete water aspiration, were frozen at -80°. Fatty acid methyl esters and lipid extraction were performed as described (![]()
Lipid separation:
At least 100 mg of worms were killed rapidly by immersion in liquid nitrogen, transferred to a screw-capped glass centrifuge tube with 5 ml of ice-cold chloroform/methanol/formic acid (10:10:1, by volume), vortexed for 2 min, and stored 4 hr to overnight at -20°. A total of 2.2 ml of H3PO4, 1 M KCl (![]()
| RESULTS |
|---|
A family of the FA elongation enzymes in C. elegans:
Eight predicted C. elegans protein sequences were identified by a BLAST search as members of the GNS1/SUR4 family of FA elongation enzymes. Interestingly, no significant homology was detected between the corresponding genes when a BLASTN search was performed using either genomic or cDNA sequences. This is especially striking because two pairs of the predicted genes, F56H11.3 and F56H11.4 as well as F41H10.7 and F41H10.8, have paired chromosomal locations, suggesting an ancestral duplication event. If there was a common phylogenic root, these genes no longer share significant structural similarity. This suggests that the conserved blocks seen on the protein level indicate functionally essential domains in the FA elongation enzymes.
We anticipated that the loss of an FA elongation activity might lead to the accumulation of its unused substrate. This could then be detected through GC analysis and provide information on the biochemical activity of the corresponding proteins. We performed RNAi-mediated suppression on each of the genes and evaluated the resulting FA composition and other phenotypes. No RNAi-associated phenotypes were detected for the F56H11.3, F41H10.8, D2024.3, Y53F4B.2, and C40H1.4 genes. The suppression of F56H11.4 resulted in an abnormal FA composition with no other apparent phenotypic changes. The suppression of the F11E6.5 and F41H10.7 genes caused significant alterations in FA composition and multiple growth defects. The F56H11.4 and F11E6.5 loss-of-function phenotypes are discussed in detail in this article.
It has been previously shown by expression in yeast that F56H11.4 (elo-1) encodes a condensing enzyme involved in the elongation of the n6 (and to some extent the n3) series C18 PUFA as well as in the elongation of palmitoleic acid (![]()
4 kb from F56H11.4. As mentioned earlier, F56H11.3 (RNAi) does not change the FA composition and no expressed sequence tags are reported for this gene, suggesting that it may not be actively transcribed.
The elo-1(gk48) worms have an abnormal FA composition that is identical to the above-mentioned F56H11.4 (RNAi) animals and to the elo-1(wa7) mutant, which lacks the final 50 C-terminal amino acids (![]()
Interestingly, despite significant alterations in FA composition, all elo-1 mutants display no obvious phenotypic changes, indicating a tolerance to the low C20 PUFA amounts.
In the rest of this article, we describe our results obtained for the F11E6.5 protein, designated ELO-2. ELO-2 shares a significant homology with all characterized condensing enzymes. It is 39% identical to the C. elegans long chain polyunsaturated fatty acid elongation enzyme ELO-1 (GenBank accession no.
AF244356; ![]()
![]()
![]()
|
RNAi-mediated suppression of ELO-2, a predicted C. elegans enzyme with FA elongation activity, results in significant changes in FA composition in living worms:
GC analysis of the total lipids revealed that the RNAi-mediated suppression of elo-2 resulted in alterations in FA composition. The major change was a sixfold increase in palmitic acid (C16:0) as compared to the wild-type N2 Bristol strain (Fig 2). Apparently, palmitate could not be properly metabolized in the absence of ELO-2 activity. The large C16:0 increase suggests that palmitate is likely to be a main substrate for ELO-2. This increase, however, is not accompanied by a proportional decrease in C18:0, a product of the C16:0 elongation. Several factors may contribute to the presence of stearic acid in elo-2(RNAi) worms. First, the bacterial food may be a sufficient source of stearate even in the absence of C16:0 to C18:0 elongation activity. Indeed, HT115 E. coli strain used to feed worms in RNAi experiments contains C18:0 in addition to C16:0, C17D, C14:0, C19D, C16:1 n7, and C18:1 n7 FA species. Second, it is possible that the ELO-2 suppression by RNAi is incomplete. Third, there could be a functional redundancy in this elongation process.
|
In addition to changes in the saturated FA fraction, two- and threefold decreases were observed in the C18:1 n9 and C20:2 n6 fractions, respectively. This implies that a loss of the ELO-2 function may also affect biosynthesis of mono- and polyunsaturated FAs.
GC and statistical analysis showed a similar increase in palmitate in both triacylglycerols (TAG) and phospholipids (PL) (Fig 3). This was accompanied by significant changes in the relative amounts of C16:1 n7, C18:1 n9, C18:2 n6, C20:4 n6, and C20:5 n3 FA species, indicating an imbalance in the FA composition. The data predict that the disruption of ELO-2 could result in multiple metabolic and physiological defects involving energy storage and membrane properties. As we discuss below, elo-2(RNAi) animals display various abnormalities.
|
Disruption of both ELO-2 and ELO-1 functions blocks the synthesis of 20-carbon PUFA and causes severe phenotypes:
To further address ELO-2's possible involvement in PUFA biosynthesis, we asked if a suppression elo-2 would further decrease the amounts of PUFA in the elo-1(gk48) strain. For this experiment elo-1(gk48) worms were grown on elo-2(RNAi) plates. The following GC analysis of the total lipids revealed that the 20-carbon PUFA fractions are nearly eliminated in elo-1(gk48);elo-2(RNAi) animals (Fig 4). While a redundancy of the ELO-1 and ELO-2 functions would explain the observed shortage of C20 PUFA in these double "mutants," in the absence of biochemical proofs, other possibilities may be considered. As it was shown in another system and is discussed later, large amounts of palmitate could influence lipogenesis (![]()
![]()
|
The double suppression of the ELO-1 and ELO-2 activities results in the very sick appearance of the affected worms. The worms in the first generation, F1, have small scrawny bodies and various structural abnormalities (Fig 4). A brood size of P0 elo-1(gk48);elo-2(RNAi) is reduced to 3040 worms. While early F1 animals lay eggs that hatch, the late F1 worms are sterile because of severe gonad defects. A small number of produced L1 of the second generation do not develop past this larval stage and eventually die. Therefore, the double phenotype drastically differs from both the elo-1(gk48), which looks wild type, and the elo-2(RNAi), which has mild phenotype (discussed in detail below). Interestingly, the double mutants also differ from fat-3(wa22), a slow-growing but viable and fertile mutant characterized by a lack of C20 PUFA (![]()
Taken together, the data suggest that the ELO-1 and ELO-2 combined function is essential, and at least one of the enzymes must be active to provide normal growth and development in C. elegans.
elo-2 is predominantly expressed in intestinal cells in C. elegans:
The ELO-2::GFP reporter driven by the putative elo-2 promoter (a sequence
3 kb upstream of the first ATG codon) was used to evaluate the tissue expression pattern of elo-2. The open reading frame of the construct encodes ELO-2 truncated at the C terminus and fused with GFP. While being detected in various tissues and parts of the body, including the ventral cord, pharyngeal muscles, uterus, and the tail, the reporter is most strongly expressed in intestinal cells (Fig 5). In the intestinal cells, GFP fluorescence could be detected from the late embryonic stage onward. In very old (30 days) and even dead worms the intestinal fluorescence stays bright, suggesting that the ELO-2::GFP protein is stable. The gut cells in C. elegans are responsible for digestion, energy storage, and the distribution of nutrients, all functions that are agreeable with active FA biosynthesis.
|
elo-2(RNAi) results in multiple phenotypic changes:
The elo-2(RNAi) worms develop 1.5 times slower as measured by the time required for a laid egg to transform into an egg-laying adult, although its life span is not affected. A grown adult hermaphrodite is
20% smaller than an adult N2. In addition, elo-2(RNAi) worms have a prominent pale coloring to their intestine, probably due to some different refractive property (Fig 6).
|
Although the RNAi-treated animals are vital and fertile, they have apparent reproductive defects, which result in a smaller number of progeny. A brood of one elo-2(RNAi) hermaphrodite consists of 30 ± 10 worms vs. 188 ± 10 in the wild type (animals were scored on the fourth day of plating synchronized L4; progeny of 10 animals of each type were counted; ± represents standard error of mean). There is no increase in the number of dead eggs or in the frequency of early embryonic lethality as compared to the wild type; however, there is a difference in the average number of eggs in the uterus of young adults: 3.2 in elo-2(RNAi) vs. 8.6 in the wild type (30 synchronized worms of each type were scored).
elo-2(RNAi)-treated worms change their rhythmic behavior:
To test if FA composition affects physiological rhythms, we examined the intervals of pBoc, components of the defecation cycle (![]()
![]()
|
To test the effect of ELO-2 overexpression, we injected worms with an elo-2 genomic fragment (3 kb of putative promoter and a coding region truncated after the stop codon) cloned into the pPD95.77 vector (gift of A. Fire). Since the elo-2 promoter is functional and strong in the ELO-2::GFP reporter mentioned above, we expected it to be efficient in the production of ELO-2. To trace the elo-2 expression, a gut-specific GFP reporter vector, ku142Ex[kqt-1::GFP], was coinjected along with ku141Ex[elo-2(+)]. Thus, the extrachromosomal array contained two genes coding for ELO-2 and GFP. The promoters of both genes are active in intestinal cells; therefore the presence of GFP indicates a presence of ELO-2 in the same cell. The worms injected with the GFP reporter alone were used as a control. When kuEx141[elo-2 (+)];kuEx142[kqt1::GFP] was introduced into the worms, we noticed that in 35 analyzed animals 21 had long and 14 had short pBoc intervals. The array was not integrated and we suspected that the inconsistency may result from mosaic distribution of the array. Since the most posterior gut cells are pacemaker cells for pBoc rhythms (![]()
The increased amount of palmitate, but not the decrease in PUFA, seems to be relevant to the observed acceleration of pBoc rhythms in elo-2(RNAi) worms:
We asked if the reduced relative amounts of PUFA observed in elo-2(RNAi) animals contributes to the pBoc phenotype. Changes in PUFA composition may cause differences in lipid-protein interactions in cell membranes and affect various physiological functions (![]()
![]()
![]()
Since the accumulation of palmitate is the most remarkable characteristic of the FA composition in elo-2(RNAi) animals, we tested if palmitate alone could be responsible for the pBoc interval shortening. In this experiment, wild-type worms were grown on plates supplemented with palmitate. The pBoc intervals were compared with those in wild-type control worms grown on plates with 1% NP40 without FA supplements. The results shown in Fig 7 indicate that supplementation with palmitate increases the pBoc frequency (t-test = 7.36452E-48, two-tailed distribution, unequal variance analysis). To test if the observed pBoc interval shortening is associated with a general increase in lipid saturation, we performed a similar experiment using stearate (C18:0) as a supplement and did not detect significant changes as compared to the controls (Fig 7). Therefore, the increased amount of palmitate, but not the decrease in PUFA, seems to be relevant to the observed acceleration of pBoc rhythms in elo-2(RNAi) worms.
|
Long chain saturated FAs C20:0 and C22:0 are unlikely to be involved in the elo-2(RNAi) phenotype:
We considered the possibility that ELO-2 may also be engaged in the elongation of other saturated FAs, such as C20:0 and C22:0, whose amounts are normally low and therefore difficult to detect in total FAs through GC. Very long chain FAs are important components of sphingolipids and, through sphingolipid signaling, may contribute to the pBoc regulation, in particular. We tested the hypothesis that a possible decrease in C20:0 and C22:0 in elo-2(RNAi) may have caused the observed acceleration of pBoc intervals. To do this, we fed elo-2(RNAi) animals with each of these FAs and then counted pBoc intervals and evaluated other aspects of the phenotype. In these experiments we did not detect any differences between elo-2(RNAi) and elo-2(RNAi) worms fed with arachidic and behenic FAs in terms of pBoc rhythms, number of progeny, or growth rate. We also did not see any changes in the phenotypes of N2 worms supplemented with these same FAs. Therefore it is unlikely that the amounts of C20:0 or C22:0 mediate the elo-2(RNAi) phenotype.
| DISCUSSION |
|---|
In at least five elongation and nine desaturation reactions, C. elegans is able to synthesize straight saturated, and mono- and polyunsaturated FAs (Fig 8). In contrast to the well-characterized FA desaturation system (![]()
![]()
![]()
![]()
![]()
|
Being interested in the analysis of the physiological changes that could arise from mutations in FA elongation genes, we performed RNAi-mediated suppression of eight predicted C. elegans proteins recognized as members of the GNS1/SUR4 family of the long chain fatty acid elongation enzymes. This experiment resulted in the identification of two functional enzymes, F11E6.5 and F41H10.7, whose loss of function leads to prominent phenotypic changes. In this article we report the biochemical and physiological characteristics of the C. elegans F11E6.5 protein, designated ELO-2, as deduced from the genetic analysis of live worms. The biochemical conclusions reported here are based on the GC data obtained on a whole animal.
RNAi-mediated suppression of elo-2 results in the significant accumulation of palmitate, suggesting that C16:0 could be a major substrate for ELO-2. The accumulation of palmitate causes an imbalance in total FA composition that can be critical for many cellular functions. Indeed, portions of the palmitate fraction in PL and TAG lipid classes rose from 4 to 22% and from 12 to 51%, respectively, at the expense of C20 PUFA. These changes in the FA composition may affect the energy storage function as well as the membrane properties and associated signal transduction mechanisms. This would explain why ELO-2 suppression has multiple phenotypic impacts involving growth, reproduction, and rhythmic behavior.
While future experiments are needed to isolate the particular molecules responsible for the phenotypic pleiotropy in elo-2(RNAi), there are indications that C16:0 itself plays an important role. Our supplementation experiments have shown that the addition of palmitate to the food source can change physiological rhythms, as exemplified by the shortening pBoc intervals, and that this effect is not attributed to an increase in lipid saturation or a relative decrease in PUFA amounts. It seems feasible that the increase in palmitate could be linked to the various associated phenotypic changes through the sphingolipid pathway. This is a testable hypothesis and we will address the problem through future biochemical studies.
In addition to the increase in palmitate, a statistically significant decrease in the C18:1 n9, a product of stearoyl-CoA desaturase activity, was observed in elo-2(RNAi) (Fig 2). We hypothesize that these changes are also related to the accumulation of palmitic acid. It has been recently shown in Drosophila that palmitate is indirectly involved in the regulation of lipogenesis through the sterol regulatory element binding protein (SREBP) pathway (![]()
![]()
ELO-1 and ELO-2 function in concordance, providing worms with the necessary amounts of PUFA. The double suppressed elo-1(gk48);elo-2(RNAi) animals are unable to synthesize C20 PUFA and are barely viable. Taken separately, elo-2(RNAi) and elo-1(gk48) phenotypes are noticeably different. Thus, despite possibly overlapping biochemical functions, ELO-1 and ELO-2 may have different impacts on physiological integrity in C. elegans.
In conclusion, we have shown that the predicted C. elegans protein, designated ELO-2, is an active enzyme involved in FA elongation. ELO-2 functions together with ELO-1 in PUFA biosynthesis. The activity of at least one of these enzymes is necessary for C20 PUFA production. A loss of ELO-2 function results in a significant accumulation of palmitate that directly or indirectly causes multiple phenotypic defects in growth, reproduction, and physiological rhythms. More biochemical studies are necessary to explain the observed phenotypes and to isolate the particular molecules that are involved. elo-2(RNAi) animals provide a useful tool for studying the genetic and physiological links between FA biosynthesis and signal transduction, which are essential for understanding human metabolic and rhythmic disorders.
| ACKNOWLEDGMENTS |
|---|
We thank Bob Barkley for invaluable support with GC and the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is funded by the Canadian Institute for Health Research, Genome Canada, and Genome BC, for the elo-1(gk48) allele. We also thank A. Fire for vectors and members of the Han Laboratory for discussions. This project is supported by Howard Hughes Medical Institute of which M.K. is a specialist and M.H. is an associate investigator; J.L.W. is funded by National Institutes of Health grant R01 GM-62521.
Manuscript received July 18, 2002; Accepted for publication October 23, 2002.
| LITERATURE CITED |
|---|
AGATHA, G., R. HAFER, and F. ZINTL, 2001 Fatty acid composition of lymphocyte membrane phospholipids in children with acute leukemia. Cancer Lett. 173:139-144.[Medline]
BEAUDOIN, F., L. V. MICHAELSON, S. J. HEY, M. J. LEWIS, and P. R. SHEWRY et al., 2000 Heterologous reconstitution in yeast of the polyunsaturated fatty acid biosynthetic pathway. Proc. Natl. Acad. Sci. USA 97:6421-6426.
BHATHENA, S. J., 2000 Relationship between fatty acids and the endocrine system. Biofactors 13:35-39.[Medline]
CARRICABURU, V. and B. FOURNIER, 2001 Phosphoinositide fatty acids regulate phosphatidylinositol 5-kinase, phospholipase C and protein kinase C activities. Eur. J. Biochem. 268:1238-1249.[Medline]
CHAWLA, A., J. J. REPA, R. M. EVANS, and D. J. MANGELSDORF, 2001 Nuclear receptors and lipid physiology: opening the X-files. Science 294:1866-1870.
CHEN, C. A. and D. R. MANNING, 2001 Regulation of G proteins by covalent modification. Oncogene 20:1643-1652.[Medline]
CHINETTI, G., J. C. FRUCHART, and B. STAELS, 2001 Peroxisome proliferator-activated receptors (PPARs): nuclear receptors with functions in the vascular wall. Z. Kardiol. 90:125-132.
DAL SANTO, P., M. A. LOGAN, A. D. CHISHOLM, and E. M. JORGENSEN, 1999 The inositol trisphosphate receptor regulates a 50-second behavioral rhythm in C. elegans. Cell 98:757-767.[Medline]
DOBROSOTSKAYA, I. Y., A. C. SEEGMILLER, M. S. BROWN, J. L. GOLDSTEIN, and R. B. RAWSON, 2002 Regulation of SREBP processing and membrane lipid production by phospholipids in Drosophila. Science 296:879-883.
DUCHEN, K. and B. BJORKSTEN, 2001 Polyunsaturated n-3 fatty acids and the development of atopic disease. Lipids 36:1033-1042.[Medline]
FREEMAN, M. P., 2000 Omega-3 fatty acids in psychiatry: a review. Ann. Clin. Psychiatry 12:159-165.[Medline]
FUNK, C. D., 2001 Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294:1871-1875.
HAJRA, A. K., 1974 On extraction of acyl and alkyl dihydroxyacetone phosphate from incubation mixtures. Lipids 9:502-505.[Medline]
HANNUN, Y. A., C. LUBERTO, and K. M. ARGRAVES, 2001 Enzymes of sphingolipid metabolism: from modular to integrative signaling. Biochemistry 40:4893-4903.[Medline]
HIDA, A., Y. UCHIJIMA, and Y. SEYAMA, 1998 Sexual differences in branched chain amino acid metabolism into fatty acids and cholesterol in Harderian gland of golden hamster. J. Biochem. 124:648-653.
HLA, T., M. J. LEE, N. ANCELLIN, J. H. PAIK, and M. J. KLUK, 2001 Lysophospholipidsreceptor revelations. Science 294:1875-1878.
HORROBIN, D. F., 1995 Abnormal membrane concentrations of 20 and 22-carbon essential fatty acids: A common link between risk factors and coronary and peripheral vascular disease? Prostaglandins Leukot. Essent. Fatty Acids 53:385-396.[Medline]
INAGAKI, K., T. AKI, Y. FUKUDA, S. KAWAMOTO, and S. SHIGETA et al., 2002 Identification and expression of a rat fatty acid elongase involved in the biosynthesis of C18 fatty acids. Biosci. Biotechnol. Biochem. 66:613-621.[Medline]
JANSEN, G. A., E. M. HOGENHOUT, S. FERDINANDUSSE, H. R. WATERHAM, and R. OFMAN et al., 2000 Human phytanoyl-CoA hydroxylase: resolution of the gene structure and the molecular basis of Refsum's disease. Hum. Mol. Genet. 9:1195-1200.
JANSEN, G. A., R. OFMAN, S. FERDINANDUSSE, L. IJLST, and A. O. MUIJSERS et al., 1997 Refsum disease is caused by mutations in the phytanoyl-CoA hydroxylase gene. Nat. Genet. 17:190-193.[Medline]
JUMP, D. B., 2002 Dietary polyunsaturated fatty acids and regulation of gene transcription. Curr. Opin. Lipidol. 13:155-164.[Medline]
KAMATH, R. S., M. MARTINEZ-CAMPOS, P. ZIPPERLEN, A. G. FRASER and J. AHRINGER, 2001 Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol. 2 (1): 0002.10002.10.
KNIAZEVA, M., M. F. CHIANG, B. MORGAN, A. L. ANDUZE, and D. J. ZACK et al., 1999a A new locus for autosomal dominant stargardt-like disease maps to chromosome 4. Am. J. Hum. Genet. 64:1394-1399.[Medline]
KNIAZEVA, M., E. I. TRABOULSI, Z. YU, S. T. STEFKO, and M. B. GORIN et al., 2000 A new locus for dominant drusen and macular degeneration maps to chromosome 6q14. Am. J. Ophthalmol. 130:197-202.[Medline]
KNIAZEVA, M. F., M. F. CHIANG, G. R. CUTTING, D. J. ZACK, and M. HAN et al., 1999b Clinical and genetic studies of an autosomal dominant cone-rod dystrophy with features of Stargardt disease. Ophthalmic Genet. 20:71-81.[Medline]
KOMOROSKI, R. A., J. M. PEARCE, W. S. GRIFFIN, R. E. MRAK, and M. OMORI et al., 2001 Phospholipid abnormalities in postmortem schizophrenic brains detected by 31P nuclear magnetic resonance spectroscopy: a preliminary study. Psychiatry Res. 106:171-180.[Medline]
LEONARD, A. E., E. G. BOBIK, J. DORADO, P. E. KROEGER, and L. T. CHUANG et al., 2000 Cloning of a human cDNA encoding a novel enzyme involved in the elongation of long-chain polyunsaturated fatty acids. Biochem. J. 350(Pt. 3):765-770.[Medline]
LIU, D. W. and J. H. THOMAS, 1994 Regulation of a periodic motor program in C. elegans. J. Neurosci. 14:1953-1962.[Abstract]
LOGUE, J. A., A. L. DE VRIES, E. FODOR, and A. R. COSSINS, 2000 Lipid compositional correlates of temperature-adaptive interspecific differences in membrane physical structure. J. Exp. Biol. 203(Pt. 14):2105-2115.[Abstract]
MADANI, S., A. HICHAMI, A. LEGRAND, J. BELLEVILLE, and N. A. KHAN, 2001 Implication of acyl chain of diacylglycerols in activation of different isoforms of protein kinase C. FASEB J. 15:2595-2601.
MIQUEL, M. and J. BROWSE, 1992 Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. Biochemical and genetic characterization of a plant oleoyl-phosphatidylcholine desaturase. J. Biol. Chem. 267:1502-1509.
MOON, Y. A., N. A. SHAH, S. MOHAPATRA, J. A. WARRINGTON, and J. D. HORTON, 2001 Identification of a mammalian long chain fatty acyl elongase regulated by sterol regulatory element-binding proteins. J. Biol. Chem. 276:45358-45366.
NAPIER, J. A. and L. V. MICHAELSON, 2001 Genomic and functional characterization of polyunsaturated fatty acid biosynthesis in Caenorhabditis elegans. Lipids 36:761-766.[Medline]
PEET, M., B. MURPHY, J. SHAY, and D. HORROBIN, 1998 Depletion of omega-3 fatty acid levels in red blood cell membranes of depressive patients. Biol. Psychiatry 43:315-319.[Medline]
PEYOU-NDI, M. M., J. L. WATTS, and J. BROWSE, 2000 Identification and characterization of an animal delta(12) fatty acid desaturase gene by heterologous expression in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 376:399-408.[Medline]
SEEGMILLER, A. C., I. DOBROSOTSKAYA, J. L. GOLDSTEIN, Y. K. HO, and M. S. BROWN et al., 2002 The SREBP pathway in Drosophila: regulation by palmitate, not sterols. Dev. Cell 2:229-238.[Medline]
WATTS, J. L. and J. BROWSE, 1999 Isolation and characterization of a delta 5-fatty acid desaturase from Caenorhabditis elegans. Arch. Biochem. Biophys. 362:175-182.[Medline]
WATTS, J. L. and J. BROWSE, 2002 Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 99:5854-5859.
ZHANG, K., M. KNIAZEVA, M. HAN, W. LI, and Z. YU et al., 2001 A 5-bp deletion in ELOVL4 is associated with two related forms of autosomal dominant macular dystrophy. Nat. Genet. 27:89-93.[Medline]
This article has been cited by other articles:
![]() |
M. Horikawa, T. Nomura, T. Hashimoto, and K. Sakamoto Elongation and Desaturation of Fatty Acids are Critical in Growth, Lipid Metabolism and Ontogeny of Caenorhabditis elegans J. Biochem., August 1, 2008; 144(2): 149 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Entchev, D. Schwudke, V. Zagoriy, V. Matyash, A. Bogdanova, B. Habermann, L. Zhu, A. Shevchenko, and T. V. Kurzchalia LET-767 Is Required for the Production of Branched Chain and Long Chain Fatty Acids in Caenorhabditis elegans J. Biol. Chem., June 20, 2008; 283(25): 17550 - 17560. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Branicky and S. Hekimi Specification of muscle neurotransmitter sensitivity by a Paired-like homeodomain protein in Caenorhabditis elegans Development, November 15, 2005; 132(22): 4999 - 5009. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Meyer, H. Kirsch, F. Domergue, A. Abbadi, P. Sperling, J. Bauer, P. Cirpus, T. K. Zank, H. Moreau, T. J. Roscoe, et al. Novel fatty acid elongases and their use for the reconstitution of docosahexaenoic acid biosynthesis J. Lipid Res., October 1, 2004; 45(10): 1899 - 1909. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kniazeva, M.
- Articles by Han, M.
- Search for Related Content
- PUBMED
- Articles by Kniazeva, M.
- Articles by Han, M.











