Genetics, Vol. 162, 579-589, October 2002, Copyright © 2002

Identification of RTG2 as a Modifier Gene for CTG·CAG Repeat Instability in Saccharomyces cerevisiae

Saumitri Bhattacharyyaa, Michael L. Rolfsmeier1,a, Michael J. Dixona,b, Kara Wagonera, and Robert S. Lahuea,b
a Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805
b Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805

Corresponding author: Robert S. Lahue, University of Nebraska Medical Center, Box 986805, Omaha, NE 68198-6805., rlahue{at}unmc.edu (E-mail)

Communicating editor: N. ARNHEIM


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Trinucleotide repeats (TNRs) undergo frequent mutations in families affected by TNR diseases and in model organisms. Much of the instability is conferred in cis by the sequence and length of the triplet tract. Trans-acting factors also modulate TNR instability risk, on the basis of such evidence as parent-of-origin effects. To help identify trans-acting modifiers, a screen was performed to find yeast mutants with altered CTG·CAG repeat mutation frequencies. The RTG2 gene was identified as one such modifier. In rtg2 mutants, expansions of CTG·CAG repeats show a modest increase in rate, depending on the starting tract length. Surprisingly, contractions were suppressed in an rtg2 background. This creates a situation in a model system where expansions outnumber contractions, as in humans. The rtg2 phenotype was apparently specific for CTG·CAG repeat instability, since no changes in mutation rate were observed for dinucleotide repeats or at the CAN1 reporter gene. This feature sets rtg2 mutants apart from most other mutants that affect genetic stability both for TNRs and at other DNA sequences. It was also found that RTG2 acts independently of its normal partners RTG1 and RTG3, suggesting a novel function of RTG2 that helps modify CTG·CAG repeat mutation risk.


THE genetic behavior of trinucleotide repeats (TNRs) is unusual. There is a non-Mendelian inheritance pattern of disease-causing TNR expansions in families afflicted with fragile X syndrome, Huntington's disease (HD), or other syndromes (RICHARDS and SUTHERLAND 1994 Down; PAULSON and FISCHBECK 1996 Down; CUMMINGS and ZOGHBI 2000 Down). Not only do the expanded alleles enhance the clinical symptoms, but there is also an increased expansion risk at each generation. Although each disease has its own genetic characteristics, one common theme is that tract length is a very important indicator of the tendency toward mutation. Tracts at or above a crucial threshold length of ~35 repeats (PAULSON and FISCHBECK 1996 Down) are much more prone to expansion than shorter tracts. Because thresholds designate a sharp boundary between stable and unstable alleles, they are distinct from simple length dependence where the likelihood of mutation increases with tract size. Length dependence occurs for TNRs above the threshold, but is also true for elements that do not have thresholds, such as mono- and dinucleotide sequences in yeast (TRAN et al. 1997 Down; WIERDL et al. 1997 Down). A threshold effect is therefore specific to TNRs, although its molecular nature is not yet known. Another interesting feature of TNR diseases is that human alleles at or above the threshold level exhibit a 3- to 175-fold bias toward expansions rather than contractions, depending on the disease gene and other factors (MCMURRAY 1995 Down). The reasons for the disparity between expansions and contractions are also unknown. A third characteristic of TNR diseases is that unstable triplet repeats have been reported only for the sequences CNG (where N is any nucleotide) or, in the sole case of Friedreich's ataxia, for the sequence GAA (CAMPUZANO et al. 1996 Down). The sequence specificity arises from the tendency of these sequences to adopt unusually strong secondary structures, such as hairpins or triplexes (GACY et al. 1995 Down, GACY et al. 1997 Down; SAKAMOTO et al. 1999 Down). These structures are thought to cause aberrant DNA synthesis during replication, gene conversion, and repair, leading to expansions and contractions. Thus the length and sequence of the TNR are powerful cis-elements in determining the likelihood of unstable transmissions.

In addition to the strong dependence on cis-elements like tract length and sequence, there is also evidence that trans-acting genetic modifiers affect TNR instability. For example, the same allele can show different instability, depending on whether it was inherited paternally or maternally. Generally speaking, the smaller expansions associated with translated CAG repeats are more often transmitted from the father, and very large expansions and contractions associated with untranslated CGG or CTG repeats are usually maternal in origin (see JIN and WARREN 2000 Down; KOVTUN et al. 2000 Down; USDIN and GRABCZYK 2000 Down; and references therein). Although not all transgenic mice with long TNR alleles show instability, some mouse lines show parental influence on intergenerational instability (MANGIARINI et al. 1997 Down; MONCKTON et al. 1997 Down; LA SPADA et al. 1998 Down; SATO et al. 1999 Down; SHELBOURNE et al. 1999 Down; WHEELER et al. 1999 Down; KOVTUN et al. 2000 Down; SEZNEC et al. 2000 Down). In addition to parent-of-origin effects, there is additional evidence that genetic polymorphisms outside the TNR-containing gene may also play a role in human TNR instability. For example, sperm analysis from men with identical 35 CAG repeat alleles showed a significant difference in instability between the general population and sporadic HD families (CHONG et al. 1997 Down). Another study on germline mutation spectra at HD suggested that genetic background or other factors lead to variations in instability among individuals with similar allele lengths (LEEFLANG et al. 1999 Down). Taken together, these results indicate that genetic modifiers can act in trans to influence TNR instability.

Model systems such as bacteria, yeast, and transgenic mice have been examined for factors that influence TNR instability. These studies utilized candidate gene approaches, focusing on factors that influence DNA metabolism. Examples of candidate genes or pathways that have been characterized include the flap processing activity encoded by the yeast RAD27 (FREUDENREICH et al. 1998 Down; SCHWEITZER and LIVINGSTON 1998 Down; SPIRO et al. 1999 Down; WHITE et al. 1999 Down), mismatch repair (JAWORSKI et al. 1995 Down; SCHWEITZER and LIVINGSTON 1997 Down; MANLEY et al. 1999 Down; PARNIEWSKI et al. 2000 Down; SCHMIDT et al. 2000 Down; KOVTUN and MCMURRAY 2001 Down), and recombinational repair (SARKAR et al. 1998 Down; RICHARD et al. 2000 Down). The candidate gene approach is useful because the role(s) of each gene or pathway can be evaluated in detail. One drawback is that many of the candidate genes examined for effects at TNRs also show destabilization of other DNA sequences. It would be beneficial to identify modifier genes with the highest possible selectivity for TNRs. To our knowledge, no genetic screens have been described in the literature to identify trans-acting factors with the desired selectivity.

To assist in the identification of new modifier genes, we took advantage of yeast genetic assays for TNR expansions and contractions that are selective, sensitive, and quantitative (MIRET et al. 1998 Down; ROLFSMEIER et al. 2001 Down). An earlier article made the key finding that the rate of expansion of CTG repeats is dramatically increased above an apparent threshold level of ~15 repeats (ROLFSMEIER et al. 2001 Down). The difference in TNR thresholds in yeast and humans (15 repeats vs. ~35 repeats) suggested that cellular proteins play an important role in determining the threshold. If so, mutants that alter TNR instability at tract lengths near the threshold might have a higher selectivity for TNRs than the candidate genes examined so far. We report here that mutations in RTG2 lead to altered CTG·CAG repeat instability but do not seem to affect other DNA sequences that were tested. An unexpected finding was that the rtg2 mutation also led to more expansions than contractions, as is more like the case in human families affected by TNR diseases. RTG2 is therefore a modifier gene with selectivity toward CTG·CAG repeats, which helps control the ratio of expansions to contractions. The known role of RTG2 is to help to activate certain genes in the tricarboxylic acid cycle and the glyoxylate cycle in response to stress signals in yeast harboring defective mitochondria (PARIKH et al. 1987 Down; LIAO and BUTOW 1993 Down). No role of RTG2 in genetic instability has been previously reported or anticipated.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains:
The Saccharomyces cerevisiae strains included BL035 (MAT{alpha} {Delta}trp1 ura3-52 ade2{Delta} ade8 hom3-10 his3-Kpn1 met4 met13 leu2{Delta}), a leu2{Delta} derivative of MW3317-21A (KRAMER et al. 1989 Down), and an msh2::LEU2 derivative of BL035 (MIRET et al. 1998 Down). A rad27{Delta} mutant in the MW 3317-21A background was described earlier (SPIRO et al. 1999 Down). Strains harboring rtg1{Delta}, rtg2{Delta}, and rtg3{Delta} mutations (SEKITO et al. 2000 Down), derived from PSY142 (MAT{alpha} leu2 lys2 ura3 [{rho}+]), were kindly provided by Dr. Ron Butow (University of Texas Southwestern Medical Center). The yeast strains BL490 (MATa leu2{Delta}1 trp{Delta}63 ura3-52 his3-200) and its pol32{Delta} derivative BL492 were generous gifts from Sergei Mirkin (University of Illinois, Chicago). TNR-containing plasmids were directed to integrate into the yeast chromosome at the LYS2 locus by Bsu36I digestion (MIRET et al. 1998 Down) via transformation using the lithium acetate protocol (SCHIESTL and GIETZ 1989 Down). Correctly integrated alleles were identified by Southern hybridization.

Plasmids:
All triplet-repeat-containing plasmids were constructed using the pBL94 vector as described previously (ROLFSMEIER and LAHUE 2000 Down). TNR sequences, present as oligonucleotide duplexes, were inserted into the SphI site of pBL94. The primary sequence of all plasmids was confirmed by DNA sequence analysis. Plasmid pRS416-RTG2 was the generous gift from Dr. Ron Butow. The RTG2 coding fragment was recovered from pRS416-RTG2 by restriction digestion with KpnI and BamHI and subcloned into the same restriction sites of pRS314. The low-copy pRS314-RTG2 plasmid was used in these studies and is referred to as pRTG2. The reporter plasmid pSH44, containing 16.5 repeats of the dinucleotide repeat GT (HENDERSON and PETES 1992 Down), was a generous gift from Dr. Tom Petes (University of North Carolina).

Vectorette PCR:
To identify the disrupted genes in our mutagenesis study, genomic DNA flanking the disruption site was PCR amplified using the Vectorette PCR technique (C. Friddle, http://genome-www.stanford.edu/group/botlab). DNA sequencing was used to identify flanking sequence from the disrupted gene, and the gene sequence was identified by comparison with the yeast genome database (http://genome-www.stanford.edu/Saccharomyces).

Genetic assays:
To determine the rates of expansion and contraction, we used a quantitative genetic assay that monitors changes in TNR tract lengths by means of changes in cellular phenotype (MIRET et al. 1998 Down; ROLFSMEIER et al. 2001 Down). Briefly, TNR tracts are cloned as oligonucleotide cassettes into a reporter construct that includes the Schizosaccharomyces pombe adh1 promoter fused to a URA3 reporter gene. The transcription initiation site in this construct becomes dependent on the length of the triplet repeat. A starting tract of 25 repeats or less allows expression of the URA3 reporter gene with concomitant sensitivity of the cells to the cytotoxic drug 5-fluoroorotic acid (5-FOA). Expansions of the tract to lengths of 30 or more repeats inactivate the URA3 reporter and the cells accordingly become resistant to 5-FOA. Expansion rate is proportional to the number of 5-FOA-resistant colonies. For determining contraction rates, the assay is performed in reverse (ROLFSMEIER et al. 2001 Down), and cell growth is monitored in a selective media lacking uracil. When pRTG2 was used for complementation studies of the rtg2::LEU2 allele, the pRTG2 plasmid was always added to the strain already containing the triplet repeat reporter. The assay for mutation in dinucleotide repeats was performed as described by Petes and colleagues (HENDERSON and PETES 1992 Down). In this assay, a plasmid harboring a poly(GT) tract was introduced into the strains, and alteration in the reading frame of a reporter gene was monitored. Forward mutation rates for the CAN1 gene were determined by selection for canavanine resistance. Three to five independent clones were tested for each of the above assays to ensure reproducibility.

To assess the growth behavior of strains carrying rtg2 mutations, the media used were YNBD (0.67% yeast nitrogen base, 2% glucose, 0.02% glutamate) or YNB acetate (0.67% yeast nitrogen base, 2% potassium acetate and 0.5% yeast extract, 0.02% glutamate, pH 5.5).

Fluctuation analysis:
Fluctuation analysis was performed as described previously (MIRET et al. 1998 Down). The method of median (LEA and COULSON 1948 Down) was used to determine the rates of TNR instability. Briefly, yeast cells harboring a TNR reporter were resuspended in water and appropriate dilutions were plated onto nonselective media (YPD for most strains or YNBD + 0.02% glutamate for rtg strains). After growth for 2–3 days (wild type) or 7–10 days (mutants) at 30°, ~10 colonies were resuspended in water and an appropriate dilution was plated on nonselective media for total cell counts. The remaining suspension was plated on selective media containing 1 mg/ml 5-FOA but lacking histidine, to determine expansion rates, or on selective media lacking both histidine and uracil to determine contraction rates. At least three independent clones were tested to generate an average rate with standard deviation.

PCR analysis of independent expansion and contraction events:
Single-colony PCR analysis was performed using a published method (MIRET et al. 1998 Down). Briefly, template DNA was isolated from single yeast colonies by treatment with dithiothreitol and Triton X-100. DNA preparations were subjected to PCR in the presence of 0.125 µCi [{alpha}-32P]dCTP and oligonucleotide primers oBL91 (AAACTCGGTTTGACGCCTCCCATG) and oBL157 (AGCAACAGGACTAGGATGAGTAGC) that flank the triplet repeat region. The products of the PCR reaction were resolved on 6% denaturing polyacrylamide gels and their sizes were ascertained to within one to two repeats by comparing them with the reaction products of an M13 DNA sequence ladder. The percentage of bona fide expansions or contractions, determined by PCR analysis, was multiplied by the apparent expansion and contraction rates derived from fluctuation analysis. All rates reported here reflect this correction factor.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Identification of an rtg2 mutant affecting CTG·CAG repeat stability:
To identify new cellular proteins that affect TNR instability, we performed a screen for yeast mutants that showed an increased rate of expansion for CTG·CAG tracts near the threshold length. Since the CTG sequences reside in the Okazaki fragment in these expansion experiments, the CTG·CAG tract will be referred to as CTG whenever possible for brevity. [It is important to note the nomenclature for these experiments. For expansions, the cited sequence resides on the lagging daughter strand, since most models for TNR expansions envision hairpin formation in the Okazaki fragment (RICHARDS and SUTHERLAND 1994 Down; KANG et al. 1995 Down; FREUDENREICH et al. 1997 Down; GORDENIN et al. 1997 Down; SCHWEITZER and LIVINGSTON 1997 Down; MIRET et al. 1998 Down). The lagging daughter strand corresponds to the antisense strand of URA3. In contrast, contractions are thought to occur by folding of the TNR in the lagging template strand; therefore we use the convention that the template strand contains the indicated sequence. These assignments are possible because the direction of DNA replication through the integration locus is known (FREUDENREICH et al. 1997 Down).] As shown in previous work (ROLFSMEIER et al. 2001 Down), CTG expansions in our system exhibit an apparent threshold of ~15 repeats. The response curve of expansion rate vs. tract length is very steep in this range, with a 100-fold increase in expansion rates as the tract size is doubled from 10 to 20 CTGs. The steepness of this curve suggested that trans-acting mutations might be found with even modest phenotypes on CTG instability. We also reasoned that since thresholds are apparently unique to TNRs, mutations affecting tract instability in this size range might destabilize TNRs more than other DNA sequences. CTG repeats were chosen as a representative TNR because they are unstable in human disease and in many model systems. Furthermore, extensive information is available for CTG tracts in our system (MIRET et al. 1998 Down; SPIRO et al. 1999 Down; ROLFSMEIER et al. 2000 Down, ROLFSMEIER et al. 2001 Down), allowing direct comparison of the behavior of mutant strains with wild-type cells.

The starting strain contained 13 CTG repeats within the Padh1-TNR-URA3 reporter system (MIRET et al. 1998 Down) described in MATERIALS AND METHODS and reported previously (ROLFSMEIER et al. 2001 Down). In addition to the (CTG)13 tract, randomized nucleotides equivalent to 12 additional repeats were included to make a total insert length equal to 25 triplets. Expansions within the (CTG)13 region that increase the length by 5 repeats or more inactivate the URA3 reporter and thereby convey resistance to 5-FOA. In a wild-type background, the rate of expansion for (CTG)13 is very low (ROLFSMEIER et al. 2001 Down). When unmutagenized cells are first grown on nonselective media (YPD) and are then replica plated to 5-FOA-containing media, very few 5-FOAR papillae are observed. We used frequency of papillation on 5-FOA-containing media as a phenotype to screen 20,000 transformants from a yeast genomic library containing random insertions of the mTn-lacZ/LEU2 marker (BURNS et al. 1994 Down). Hereafter these mutants are referred to simply as LEU2 disruptions. Three rounds of screening were performed to identify mutants that reproducibly displayed more 5-FOAR papillae than wild type did when replica plated onto 5-FOA-containing media. The first screening was performed with transformant colonies, whereas rounds 2 and 3 were conducted with 1- to 2-cm2 patches of cells (to give more total papillae). Next, DNA was isolated from 5-FOAR papillae and tested by PCR for bona fide expansions of the CTG tract (MIRET et al. 1998 Down). Several mutants frequently exhibited PCR sizes larger than the starting tract. To identify the disrupted genes, genomic DNA flanking the disruption site was PCR amplified, sequenced, and compared to the yeast genome database. RTG2 was identified as the disrupted gene in two independent mutant strains.

Confirmation of the rtg2 mutation:
RTG2 is one of the pivotal genes involved in controlling interorganelle communication between mitochondria, peroxisomes, and the nucleus (LIAO and BUTOW 1993 Down). It encodes a novel cytoplasmic protein possessing an amino-terminal ATP-binding domain with sequence motifs bearing some similarity to hsp70 (BORK et al. 1992 Down), and it also shares some sequence similarity with bacterial polyphosphatases and phosphatases that hydrolyze guanosine penta- and tetraphosphate (KOONIN 1994 Down). RTG2 is also required to maintain a functional metabolic interaction between the TCA and glyoxylate cycles when there is mitochondrial dysfunction. Under such conditions, a decrease in TCA cycle activity is compensated by an increase in the activity of a peroxisomal enzyme via the metabolic interactions between the glyoxylate and TCA cycle. Hence RTG2 plays an important physiological role for retrograde regulation in linking the two metabolic pathways. It has been demonstrated that rtg2 deletion mutants are glutamate auxotrophs (LIAO and BUTOW 1993 Down; LIU and BUTOW 1999 Down). Various nucleotides and amino acids are synthesized from glutamate, which is synthesized from {alpha}-ketoglutarate, a TCA cycle intermediate. Any change in TCA cycle activity will affect the production of {alpha}-ketoglutarate and hence of glutamate. Thus, glutamate level is considered an important signaling component in the retrograde response pathway (LIU and BUTOW 1999 Down; SEKITO et al. 2000 Down; EPSTEIN et al. 2001 Down).

Since its known role is in interorganelle signaling, not in control of genetic stability, RTG2 was unexpected in our screen. Several genetic tests were therefore initiated to verify the assignment. rtg2 mutants are unable to thrive on media containing acetate as the major carbon source, even when supplemented with glutamate (LIAO and BUTOW 1993 Down; JIA et al. 1997 Down; LIU et al. 2001 Down). We confirmed that our mutant was defective in RTG2 function by monitoring the growth of the cells on the nonselective media YNBD and the YNB-acetate selective media, both containing 0.02% glutamate (Fig 1). On YNBD, all strains grew well. On acetate-containing media, however, the rtg2::LEU2 mutation resulted in no growth, similar to an rtg2{Delta} strain (kindly provided by Ron Butow). Growth on acetate-containing media was restored to both rtg2 mutant strains when a low-copy-number plasmid harboring the wild-type RTG2 gene was present in the cells. Also, as shown below, the pRTG2 plasmid reversed the phenotypes of the rtg2::LEU2 mutation when assayed for two phenotypes on CTG·CAG repeat tracts. Together, the sequencing data, the cellular phenotypes, and the complementation data establish RTG2 as the mutated gene from our screen.



View larger version (75K):
In this window
In a new window
Download PPT slide
 
Figure 1. Confirmation of RTG2 as the mutated gene. Cells with the indicated genotypes were grown for 5 days at 30° on plates containing either YNBD + 0.02% glutamate (left) or YNB acetate + 0.02% glutamate (right). The extended time accommodated the slow-growing rtg2 mutant strains.

The effect of rtg2::LEU2 on CTG expansions:
To better understand the effects of rtg2::LEU2 on expansions, quantitative rate measurements were performed. Several different CTG tract lengths were tested to compare phenotypic effects at tract lengths near the wild-type threshold of ~15 repeats (ROLFSMEIER et al. 2001 Down) and above the threshold (25 repeats). We found a subtle but significant effect with the (CTG)13 tract. The expansion rate was 2.5-fold higher in the rtg2::LEU2-containing strain than in the wild type (Table 1A). The control strain with an rtg2{Delta} allele gave a similar increase in rate of 3-fold. Both mutant values are significantly different from wild type (P values of 0.005 and 0.003; see legend to Table 1). The increased expansion rate for rtg2::LEU2 was reversed to wild-type levels when the pRTG2 plasmid was present (Table 1A). These results indicate that the rtg2 mutation conferred a hyperexpansion phenotype for (CTG)13 tracts. In contrast, strains with 25 CTG repeats showed expansion rates that were indistinguishable among wild type, rtg2::LEU2, and rtg2{Delta} (Table 1B). With 15 repeats, we found an intermediate effect. The expansion rate for rtg2::LEU2 strain was 1.5-fold higher than that for the wild type (data not shown). Thus the CTG repeat hyperexpansion phenotype associated with rtg2 mutations is lost as the repeat tract is lengthened. Since expansion rates near the threshold are somewhat higher in rtg2 mutants, these data suggest that RTG2 plays a modest role in determining the apparent threshold length for CTG expansions.


 
View this table:
In this window
In a new window

 
Table 1. Mutation rates for rtg2 mutants

Two explanations exist for the higher rate of expansions for the (CTG)13 tract in the rtg2::LEU2 mutant. Either there is an increased incidence of the same size expansions as seen in wild-type cells or a new size class of expansions, such as a shift toward larger or smaller alleles, occurs in the mutant. We examined the distribution of expansion sizes in the mutant for the 13 repeats by single-colony PCR (Fig 2). The distribution of expansion sizes for rtg2::LEU2 ranged from +5 to +10, with a median of 7.5 compared to 8 for the wild-type cells. The two mutational spectra overlap and therefore do not support a different size class of expansions in the mutant. We conclude therefore that the increase in expansion rate associated with the rtg2 mutation is due to an increased number of events that are of the same size range as in wild type. This analysis also showed that in the rtg2::LEU2 background, 97% of the expansions were limited to gains equal to or less than the original tract length, consistent with a replicational mechanism of instability (GORDENIN et al. 1997 Down). One expansion of +29 repeats was observed.



View larger version (15K):
In this window
In a new window
Download PPT slide
 
Figure 2. Comparison of the distribution of (CTG)13 expansion sizes between wild type and rtg2::LEU2. Single-colony PCR analysis was performed on genetically independent 5-FOAR colonies from fluctuation tests. Expansion sizes were measured using high-resolution denaturing polyacrylamide gels (MIRET et al. 1998 Down). Expansion sizes are accurate to within ±1–2 repeats. The x-axis denotes the number of repeats added with respect to the starting tract length (e.g., +5 repeats added means a final tract length of 18 repeats). The y-axis denotes the observed number of expansion events of that size.

We asked whether RTG2 dosage was limiting for control of CTG repeat expansions. This question was first addressed in heterozygous diploids. When the rtg2::LEU2 strain was mated to an RTG2 strain, the resulting heterozygous diploid showed the wild-type phenotype when assayed for expansions of the (CTG)13 tract. This indicates that a single copy of RTG2 is sufficient to control expansions in a diploid cell. We also introduced the low-copy-number RTG2 plasmid into wild-type haploids and found that the cells retained their wild-type expansion phenotype for (CTG)13. This indicates that one to two extra copies of RTG2 in a wild-type background do not improve the control of CTG expansions.

The effect of rtg2 on CTG contraction rates:
If expansion rates for at least some CTG alleles are increased in rtg2 mutants, then perhaps contraction rates would be similarly affected. To see if this were true, we examined CTG contraction rates under conditions where the CTG repeat sequences occupy the lagging strand template (see previous comments on nomenclature; ROLFSMEIER et al. 2001 Down). A contraction construct was used that contained a (CTG)25 repeat tract to which 24 bp of scrambled sequence, equivalent to eight repeats, was added ("25 + 8" configuration). This assay scores for losses of -5 to -25 repeats (ROLFSMEIER et al. 2001 Down) and allows a direct comparison with the (CTG)25 expansion measurements reported earlier (MIRET et al. 1998 Down). Contrary to expectations, we found that the contraction rate was reduced 15-fold for the rtg2::LEU2 mutant compared to that of the wild type (Table 1C). A similar, 16-fold reduction was seen for the rtg2{Delta} allele. The contraction rate was restored to wild-type levels by introducing the RTG2 plasmid into the rtg2::LEU2 background.

To help verify the unexpected finding that rtg2 mutants suppressed CTG contractions, we examined the contraction sizes in the mutant arising from the "25 + 8" starting tract. Contractions ranged from -9 to -16 repeats in the rtg2::LEU2 mutant, compared to -13 to -21 in the wild-type background (Fig 3). It therefore appears that the rtg2 mutation results in the loss of larger expansions and gives rise to a predominance of smaller size contractions. The influence of RTG2 on expansions and contractions is exciting because it leads to a greater propensity for expansions, at least for one CTG repeat allele. For the (CTG)25 tract that can be directly compared by our results, the rtg2::LEU2 background leads to a preponderance of expansions over contractions of ~5:1, whereas in the wild-type strain the ratio is ~1:3 (ROLFSMEIER et al. 2001 Down). Unlike the case in most model systems, these results indicate that expansions are the preferred event in rtg2 yeast cells.



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 3. Distribution of contraction sizes from (CTG)25+8 in wild-type and rtg2::LEU2 mutant strains. Single-colony PCR was performed on genetically independent Ura+ colonies from fluctuation tests. The size data were acquired as described in the legend to Fig 2. The x-axis here denotes repeats lost.

rtg2 shows little-to-no phenotype on mutation rates at other DNA sequences:
One goal of this mutant hunt was to find genes that affect CTG·CAG repeat instability substantially more than other DNA sequences. The effects of rtg2::LEU2 on a poly(GT) dinucleotide repeat were examined because the behavior of this microsatellite is well established. However, dinucleotide repeat mutations occur by a mechanism different from that for TNRs. Dinucleotide repeats most often show variation of plus or minus one to two repeats (HENDERSON and PETES 1992 Down), and mutation rates are very sensitive to the mismatch repair status of the cell (STRAND et al. 1993 Down). In contrast, CTG·CAG repeat expansions and contractions are identified in our system when they change length by five triplets or more, and these rates are not affected by mismatch repair deficiencies (MIRET et al. 1998 Down; ROLFSMEIER et al. 2000 Down). We measured the mutation rates for a (GT)16.5 tract in rtg2 mutants (Table 1D) by the method of Petes and colleagues (HENDERSON and PETES 1992 Down). The rtg2::LEU2 allele did not result in a detectable change of dinucleotide mutation rate, relative to wild type. In contrast, the mutation rate in an msh2{Delta} control strain was elevated >300-fold, similar to published values (STRAND et al. 1993 Down). We conclude that dinucleotide repeat instability is not significantly changed in an rtg2 background. Table 1E shows the results of a similar experiment with the CAN1 gene for determining the mutation rate in nonrepeating sequences. Again, the rtg2::LEU2 mutant gave a result very close to wild-type levels, whereas a rad27{Delta} control strain was elevated ~60-fold, similar to published values (TISHKOFF et al. 1997 Down). Like dinucleotide repeats, the results of the forward mutation rate analysis at CAN1 suggest that the rtg2 allele does not confer a general mutator phenotype. Rather, the rtg2 phenotypes on mutation rates appear specific for CTG·CAG repeats.

Another possibility is that the rtg2 mutation leads to increased instability of triplet repeats in general. To test this idea, we examined expansions of (CTA)25. Unlike CTG tracts, CTA repeats show little or no propensity to fold into hairpins (GACY et al. 1995 Down) and they are stable in our yeast assay (MIRET et al. 1998 Down). Fluctuation analysis revealed that the (CTA)25 sequence was equally stable in the rtg2 mutant and in wild-type cells, with an expansion rate of ~3 x 10-8 (MIRET et al. 1998 Down). The low rate suggests that the rtg2 phenotype is specific for hairpin-forming triplet repeat sequences only. Our assay may not be suitably sensitive to detect changes in (CTA)25 instability at this low level, however.

rtg1 and rtg3 mutants do not show effects on CTG·CAG repeat stability:
In response to changes in the mitochondrial state in yeast, an interorganelle signaling pathway known as retrograde regulation is activated (LIAO and BUTOW 1993 Down). The RTG1, RTG2, and RTG3 genes are all required in this pathway (LIAO and BUTOW 1993 Down; JIA et al. 1997 Down). In cells with dysfunctional mitochondria, RTG1 and RTG3 encode transcription factors that bind as a heterodimer to promoters of certain nuclear genes. Although the precise biochemical function of Rtg2p is not known, it helps facilitate the nuclear relocalization of Rtg1p and Rtg3p when the retrograde pathway is activated (SEKITO et al. 2000 Down). To assess the potential role of RTG1 and RTG3 on CTG·CAG repeat instability, we performed quantitative genetic assays for expansions and contractions in rtg1{Delta} and rtg3{Delta} strains. The expansion rates of the (CTG)13 repeat in the rtg1{Delta} and rtg3{Delta} mutants were unchanged compared to wild type (Table 1A). Similarly, the contraction rates of (CTG)25+8 in the rtg1{Delta} and rtg3{Delta} mutants were comparable to wild type (Table 1C). These results suggest that, in our system, RTG2 acts independently of RTG1 and RTG3, whereas in the retrograde response all the genes are involved and RTG2 works in conjunction with RTG1 and RTG3 (SEKITO et al. 2000 Down).

To further establish that the retrograde regulatory pathway is not involved in conferring triplet repeat instability, we tested CTG·CAG repeat expansions and contractions in wild-type cells by inhibiting the retrograde regulation with a high concentration of glutamate. Patches of wild-type cells were grown on YNBD media supplemented with proper nutrients, both in the presence and the absence of 0.2% glutamate (Table 1A and Table 1C). Glutamate at this concentration has been shown to inhibit retrograde regulation by ~99% (R. BUTOW, personal communication). Both expansion and contraction rates were unchanged by the presence or absence of glutamate (Table 1A and Table 1C). Since the presence of 0.2% glutamate failed to alter the behavior of RTG2 cells, these results suggest that the retrograde regulation pathway is not involved in instability of CTG·CAG tracts. Furthermore, the retrograde pathway is activated in cells with compromised mitochondrial function (LIAO and BUTOW 1993 Down). Our rtg2::LEU2 mutant strain is respiratory competent, judged by its ability to grow in the presence of glycerol as the sole carbon source. The results from the above experiments indicate that RTG2 affects triplet repeat stability via a novel pathway, independent of the retrograde regulatory pathway.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Significance:
This study revealed RTG2 as a yeast modifier gene for CTG·CAG repeat instability. The rtg2::LEU2 allele was found in a screen for mutations that increased expansion frequencies of the (CTG)13 reporter. The disrupted allele was identified first by PCR and DNA sequencing. The assignment was subsequently verified by comparisons with a known rtg2{Delta} mutant strain, by growth phenotypes in different media, and by complementation by plasmid-borne RTG2 for growth defects and for instability phenotypes on CTG·CAG repeats. Clearly the altered behavior of these tracts in the mutant is linked to defects in RTG2. Three new phenotypes were found associated with the loss of RTG2: (1) modest increases in rates of repeat expansions but significant decreases in contraction rates; (2) selectivity of the mutation for its effects on CTG·CAG repeat sequences, compared to no detectable change in instability of dinucleotide repeats or at the CAN1 mutation reporter gene; and (3) the apparent independence of RTG2 from its normal partners, RTG1 and RTG3. Each of these points is considered in more depth below. The significance of this work includes two major conclusions. First, yeast modifier genes can be identified by mutant screens. Second, mutant modifier genes may provide novel insights into the genetic controls that selectively govern TNR instability. While no human homolog of RTG2 is known from sequence-similarity analysis of the human genome database, perhaps there is a functional homolog that remains unidentified.

Effects of rtg2 on expansions and contractions:
The rtg2::LEU2 and rtg2{Delta} mutations resulted in a modest but significant hyperexpansion phenotype for the (CTG)13 reporter. The increased expansion rate was traced to more mutations of the same size class as that seen in wild type. Nearly all (97%) of the expansions were within twofold of the original tract length, consistent with a replicational mechanism of instability (GORDENIN et al. 1997 Down), although a recombinational mechanism (JANKOWSKI et al. 2000 Down) has not been ruled out in the rtg2 background. The hyperexpansion phenotype was reduced when the reporter contained 15 repeats, and no detectable change from wild type was observed when 25 CTG repeats were the target. When plotted as a graph of the log (expansion rate) vs. starting tract size (not shown), the data suggest that rtg2 mutations slightly shift the sigmoidal curve to the left, compared to the wild-type response (ROLFSMEIER et al. 2001 Down). This is consistent with the idea that the rtg2 mutation modestly reduces the apparent threshold length for CTG expansions, without affecting the plateau expansion rate at 25 repeats. However, the changes in expansion rate due to rtg2::LEU2 are too subtle to conclusively indicate an alteration in the threshold for expansions. To provide more compelling evidence for trans-control of threshold, additional mutations will be needed in other modifier genes with a stronger influence on expansion rates.

Surprisingly, the rtg2::LEU2 and rtg2{Delta} mutations also caused a suppression of contractions. The contraction rates were reduced by 15-fold for repeat tracts of 25. Fewer large size contractions were observed in the rtg2::LEU2 mutant than in wild type. The reduction in contraction rates creates a situation where expansions outnumber contractions by ~5:1 at CTG repeat lengths of 25. In this model system, expansions are more frequent than contractions, as is more like the case in human families afflicted with TNR diseases. One exciting possibility is that some limiting factor that controls expansion and contraction ratios is altered in rtg2 mutants. For comparison, rad27 mutants result in approximately equal numbers of expansions and contractions, primarily due to increases in expansion rates (SCHWEITZER and LIVINGSTON 1998 Down; SPIRO et al. 1999 Down). Mutations in rad50 or mre11 yield recombination-dependent expansions and contractions in nearly equal ratios, but the primary effect of these mutants is to reduce the frequency of contractions (RICHARD et al. 2000 Down). Regarding the opposing effects of rtg2 on expansion and contraction rates, it remains to be seen whether the two types of alterations occur through different mechanisms or whether the mechanisms are similar but are differentially sensitive to changes caused by the rtg2 mutation.

Selectivity of the rtg2 mutation for CTG·CAG repeat tracts:
As the existence of a threshold is thought to be unique to TNRs, we hypothesized that mutations affecting the expansion rate of a CTG repeat tract near the yeast threshold length (ROLFSMEIER et al. 2001 Down) would help identify mutants that destabilize TNRs more than other DNA sequences. The rtg2::LEU2 allele confers the desired selectivity. There was no detectable difference, compared to wild type, for mutation rates at a poly(GT) tract or for forward mutations inactivating CAN1. This feature distinguishes rtg2 from most other mutations that have been reported to alter the genetic stability of TNRs, but that also affect stability of other sequences. For example, mutation of the flap-processing activity encoded by yeast RAD27 increases TNR instability (FREUDENREICH et al. 1998 Down; SCHWEITZER and LIVINGSTON 1998 Down; SPIRO et al. 1999 Down; WHITE et al. 1999 Down), but rad27 strains are also hypermutable at a number of microsatellite repeats (JOHNSON et al. 1995 Down; KOKOSKA et al. 1998 Down) and they result in excess duplications (TISHKOFF et al. 1997 Down). Mismatch repair defects in bacteria (JAWORSKI et al. 1995 Down; PARNIEWSKI et al. 2000 Down; SCHMIDT et al. 2000 Down) or eukaryotes (SCHWEITZER and LIVINGSTON 1997 Down; MANLEY et al. 1999 Down; KOVTUN and MCMURRAY 2001 Down) have been reported to alter TNR instability, although other studies found no evidence of a role for mismatch repair at perfectly repeating TNRs (KRAMER et al. 1996 Down; FREUDENREICH et al. 1998 Down; ROLFSMEIER et al. 2000 Down). In either case, it is clear that loss of mismatch repair function creates instability at many sequences in the genome. Defects in recombinational repair systems in bacteria (SARKAR et al. 1998 Down) and yeast (RICHARD et al. 2000 Down) also have been reported to change TNR mutation frequencies, but again these defects have widespread effects throughout the genome. Based on this analysis RTG2 seems to be the best example so far of a gene that shows a high selectivity for a TNR sequence.

Independence of RTG2 effects at CTG·CAG repeats from RTG1 and RTG3:
The retrograde regulation pathway helps maintain cellular metabolism in yeast with mitochondrial dysfunction (LIAO and BUTOW 1993 Down). The retrograde response involves the products of RTG1, RTG2, and RTG3, plus other genes. Mutation in any one of the three RTG genes leads to loss of the retrograde response (LIAO and BUTOW 1993 Down; JIA et al. 1997 Down). Since the rtg2::LEU2 allele was identified in our screen, there was good reason to examine rtg1 and rtg3 mutants for potential effects on CTG·CAG repeat instability. However, we found no evidence that the complete retrograde regulatory pathway was involved. Neither RTG1 nor RTG3 was identified in our mutant screen. When rtg1{Delta} and rtg3{Delta} strains were assayed for expansions and contractions, both strains behaved like wild type. Furthermore, in wild-type cells there was no apparent difference in CTG·CAG tract instability whether or not the retrograde response was inhibited by the presence of high concentrations of glutamate in the growth media. Also our rtg2::LEU2 mutation was found in cells that are respiration competent, whereas signaling of dysfunctional mitochondria is a necessary input signal for activation of retrograde regulation (LIAO and BUTOW 1993 Down). Together these findings indicate that the action of RTG2 in our system is independent of RTG1 and RTG3 and probably independent of the retrograde response. There is a report of the independent function of Rtg2p in the regulation of nitrogen catabolism. Evidence is available that rtg2{Delta} mutations, but not rtg1{Delta} or rtg3{Delta} alleles, affect the ability of cells to take up ureidosuccinate (PIERCE et al. 2001 Down). Another study concluded, however, that glutamate levels dependent on the RTG pathway indirectly control ureidosuccinate uptake (SEKITO et al. 2002 Down). Thus it is controversial whether or not RTG2 can act independently of RTG1 or RTG3 in functions other than control of CTG·CAG repeat instability.

Possible models for RTG2 action:
Our evidence indicates that RTG2 is involved in triplet repeat stability via a novel pathway, distinct from the retrograde regulatory response. Although the biochemical function of Rtg2p is not known, it is a cytoplasmic protein involved in the nuclear relocalization of Rtg1p and Rtg3p in response to activation of the retrograde pathway (SEKITO et al. 2000 Down). Rtg2p does not appear to enter the nucleus, nor is the protein known to interact with DNA. Thus, Rtg2p most likely plays an indirect role in triplet repeat instability. One feasible scenario is that loss of RTG2 leads to altered expression of some gene or genes that influence CTG·CAG repeat instability. We examined available literature data on Rtg2p for clues to its potential action at CTG·CAG tracts. Microarray analysis provides one means of identifying genes whose expression is altered in an rtg2 background. Microarray data are available for RTG2 vs. rtg2 cells (EPSTEIN et al. 2001 Down), but only for cells that are {rho}-. Since our cells are {rho}+, the comparison is not a perfect one but it does provide some suggestions. Some of the genes with downregulated expression in an rtg2 background (but not in rtg1 or rtg3 strains) include HTB2 and HHF1, encoding histones H2B and H4, respectively. Two other downregulated genes in the rtg2 background are POL32, which encodes a noncatalytic subunit of DNA polymerase {delta}, and POL5, encoding a putative DNA polymerase of unknown function. Expression of these genes is reduced three- to fivefold in the rtg2 background. These findings implicate chromatin structure and/or DNA polymerase activity in TNR instability. We tested the idea that downregulation of POL32 might be the mechanism of action by examining the contraction rate of (CTG)25+8 in a pol32{Delta} background. If this idea is correct, the pol32{Delta} mutant would show a reduction in CTG repeat contraction rates similar to rtg2, assuming that a pol32{Delta} strain mimics downregulation of the gene. On the contrary, we found that the contraction rate in a pol32{Delta} background [5.2 (±3.5) x 10-5] is slightly higher than that in wild type [2.0 (±2.5) x 10-5]. This increased rate suggests that POL32 is not involved in triplet repeat stability, but that POL32 helps suppress genomic deletions, as suggested in a recent report (HUANG et al. 2002 Down). Proteomic analysis is a second possible avenue for understanding RTG2 action at TNR sequences. Proteomic results with yeast protein complexes (GAVIN et al. 2002 Down) suggest that Rtg2p is part of a large complex that also includes Hca4p. The activity of this complex is thought to be in protein/RNA transport and its cellular localization is listed as nuclear or unknown (GAVIN et al. 2002 Down). A recent study reported that Rtg2p also forms complexes with Mks1p, a regulatory factor in several cellular pathways, and this complex may play an important role in the regulation of RTG-dependent gene expression (SEKITO et al. 2002 Down). These reports, in conjunction with our results, underscore the fact that more must be done to fully understand the action of RTG2 at triplet repeat sequences. Nonetheless, the identification of RTG2 as a modifier gene and verification of its mutant phenotypes at CTG·CAG repeats provide an important first step.


*  FOOTNOTES

1 Present address: Division of Biological Sciences, Section of Microbiology, University of California, 1 Shields Ave., Davis, CA 95616. Back


*  ACKNOWLEDGMENTS

The authors thank Ron Butow for valuable reagents and for numerous helpful suggestions and Eric Alani for insightful comments on the manuscript. This work was supported by National Institutes of Health award GM-61961 (R.S.L.), by a Huntington's Disease Society of America Postdoctoral Fellowship (S.B.), by National Cancer Institute (NCI) training grant T32 CA09476 (M.J.D. and M.L.R.), by a graduate fellowship from the University of Nebraska Medical Center (M.J.D.), by summer undergraduate research fellowship funds from the Eppley Institute (K.W.), and by NCI Cancer Center support grant P30 CA36727 (Eppley Institute).

Manuscript received April 15, 2002; Accepted for publication June 27, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BORK, P., C. SANDER, and A. VALENCIA, 1992  An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, and hsp70 heat shock proteins. Proc. Natl. Acad. Sci. USA 89:7290-7294.[Abstract/Free Full Text]

BURNS, N., B. GRIMWADE, P. B. ROSS-MACDONALD, E.-Y. CHOI, and K. FINBERG et al., 1994  Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.. Genes Dev. 8:1087-1105.[Abstract/Free Full Text]

CAMPUZANO, V., L. MONTERMINI, M. D. MOLTO, L. PIANESE, and M. COSSEE et al., 1996  Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 271:1423-1427.[Abstract]

CHONG, S. S., E. ALMQVIST, H. TELENIUS, L. LATRAY, and K. NICHOL et al., 1997  Contribution of DNA sequence and CAG size to mutation frequencies of intermediate alleles for Huntington disease: evidence from single sperm analysis. Hum. Mol. Genet. 6:301-309.[Medline]

CUMMINGS, C. J. and H. Y. ZOGHBI, 2000  Fourteen and counting: unraveling trinucleotide repeat diseases. Hum. Mol. Genet. 9:909-916.[Abstract/Free Full Text]

EPSTEIN, C. B., J. A. WADDLE, W. HALE, IV, V. DAVE, and J. THORNTON et al., 2001  Genome-wide responses to mitochondrial dysfunction. Mol. Biol. Cell 12:297-308.[Abstract/Free Full Text]

FREUDENREICH, C. H., J. B. STAVENHAGEN, and V. A. ZAKIAN, 1997  Stability of a CTG/CAG trinucleotide repeat in yeast is dependent on its orientation in the genome. Mol. Cell. Biol. 17:2090-2098.[Abstract/Free Full Text]

FREUDENREICH, C. H., S. M. KANTROW, and V. A. ZAKIAN, 1998  Expansion and length-dependent fragility of CTG repeats in yeast. Science 279:853-856.[Abstract/Free Full Text]

GACY, A. M., G. GOELLNER, N. JURANIC, S. MACURA, and C. T. MCMURRAY, 1995  Trinucleotide repeats that expand in human disease form hairpin structure in vitro. Cell 81:533-540.[Medline]

GACY, A. M., G. M. GOELLNER, C. SPIRO, R. DYER, M. MIKESELL et al., 1997 DNA structures asociated with class I expansion of GAA in Friedreich's ataxia, p. 30 in Unstable Triplets, Microsatellites and Human Disease. Cambridge Symposia, Santa Fe, NM.

GAVIN, A.-C., M. BOSCHE, R. KRAUSE, P. GRANDI, and M. MARZLOCH et al., 2002  Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415:141-147.[Medline]

GORDENIN, D. A., T. A. KUNKEL, and M. A. RESNICK, 1997  Repeat expansion—All in a flap? Nat. Genet. 16:116-118.[Medline]

HENDERSON, S. T. and T. D. PETES, 1992  Instability of simple sequence DNA in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2749-2757.[Abstract/Free Full Text]

HUANG, M.-E., A.-G. RIO, M.-D. GALIBERT, and F. GALIBERT, 2002  POL32, a subunit of Saccharomyces cerevisiae DNA polymerase {Delta}, suppresses genomic deletions and is involved in the mutagenic bypass pathway. Genetics 160:1409-1422.[Abstract/Free Full Text]

JANKOWSKI, C., F. NASAR, and D. K. NAG, 2000  Meiotic instability of CAG repeat tracts occurs by double-strand break repair in yeast. Proc. Natl. Acad. Sci. USA 97:2134-2139.[Abstract/Free Full Text]

JAWORSKI, A., W. A. ROSCHE, R. GELLIBOLIAN, S. KANG, and M. SHIMIZU et al., 1995  Mismatch repair in Escherichia coli enhances instability of (CTG)n triplet repeats from human hereditary diseases. Proc. Natl. Acad. Sci. USA 92:11019-11023.[Abstract/Free Full Text]

JIA, Y., B. ROTHERMEL, J. THORNTON, and R. A. BUTOW, 1997  A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in a signaling pathway from mitochondria to the nucleus. Mol. Cell. Biol. 17:1110-1117.[Abstract/Free Full Text]

JIN, P. and S. T. WARREN, 2000  Understanding the molecular basis of fragile X syndrome. Hum. Mol. Genet. 9:901-908.[Abstract/Free Full Text]

JOHNSON, R. E., G. K. KOVVALI, L. PRAKASH, and S. PRAKASH, 1995  Requirement of the yeast RTH1 5' to 3' exonuclease for the stability of simple repetitive DNA. Science 269:238-240.[Abstract/Free Full Text]

KANG, S., A. JAWORSKI, K. OHSHIMA, and R. D. WELLS, 1995  Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli.. Nat. Genet. 10:213-218.[Medline]

KOKOSKA, R. J., L. STEFANOVIC, H. T. TRAN, M. A. RESNICK, and D. A. GORDENIN et al., 1998  Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase delta (pol3-t). Mol. Cell. Biol. 18:2779-2788.[Abstract/Free Full Text]

KOONIN, E. V., 1994  Yeast protein controlling inter-organelle communication is related to bacterial phosphatases containing the Hsp70-type ATP-binding region. Trends Biochem. Sci. 19:156-157.[Medline]

KOVTUN, I. V. and C. T. MCMURRAY, 2001  Trinucleotide expansion in haploid germ cells by gap repair. Nat. Genet. 27:407-411.[Medline]

KOVTUN, I. V., T. M. THERNEAU, and C. T. MCMURRAY, 2000  Gender of the embryo contributes to CAG instability in transgenic mice containing a Huntington's disease gene. Hum. Mol. Genet. 9:2767-2775.[Abstract/Free Full Text]

KRAMER, B., W. KRAMER, M. S. WILLIAMSON, and S. FOGEL, 1989  Heteroduplex DNA correction in Saccharomyces cerevisiae is mismatch specific and requires functional PMS genes. Mol. Cell. Biol. 9:4432-4440.[Abstract/Free Full Text]

KRAMER, P. R., C. E. PEARSON, and R. R. SINDEN, 1996  Stability of triplet repeats of myotonic dystrophy and fragile X loci in human mismatch repair cell lines. Hum. Genet. 98:151-157.[Medline]

LA SPADA, A. R., K. R. PETERSON, S. A. MEADOWS, M. E. MCCLAIN, and G. JENG et al., 1998  Androgen receptor YAC transgenic mice carrying CAG 45 alleles show trinucleotide repeat instability. Hum. Mol. Genet. 7:959-967.[Abstract/Free Full Text]

LEA, D. E. and C. A. COULSON, 1948  The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-284.

LEEFLANG, E. P., S. TAVARE, P. MARJORAM, C. O. S. NEAL, and J. SRINIDHI et al., 1999  Analysis of germline mutation spectra at the Huntington's disease locus supports a mitotic mutation mechanism. Hum. Mol. Genet. 8:173-183.[Abstract/Free Full Text]

LIAO, X. and R. A. BUTOW, 1993  RTG1 and RTG2: two yeast genes required for a novel path of communication from mitochondria to the nucleus. Cell 72:61-71.[Medline]

LIU, Z. and R. A. BUTOW, 1999  A transcriptional switch in the expression of yeast tricarboxylic acid cycle genes in response to a reduction or loss of respiratory function. Mol. Cell. Biol. 19:6720-6728.[Abstract/Free Full Text]

LIU, Z., T. SEKITO, C. B. EPSTEIN, and R. A. BUTOW, 2001  RTG-dependent mitochondria to nucleus signaling is negatively regulated by the seven WD-repeat protein Lst8p. EMBO J. 20:7209-7219.[Medline]

MANGIARINI, L., K. SATHASIVAM, A. MAHAL, R. MOTT, and M. SELLER et al., 1997  Instability of highly expanded CAG repeats in mice transgenic for the Huntington's disease mutation. Nat. Genet. 15:197-200.[Medline]

MANLEY, K., T. L. SHIRLEY, L. FLAHERTY, and A. MESSER, 1999  Msh2 deficiency prevents in vivo somatic instability of the CAG repeat in Huntington disease transgenic mice. Nat. Genet. 23:471-473.[Medline]

MCMURRAY, C. T., 1995  Mechanisms of DNA expansion. Chromosoma 104:2-13.[Medline]

MIRET, J. J., L. PESSOA-BRANDAO, and R. S. LAHUE, 1998  Orientation-dependent and sequence-specific expansions of CTG/CAG trinucleotide repeats in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:12438-12443.[Abstract/Free Full Text]

MONCKTON, D. G., M. I. COOLBAUGH, K. T. ASHIZAWA, M. J. SICILIANO, and C. T. CASKEY, 1997  Hypermutable myotonic dystrophy CTG repeats in transgenic mice. Nat. Genet. 15:193-196.[Medline]

PARIKH, V. S., M. M. MORGAN, R. SCOTT, L. S. CLEMENTS, and R. A. BUTOW, 1987  The mitochondrial genotype can influence nuclear gene expression in yeast. Science 235:576-580.[Abstract/Free Full Text]

PARNIEWSKI, P., A. JAWORSKI, R. D. WELLS, and R. P. BOWATER, 2000  Length of CTG/CAG repeats determines the influence of mismatch repair on genetic instability. J. Mol. Biol. 299:865-874.[Medline]

PAULSON, H. L. and K. H. FISCHBECK, 1996  Trinucleotide repeats in neurogenetic disorders. Annu. Rev. Neurosci. 19:79-107.[Medline]

PIERCE, M. M., M.-L. MADDELEIN, B. T. ROBERTS, and R. B. WICKNER, 2001  A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA 98:13213-13218.[Abstract/Free Full Text]

RICHARD, G.-F., G. M. GOELLNER, C. T. MCMURRAY, and J. E. HABER, 2000  Recombination-induced CAG trinucleotide repeat expansions in yeast involve the MRE11–RAD50–XRS2 complex. EMBO J. 19:2381-2390.[Medline]

RICHARDS, R. I. and G. R. SUTHERLAND, 1994  Simple repeat DNA is not replicated simply. Nat. Genet. 6:114-116.[Medline]

ROLFSMEIER, M. L. and R. S. LAHUE, 2000  Stabilizing effects of interruptions on trinucleotide repeat expansions in Saccharomyces cerevisiae.. Mol. Cell. Biol. 20:173-180.[Abstract/Free Full Text]

ROLFSMEIER, M. L., M. J. DIXON, and R. S. LAHUE, 2000  Mismatch repair blocks expansions of interrupted trinucleotide repeats in yeast. Mol. Cell 6:1501-1507.[Medline]

ROLFSMEIER, M. L., M. J. DIXON, L. PESSOA-BRANDAO, R. PELLETIER, and J. J. MIRET et al., 2001  Cis-elements governing trinucleotide repeat instability in Saccharomyces cerevisiae.. Genetics 157:1569-1579.[Abstract/Free Full Text]

SAKAMOTO, N., P. D. CHASTAIN, P. PARNIEWSKI, K. OHSHIMA, and M. PANDOLFO et al., 1999  Sticky DNA: self-association properties of long GAA-TTC repeats in R-R-Y triplex structures from Friedreich's ataxia. Mol. Cell 3:465-475.[Medline]

SARKAR, P. S., H.-C. CHANG, F. B. BOUDI, and S. REDDY, 1998  CTG repeats show bimodal amplification in E. coli. Cell 95:531-540.[Medline]

SATO, T., M. OYAKE, K. NAKAMURA, K. NAKAO, and Y. FUKUSIMA et al., 1999  Transgenic mice harboring a full-length human mutant DRPLA gene exhibit age-dependent intergenerational and somatic instabilities of CAG repeats comparable with those in DRPLA patients. Hum. Mol. Genet. 8:99-106.[Abstract/Free Full Text]

SCHIESTL, R. H. and D. GIETZ, 1989  High efficency transformation of intact yeast cells by single stranded nucleic acids as carrier. Curr. Genet. 16:339-346.[Medline]

SCHMIDT, K. H., C. M. ABOTT, and D. R. F. LEACH, 2000  Two opposing effects of mismatch repair on CTG repeat instability in Escherichia coli.. Mol. Microbiol. 35:463-471.[Medline]

SCHWEITZER, J. K. and D. M. LIVINGSTON, 1997  Destabilization of CAG trinucleotide repeat tracts by mismatch repair mutations in yeast. Hum. Mol. Genet. 6:349-355.[Abstract/Free Full Text]

SCHWEITZER, J. K. and D. M. LIVINGSTON, 1998  Expansions of CAG repeat tracts are frequent in a yeast mutant defective in Okazaki fragment maturation. Hum. Mol. Genet. 7:69-74.[Abstract/Free Full Text]

SEKITO, T., J. THORNTON, and R. A. BUTOW, 2000  Mitochondia-to-nuclear signaling is regulated by the subcellular localization of the transcription factors Rtg1p and Rtg3p. Mol. Biol. Cell 11:2103-2115.[Abstract/Free Full Text]

SEKITO, T., Z. LIU, J. THORNTON, and R. A. BUTOW, 2002  RTG-dependent mitochondria-to-nucleus signaling is regulated by MKS1 and is linked to formation of yeast prion. Mol. Biol. Cell 13:795-804. [URE3].[Abstract/Free Full Text]

SEZNEC, H., A.-S. LIA-BALDINI, C. DUROS, C. FOUQUET, and C. LACROIX et al., 2000  Transgenic mice carrying large human genomic sequences with expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic instability. Hum. Mol. Genet. 9:1185-1194.[Abstract/Free Full Text]

SHELBOURNE, P. F., N. KILLEEN, R. F. HEVNER, H. M. JOHNSTON, and L. TECOTT et al., 1999  A Huntington's disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural abnormalities in mice. Hum. Mol. Genet. 8:763-774.[Abstract/Free Full Text]

SPIRO, C., R. PELLETIER, M. L. ROLFSMEIER, M. J. DIXON, and R. S. LAHUE et al., 1999  Inhibition of FEN-1 processing by DNA secondary structure at trinucleotide repeats. Mol. Cell 4:1079-1085.[Medline]

STRAND, M., T. A. PROLLA, R. M. LISKAY, and T. D. PETES, 1993  Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-276.[Medline]

TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997  A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263.[Medline]

TRAN, H. T., J. D. KEEN, M. KRICKER, M. A. RESNICK, and D. A. GORDENIN, 1997  Hypermutability of homonucleotide runs in mismatch repair and DNA polymerase proofreading yeast mutants. Mol. Cell. Biol. 17:2859-2865.[Abstract/Free Full Text]

USDIN, K. and E. GRABCZYK, 2000  DNA repeat expansions and human disease. Cell. Mol. Life Sci. 57:914-931.[Medline]

WHEELER, V. C., W. AUERBACH, J. K. WHITE, J. SRINIDHI, and A. AUERBACH et al., 1999  Length-dependent gametic CAG repeat instability in the Huntington's disease knock-in mice. Hum. Mol. Genet. 8:115-122.[Abstract/Free Full Text]

WHITE, P. J., R. H. BORTS, and M. C. HIRST, 1999  Stability of the human Fragile X (CGG)n triplet repeat array in Saccharomyces cerevisiae deficient in aspects of DNA metabolism. Mol. Cell. Biol. 19:5675-5684.[Abstract/Free Full Text]

WIERDL, M., M. DOMINSKA, and T. D. PETES, 1997  Microsatellite instability in yeast: dependence on the length of the microsatellite. Genetics 146:769-779.[Abstract]




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Entezam and K. Usdin
ATR protects the genome against CGG{middle dot}CCG-repeat expansion in Fragile X premutation mice
Nucleic Acids Res., February 11, 2008; 36(3): 1050 - 1056.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-H. Kim, M. J. Pytlos, W. A. Rosche, and R. R. Sinden
(CAG){middle dot}(CTG) Repeats Associated with Neurodegenerative Diseases Are Stable in the Escherichia coli Chromosome
J. Biol. Chem., September 22, 2006; 281(38): 27950 - 27955.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Bhattacharyya and R. S. Lahue
Saccharomyces cerevisiae Srs2 DNA Helicase Selectively Blocks Expansions of Trinucleotide Repeats
Mol. Cell. Biol., September 1, 2004; 24(17): 7324 - 7330.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. Borghouts, A. Benguria, J. Wawryn, and S. M. Jazwinski
Rtg2 Protein Links Metabolism and Genome Stability in Yeast Longevity
Genetics, February 1, 2004; 166(2): 765 - 777.
[Abstract] [Full Text] [PDF]