- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Bhattacharyya, S.
- Articles by Lahue, R. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Bhattacharyya, S.
- Articles by Lahue, R. S.
Identification of RTG2 as a Modifier Gene for CTG·CAG Repeat Instability in Saccharomyces cerevisiae
Saumitri Bhattacharyyaa, Michael L. Rolfsmeier1,a, Michael J. Dixona,b, Kara Wagonera, and Robert S. Lahuea,ba Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805
b Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, Nebraska 68198-6805
Corresponding author: Robert S. Lahue, University of Nebraska Medical Center, Box 986805, Omaha, NE 68198-6805., rlahue{at}unmc.edu (E-mail)
Communicating editor: N. ARNHEIM
| ABSTRACT |
|---|
Trinucleotide repeats (TNRs) undergo frequent mutations in families affected by TNR diseases and in model organisms. Much of the instability is conferred in cis by the sequence and length of the triplet tract. Trans-acting factors also modulate TNR instability risk, on the basis of such evidence as parent-of-origin effects. To help identify trans-acting modifiers, a screen was performed to find yeast mutants with altered CTG·CAG repeat mutation frequencies. The RTG2 gene was identified as one such modifier. In rtg2 mutants, expansions of CTG·CAG repeats show a modest increase in rate, depending on the starting tract length. Surprisingly, contractions were suppressed in an rtg2 background. This creates a situation in a model system where expansions outnumber contractions, as in humans. The rtg2 phenotype was apparently specific for CTG·CAG repeat instability, since no changes in mutation rate were observed for dinucleotide repeats or at the CAN1 reporter gene. This feature sets rtg2 mutants apart from most other mutants that affect genetic stability both for TNRs and at other DNA sequences. It was also found that RTG2 acts independently of its normal partners RTG1 and RTG3, suggesting a novel function of RTG2 that helps modify CTG·CAG repeat mutation risk.
THE genetic behavior of trinucleotide repeats (TNRs) is unusual. There is a non-Mendelian inheritance pattern of disease-causing TNR expansions in families afflicted with fragile X syndrome, Huntington's disease (HD), or other syndromes (![]()
![]()
![]()
35 repeats (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In addition to the strong dependence on cis-elements like tract length and sequence, there is also evidence that trans-acting genetic modifiers affect TNR instability. For example, the same allele can show different instability, depending on whether it was inherited paternally or maternally. Generally speaking, the smaller expansions associated with translated CAG repeats are more often transmitted from the father, and very large expansions and contractions associated with untranslated CGG or CTG repeats are usually maternal in origin (see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Model systems such as bacteria, yeast, and transgenic mice have been examined for factors that influence TNR instability. These studies utilized candidate gene approaches, focusing on factors that influence DNA metabolism. Examples of candidate genes or pathways that have been characterized include the flap processing activity encoded by the yeast RAD27 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
To assist in the identification of new modifier genes, we took advantage of yeast genetic assays for TNR expansions and contractions that are selective, sensitive, and quantitative (![]()
![]()
15 repeats (![]()
35 repeats) suggested that cellular proteins play an important role in determining the threshold. If so, mutants that alter TNR instability at tract lengths near the threshold might have a higher selectivity for TNRs than the candidate genes examined so far. We report here that mutations in RTG2 lead to altered CTG·CAG repeat instability but do not seem to affect other DNA sequences that were tested. An unexpected finding was that the rtg2 mutation also led to more expansions than contractions, as is more like the case in human families affected by TNR diseases. RTG2 is therefore a modifier gene with selectivity toward CTG·CAG repeats, which helps control the ratio of expansions to contractions. The known role of RTG2 is to help to activate certain genes in the tricarboxylic acid cycle and the glyoxylate cycle in response to stress signals in yeast harboring defective mitochondria (![]()
![]()
| MATERIALS AND METHODS |
|---|
Strains:
The Saccharomyces cerevisiae strains included BL035 (MAT
trp1 ura3-52 ade2
ade8 hom3-10 his3-Kpn1 met4 met13 leu2
), a leu2
derivative of MW3317-21A (![]()
![]()
mutant in the MW 3317-21A background was described earlier (![]()
, rtg2
, and rtg3
mutations (![]()
leu2 lys2 ura3 [
+]), were kindly provided by Dr. Ron Butow (University of Texas Southwestern Medical Center). The yeast strains BL490 (MATa leu2
1 trp
63 ura3-52 his3-200) and its pol32
derivative BL492 were generous gifts from Sergei Mirkin (University of Illinois, Chicago). TNR-containing plasmids were directed to integrate into the yeast chromosome at the LYS2 locus by Bsu36I digestion (![]()
![]()
Plasmids:
All triplet-repeat-containing plasmids were constructed using the pBL94 vector as described previously (![]()
![]()
Vectorette PCR:
To identify the disrupted genes in our mutagenesis study, genomic DNA flanking the disruption site was PCR amplified using the Vectorette PCR technique (C. Friddle, http://genome-www.stanford.edu/group/botlab). DNA sequencing was used to identify flanking sequence from the disrupted gene, and the gene sequence was identified by comparison with the yeast genome database (http://genome-www.stanford.edu/Saccharomyces).
Genetic assays:
To determine the rates of expansion and contraction, we used a quantitative genetic assay that monitors changes in TNR tract lengths by means of changes in cellular phenotype (![]()
![]()
![]()
![]()
To assess the growth behavior of strains carrying rtg2 mutations, the media used were YNBD (0.67% yeast nitrogen base, 2% glucose, 0.02% glutamate) or YNB acetate (0.67% yeast nitrogen base, 2% potassium acetate and 0.5% yeast extract, 0.02% glutamate, pH 5.5).
Fluctuation analysis:
Fluctuation analysis was performed as described previously (![]()
![]()
10 colonies were resuspended in water and an appropriate dilution was plated on nonselective media for total cell counts. The remaining suspension was plated on selective media containing 1 mg/ml 5-FOA but lacking histidine, to determine expansion rates, or on selective media lacking both histidine and uracil to determine contraction rates. At least three independent clones were tested to generate an average rate with standard deviation.
PCR analysis of independent expansion and contraction events:
Single-colony PCR analysis was performed using a published method (![]()
-32P]dCTP and oligonucleotide primers oBL91 (AAACTCGGTTTGACGCCTCCCATG) and oBL157 (AGCAACAGGACTAGGATGAGTAGC) that flank the triplet repeat region. The products of the PCR reaction were resolved on 6% denaturing polyacrylamide gels and their sizes were ascertained to within one to two repeats by comparing them with the reaction products of an M13 DNA sequence ladder. The percentage of bona fide expansions or contractions, determined by PCR analysis, was multiplied by the apparent expansion and contraction rates derived from fluctuation analysis. All rates reported here reflect this correction factor.
| RESULTS |
|---|
Identification of an rtg2 mutant affecting CTG·CAG repeat stability:
To identify new cellular proteins that affect TNR instability, we performed a screen for yeast mutants that showed an increased rate of expansion for CTG·CAG tracts near the threshold length. Since the CTG sequences reside in the Okazaki fragment in these expansion experiments, the CTG·CAG tract will be referred to as CTG whenever possible for brevity. [It is important to note the nomenclature for these experiments. For expansions, the cited sequence resides on the lagging daughter strand, since most models for TNR expansions envision hairpin formation in the Okazaki fragment (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
15 repeats. The response curve of expansion rate vs. tract length is very steep in this range, with a 100-fold increase in expansion rates as the tract size is doubled from 10 to 20 CTGs. The steepness of this curve suggested that trans-acting mutations might be found with even modest phenotypes on CTG instability. We also reasoned that since thresholds are apparently unique to TNRs, mutations affecting tract instability in this size range might destabilize TNRs more than other DNA sequences. CTG repeats were chosen as a representative TNR because they are unstable in human disease and in many model systems. Furthermore, extensive information is available for CTG tracts in our system (![]()
![]()
![]()
![]()
The starting strain contained 13 CTG repeats within the Padh1-TNR-URA3 reporter system (![]()
![]()
![]()
![]()
![]()
Confirmation of the rtg2 mutation:
RTG2 is one of the pivotal genes involved in controlling interorganelle communication between mitochondria, peroxisomes, and the nucleus (![]()
![]()
![]()
![]()
![]()
-ketoglutarate, a TCA cycle intermediate. Any change in TCA cycle activity will affect the production of
-ketoglutarate and hence of glutamate. Thus, glutamate level is considered an important signaling component in the retrograde response pathway (![]()
![]()
![]()
Since its known role is in interorganelle signaling, not in control of genetic stability, RTG2 was unexpected in our screen. Several genetic tests were therefore initiated to verify the assignment. rtg2 mutants are unable to thrive on media containing acetate as the major carbon source, even when supplemented with glutamate (![]()
![]()
![]()
strain (kindly provided by Ron Butow). Growth on acetate-containing media was restored to both rtg2 mutant strains when a low-copy-number plasmid harboring the wild-type RTG2 gene was present in the cells. Also, as shown below, the pRTG2 plasmid reversed the phenotypes of the rtg2::LEU2 mutation when assayed for two phenotypes on CTG·CAG repeat tracts. Together, the sequencing data, the cellular phenotypes, and the complementation data establish RTG2 as the mutated gene from our screen.
|
The effect of rtg2::LEU2 on CTG expansions:
To better understand the effects of rtg2::LEU2 on expansions, quantitative rate measurements were performed. Several different CTG tract lengths were tested to compare phenotypic effects at tract lengths near the wild-type threshold of
15 repeats (![]()
allele gave a similar increase in rate of 3-fold. Both mutant values are significantly different from wild type (P values of 0.005 and 0.003; see legend to Table 1). The increased expansion rate for rtg2::LEU2 was reversed to wild-type levels when the pRTG2 plasmid was present (Table 1A). These results indicate that the rtg2 mutation conferred a hyperexpansion phenotype for (CTG)13 tracts. In contrast, strains with 25 CTG repeats showed expansion rates that were indistinguishable among wild type, rtg2::LEU2, and rtg2
(Table 1B). With 15 repeats, we found an intermediate effect. The expansion rate for rtg2::LEU2 strain was 1.5-fold higher than that for the wild type (data not shown). Thus the CTG repeat hyperexpansion phenotype associated with rtg2 mutations is lost as the repeat tract is lengthened. Since expansion rates near the threshold are somewhat higher in rtg2 mutants, these data suggest that RTG2 plays a modest role in determining the apparent threshold length for CTG expansions.
|
Two explanations exist for the higher rate of expansions for the (CTG)13 tract in the rtg2::LEU2 mutant. Either there is an increased incidence of the same size expansions as seen in wild-type cells or a new size class of expansions, such as a shift toward larger or smaller alleles, occurs in the mutant. We examined the distribution of expansion sizes in the mutant for the 13 repeats by single-colony PCR (Fig 2). The distribution of expansion sizes for rtg2::LEU2 ranged from +5 to +10, with a median of 7.5 compared to 8 for the wild-type cells. The two mutational spectra overlap and therefore do not support a different size class of expansions in the mutant. We conclude therefore that the increase in expansion rate associated with the rtg2 mutation is due to an increased number of events that are of the same size range as in wild type. This analysis also showed that in the rtg2::LEU2 background, 97% of the expansions were limited to gains equal to or less than the original tract length, consistent with a replicational mechanism of instability (![]()
|
We asked whether RTG2 dosage was limiting for control of CTG repeat expansions. This question was first addressed in heterozygous diploids. When the rtg2::LEU2 strain was mated to an RTG2 strain, the resulting heterozygous diploid showed the wild-type phenotype when assayed for expansions of the (CTG)13 tract. This indicates that a single copy of RTG2 is sufficient to control expansions in a diploid cell. We also introduced the low-copy-number RTG2 plasmid into wild-type haploids and found that the cells retained their wild-type expansion phenotype for (CTG)13. This indicates that one to two extra copies of RTG2 in a wild-type background do not improve the control of CTG expansions.
The effect of rtg2 on CTG contraction rates:
If expansion rates for at least some CTG alleles are increased in rtg2 mutants, then perhaps contraction rates would be similarly affected. To see if this were true, we examined CTG contraction rates under conditions where the CTG repeat sequences occupy the lagging strand template (see previous comments on nomenclature; ![]()
![]()
![]()
allele. The contraction rate was restored to wild-type levels by introducing the RTG2 plasmid into the rtg2::LEU2 background.
To help verify the unexpected finding that rtg2 mutants suppressed CTG contractions, we examined the contraction sizes in the mutant arising from the "25 + 8" starting tract. Contractions ranged from -9 to -16 repeats in the rtg2::LEU2 mutant, compared to -13 to -21 in the wild-type background (Fig 3). It therefore appears that the rtg2 mutation results in the loss of larger expansions and gives rise to a predominance of smaller size contractions. The influence of RTG2 on expansions and contractions is exciting because it leads to a greater propensity for expansions, at least for one CTG repeat allele. For the (CTG)25 tract that can be directly compared by our results, the rtg2::LEU2 background leads to a preponderance of expansions over contractions of
5:1, whereas in the wild-type strain the ratio is
1:3 (![]()
|
rtg2 shows little-to-no phenotype on mutation rates at other DNA sequences:
One goal of this mutant hunt was to find genes that affect CTG·CAG repeat instability substantially more than other DNA sequences. The effects of rtg2::LEU2 on a poly(GT) dinucleotide repeat were examined because the behavior of this microsatellite is well established. However, dinucleotide repeat mutations occur by a mechanism different from that for TNRs. Dinucleotide repeats most often show variation of plus or minus one to two repeats (![]()
![]()
![]()
![]()
![]()
control strain was elevated >300-fold, similar to published values (![]()
control strain was elevated
60-fold, similar to published values (![]()
Another possibility is that the rtg2 mutation leads to increased instability of triplet repeats in general. To test this idea, we examined expansions of (CTA)25. Unlike CTG tracts, CTA repeats show little or no propensity to fold into hairpins (![]()
![]()
3 x 10-8 (![]()
rtg1 and rtg3 mutants do not show effects on CTG·CAG repeat stability:
In response to changes in the mitochondrial state in yeast, an interorganelle signaling pathway known as retrograde regulation is activated (![]()
![]()
![]()
![]()
and rtg3
strains. The expansion rates of the (CTG)13 repeat in the rtg1
and rtg3
mutants were unchanged compared to wild type (Table 1A). Similarly, the contraction rates of (CTG)25+8 in the rtg1
and rtg3
mutants were comparable to wild type (Table 1C). These results suggest that, in our system, RTG2 acts independently of RTG1 and RTG3, whereas in the retrograde response all the genes are involved and RTG2 works in conjunction with RTG1 and RTG3 (![]()
To further establish that the retrograde regulatory pathway is not involved in conferring triplet repeat instability, we tested CTG·CAG repeat expansions and contractions in wild-type cells by inhibiting the retrograde regulation with a high concentration of glutamate. Patches of wild-type cells were grown on YNBD media supplemented with proper nutrients, both in the presence and the absence of 0.2% glutamate (Table 1A and Table 1C). Glutamate at this concentration has been shown to inhibit retrograde regulation by
99% (R. BUTOW, personal communication). Both expansion and contraction rates were unchanged by the presence or absence of glutamate (Table 1A and Table 1C). Since the presence of 0.2% glutamate failed to alter the behavior of RTG2 cells, these results suggest that the retrograde regulation pathway is not involved in instability of CTG·CAG tracts. Furthermore, the retrograde pathway is activated in cells with compromised mitochondrial function (![]()
| DISCUSSION |
|---|
Significance:
This study revealed RTG2 as a yeast modifier gene for CTG·CAG repeat instability. The rtg2::LEU2 allele was found in a screen for mutations that increased expansion frequencies of the (CTG)13 reporter. The disrupted allele was identified first by PCR and DNA sequencing. The assignment was subsequently verified by comparisons with a known rtg2
mutant strain, by growth phenotypes in different media, and by complementation by plasmid-borne RTG2 for growth defects and for instability phenotypes on CTG·CAG repeats. Clearly the altered behavior of these tracts in the mutant is linked to defects in RTG2. Three new phenotypes were found associated with the loss of RTG2: (1) modest increases in rates of repeat expansions but significant decreases in contraction rates; (2) selectivity of the mutation for its effects on CTG·CAG repeat sequences, compared to no detectable change in instability of dinucleotide repeats or at the CAN1 mutation reporter gene; and (3) the apparent independence of RTG2 from its normal partners, RTG1 and RTG3. Each of these points is considered in more depth below. The significance of this work includes two major conclusions. First, yeast modifier genes can be identified by mutant screens. Second, mutant modifier genes may provide novel insights into the genetic controls that selectively govern TNR instability. While no human homolog of RTG2 is known from sequence-similarity analysis of the human genome database, perhaps there is a functional homolog that remains unidentified.
Effects of rtg2 on expansions and contractions:
The rtg2::LEU2 and rtg2
mutations resulted in a modest but significant hyperexpansion phenotype for the (CTG)13 reporter. The increased expansion rate was traced to more mutations of the same size class as that seen in wild type. Nearly all (97%) of the expansions were within twofold of the original tract length, consistent with a replicational mechanism of instability (![]()
![]()
![]()
Surprisingly, the rtg2::LEU2 and rtg2
mutations also caused a suppression of contractions. The contraction rates were reduced by 15-fold for repeat tracts of 25. Fewer large size contractions were observed in the rtg2::LEU2 mutant than in wild type. The reduction in contraction rates creates a situation where expansions outnumber contractions by
5:1 at CTG repeat lengths of 25. In this model system, expansions are more frequent than contractions, as is more like the case in human families afflicted with TNR diseases. One exciting possibility is that some limiting factor that controls expansion and contraction ratios is altered in rtg2 mutants. For comparison, rad27 mutants result in approximately equal numbers of expansions and contractions, primarily due to increases in expansion rates (![]()
![]()
![]()
Selectivity of the rtg2 mutation for CTG·CAG repeat tracts:
As the existence of a threshold is thought to be unique to TNRs, we hypothesized that mutations affecting the expansion rate of a CTG repeat tract near the yeast threshold length (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Independence of RTG2 effects at CTG·CAG repeats from RTG1 and RTG3:
The retrograde regulation pathway helps maintain cellular metabolism in yeast with mitochondrial dysfunction (![]()
![]()
![]()
and rtg3
strains were assayed for expansions and contractions, both strains behaved like wild type. Furthermore, in wild-type cells there was no apparent difference in CTG·CAG tract instability whether or not the retrograde response was inhibited by the presence of high concentrations of glutamate in the growth media. Also our rtg2::LEU2 mutation was found in cells that are respiration competent, whereas signaling of dysfunctional mitochondria is a necessary input signal for activation of retrograde regulation (![]()
mutations, but not rtg1
or rtg3
alleles, affect the ability of cells to take up ureidosuccinate (![]()
![]()
Possible models for RTG2 action:
Our evidence indicates that RTG2 is involved in triplet repeat stability via a novel pathway, distinct from the retrograde regulatory response. Although the biochemical function of Rtg2p is not known, it is a cytoplasmic protein involved in the nuclear relocalization of Rtg1p and Rtg3p in response to activation of the retrograde pathway (![]()
![]()
-. Since our cells are
+, the comparison is not a perfect one but it does provide some suggestions. Some of the genes with downregulated expression in an rtg2 background (but not in rtg1 or rtg3 strains) include HTB2 and HHF1, encoding histones H2B and H4, respectively. Two other downregulated genes in the rtg2 background are POL32, which encodes a noncatalytic subunit of DNA polymerase
, and POL5, encoding a putative DNA polymerase of unknown function. Expression of these genes is reduced three- to fivefold in the rtg2 background. These findings implicate chromatin structure and/or DNA polymerase activity in TNR instability. We tested the idea that downregulation of POL32 might be the mechanism of action by examining the contraction rate of (CTG)25+8 in a pol32
background. If this idea is correct, the pol32
mutant would show a reduction in CTG repeat contraction rates similar to rtg2, assuming that a pol32
strain mimics downregulation of the gene. On the contrary, we found that the contraction rate in a pol32
background [5.2 (±3.5) x 10-5] is slightly higher than that in wild type [2.0 (±2.5) x 10-5]. This increased rate suggests that POL32 is not involved in triplet repeat stability, but that POL32 helps suppress genomic deletions, as suggested in a recent report (![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Division of Biological Sciences, Section of Microbiology, University of California, 1 Shields Ave., Davis, CA 95616. ![]()
| ACKNOWLEDGMENTS |
|---|
The authors thank Ron Butow for valuable reagents and for numerous helpful suggestions and Eric Alani for insightful comments on the manuscript. This work was supported by National Institutes of Health award GM-61961 (R.S.L.), by a Huntington's Disease Society of America Postdoctoral Fellowship (S.B.), by National Cancer Institute (NCI) training grant T32 CA09476 (M.J.D. and M.L.R.), by a graduate fellowship from the University of Nebraska Medical Center (M.J.D.), by summer undergraduate research fellowship funds from the Eppley Institute (K.W.), and by NCI Cancer Center support grant P30 CA36727 (Eppley Institute).
Manuscript received April 15, 2002; Accepted for publication June 27, 2002.
| LITERATURE CITED |
|---|
BORK, P., C. SANDER, and A. VALENCIA, 1992 An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, and hsp70 heat shock proteins. Proc. Natl. Acad. Sci. USA 89:7290-7294.
BURNS, N., B. GRIMWADE, P. B. ROSS-MACDONALD, E.-Y. CHOI, and K. FINBERG et al., 1994 Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.. Genes Dev. 8:1087-1105.
CAMPUZANO, V., L. MONTERMINI, M. D. MOLTO, L. PIANESE, and M. COSSEE et al., 1996 Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 271:1423-1427.[Abstract]
CHONG, S. S., E. ALMQVIST, H. TELENIUS, L. LATRAY, and K. NICHOL et al., 1997 Contribution of DNA sequence and CAG size to mutation frequencies of intermediate alleles for Huntington disease: evidence from single sperm analysis. Hum. Mol. Genet. 6:301-309.[Medline]
CUMMINGS, C. J. and H. Y. ZOGHBI, 2000 Fourteen and counting: unraveling trinucleotide repeat diseases. Hum. Mol. Genet. 9:909-916.
EPSTEIN, C. B., J. A. WADDLE, W. HALE, IV, V. DAVE, and J. THORNTON et al., 2001 Genome-wide responses to mitochondrial dysfunction. Mol. Biol. Cell 12:297-308.
FREUDENREICH, C. H., J. B. STAVENHAGEN, and V. A. ZAKIAN, 1997 Stability of a CTG/CAG trinucleotide repeat in yeast is dependent on its orientation in the genome. Mol. Cell. Biol. 17:2090-2098.
FREUDENREICH, C. H., S. M. KANTROW, and V. A. ZAKIAN, 1998 Expansion and length-dependent fragility of CTG repeats in yeast. Science 279:853-856.
GACY, A. M., G. GOELLNER, N. JURANIC, S. MACURA, and C. T. MCMURRAY, 1995 Trinucleotide repeats that expand in human disease form hairpin structure in vitro. Cell 81:533-540.[Medline]
GACY, A. M., G. M. GOELLNER, C. SPIRO, R. DYER, M. MIKESELL et al., 1997 DNA structures asociated with class I expansion of GAA in Friedreich's ataxia, p. 30 in Unstable Triplets, Microsatellites and Human Disease. Cambridge Symposia, Santa Fe, NM.
GAVIN, A.-C., M. BOSCHE, R. KRAUSE, P. GRANDI, and M. MARZLOCH et al., 2002 Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415:141-147.[Medline]
GORDENIN, D. A., T. A. KUNKEL, and M. A. RESNICK, 1997 Repeat expansionAll in a flap? Nat. Genet. 16:116-118.[Medline]
HENDERSON, S. T. and T. D. PETES, 1992 Instability of simple sequence DNA in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2749-2757.
HUANG, M.-E., A.-G. RIO, M.-D. GALIBERT, and F. GALIBERT, 2002 POL32, a subunit of Saccharomyces cerevisiae DNA polymerase
, suppresses genomic deletions and is involved in the mutagenic bypass pathway. Genetics 160:1409-1422.
JANKOWSKI, C., F. NASAR, and D. K. NAG, 2000 Meiotic instability of CAG repeat tracts occurs by double-strand break repair in yeast. Proc. Natl. Acad. Sci. USA 97:2134-2139.
JAWORSKI, A., W. A. ROSCHE, R. GELLIBOLIAN, S. KANG, and M. SHIMIZU et al., 1995 Mismatch repair in Escherichia coli enhances instability of (CTG)n triplet repeats from human hereditary diseases. Proc. Natl. Acad. Sci. USA 92:11019-11023.
JIA, Y., B. ROTHERMEL, J. THORNTON, and R. A. BUTOW, 1997 A basic helix-loop-helix-leucine zipper transcription complex in yeast functions in a signaling pathway from mitochondria to the nucleus. Mol. Cell. Biol. 17:1110-1117.
JIN, P. and S. T. WARREN, 2000 Understanding the molecular basis of fragile X syndrome. Hum. Mol. Genet. 9:901-908.
JOHNSON, R. E., G. K. KOVVALI, L. PRAKASH, and S. PRAKASH, 1995 Requirement of the yeast RTH1 5' to 3' exonuclease for the stability of simple repetitive DNA. Science 269:238-240.
KANG, S., A. JAWORSKI, K. OHSHIMA, and R. D. WELLS, 1995 Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli.. Nat. Genet. 10:213-218.[Medline]
KOKOSKA, R. J., L. STEFANOVIC, H. T. TRAN, M. A. RESNICK, and D. A. GORDENIN et al., 1998 Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase delta (pol3-t). Mol. Cell. Biol. 18:2779-2788.
KOONIN, E. V., 1994 Yeast protein controlling inter-organelle communication is related to bacterial phosphatases containing the Hsp70-type ATP-binding region. Trends Biochem. Sci. 19:156-157.[Medline]
KOVTUN, I. V. and C. T. MCMURRAY, 2001 Trinucleotide expansion in haploid germ cells by gap repair. Nat. Genet. 27:407-411.[Medline]
KOVTUN, I. V., T. M. THERNEAU, and C. T. MCMURRAY, 2000 Gender of the embryo contributes to CAG instability in transgenic mice containing a Huntington's disease gene. Hum. Mol. Genet. 9:2767-2775.
KRAMER, B., W. KRAMER, M. S. WILLIAMSON, and S. FOGEL, 1989 Heteroduplex DNA correction in Saccharomyces cerevisiae is mismatch specific and requires functional PMS genes. Mol. Cell. Biol. 9:4432-4440.
KRAMER, P. R., C. E. PEARSON, and R. R. SINDEN, 1996 Stability of triplet repeats of myotonic dystrophy and fragile X loci in human mismatch repair cell lines. Hum. Genet. 98:151-157.[Medline]
LA SPADA, A. R., K. R. PETERSON, S. A. MEADOWS, M. E. MCCLAIN, and G. JENG et al., 1998 Androgen receptor YAC transgenic mice carrying CAG 45 alleles show trinucleotide repeat instability. Hum. Mol. Genet. 7:959-967.
LEA, D. E. and C. A. COULSON, 1948 The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-284.
LEEFLANG, E. P., S. TAVARE, P. MARJORAM, C. O. S. NEAL, and J. SRINIDHI et al., 1999 Analysis of germline mutation spectra at the Huntington's disease locus supports a mitotic mutation mechanism. Hum. Mol. Genet. 8:173-183.
LIAO, X. and R. A. BUTOW, 1993 RTG1 and RTG2: two yeast genes required for a novel path of communication from mitochondria to the nucleus. Cell 72:61-71.[Medline]
LIU, Z. and R. A. BUTOW, 1999 A transcriptional switch in the expression of yeast tricarboxylic acid cycle genes in response to a reduction or loss of respiratory function. Mol. Cell. Biol. 19:6720-6728.
LIU, Z., T. SEKITO, C. B. EPSTEIN, and R. A. BUTOW, 2001 RTG-dependent mitochondria to nucleus signaling is negatively regulated by the seven WD-repeat protein Lst8p. EMBO J. 20:7209-7219.[Medline]
MANGIARINI, L., K. SATHASIVAM, A. MAHAL, R. MOTT, and M. SELLER et al., 1997 Instability of highly expanded CAG repeats in mice transgenic for the Huntington's disease mutation. Nat. Genet. 15:197-200.[Medline]
MANLEY, K., T. L. SHIRLEY, L. FLAHERTY, and A. MESSER, 1999 Msh2 deficiency prevents in vivo somatic instability of the CAG repeat in Huntington disease transgenic mice. Nat. Genet. 23:471-473.[Medline]
MCMURRAY, C. T., 1995 Mechanisms of DNA expansion. Chromosoma 104:2-13.[Medline]
MIRET, J. J., L. PESSOA-BRANDAO, and R. S. LAHUE, 1998 Orientation-dependent and sequence-specific expansions of CTG/CAG trinucleotide repeats in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:12438-12443.
MONCKTON, D. G., M. I. COOLBAUGH, K. T. ASHIZAWA, M. J. SICILIANO, and C. T. CASKEY, 1997 Hypermutable myotonic dystrophy CTG repeats in transgenic mice. Nat. Genet. 15:193-196.[Medline]
PARIKH, V. S., M. M. MORGAN, R. SCOTT, L. S. CLEMENTS, and R. A. BUTOW, 1987 The mitochondrial genotype can influence nuclear gene expression in yeast. Science 235:576-580.
PARNIEWSKI, P., A. JAWORSKI, R. D. WELLS, and R. P. BOWATER, 2000 Length of CTG/CAG repeats determines the influence of mismatch repair on genetic instability. J. Mol. Biol. 299:865-874.[Medline]
PAULSON, H. L. and K. H. FISCHBECK, 1996 Trinucleotide repeats in neurogenetic disorders. Annu. Rev. Neurosci. 19:79-107.[Medline]
PIERCE, M. M., M.-L. MADDELEIN, B. T. ROBERTS, and R. B. WICKNER, 2001 A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA 98:13213-13218.
RICHARD, G.-F., G. M. GOELLNER, C. T. MCMURRAY, and J. E. HABER, 2000 Recombination-induced CAG trinucleotide repeat expansions in yeast involve the MRE11RAD50XRS2 complex. EMBO J. 19:2381-2390.[Medline]
RICHARDS, R. I. and G. R. SUTHERLAND, 1994 Simple repeat DNA is not replicated simply. Nat. Genet. 6:114-116.[Medline]
ROLFSMEIER, M. L. and R. S. LAHUE, 2000 Stabilizing effects of interruptions on trinucleotide repeat expansions in Saccharomyces cerevisiae.. Mol. Cell. Biol. 20:173-180.
ROLFSMEIER, M. L., M. J. DIXON, and R. S. LAHUE, 2000 Mismatch repair blocks expansions of interrupted trinucleotide repeats in yeast. Mol. Cell 6:1501-1507.[Medline]
ROLFSMEIER, M. L., M. J. DIXON, L. PESSOA-BRANDAO, R. PELLETIER, and J. J. MIRET et al., 2001 Cis-elements governing trinucleotide repeat instability in Saccharomyces cerevisiae.. Genetics 157:1569-1579.
SAKAMOTO, N., P. D. CHASTAIN, P. PARNIEWSKI, K. OHSHIMA, and M. PANDOLFO et al., 1999 Sticky DNA: self-association properties of long GAA-TTC repeats in R-R-Y triplex structures from Friedreich's ataxia. Mol. Cell 3:465-475.[Medline]
SARKAR, P. S., H.-C. CHANG, F. B. BOUDI, and S. REDDY, 1998 CTG repeats show bimodal amplification in E. coli. Cell 95:531-540.[Medline]
SATO, T., M. OYAKE, K. NAKAMURA, K. NAKAO, and Y. FUKUSIMA et al., 1999 Transgenic mice harboring a full-length human mutant DRPLA gene exhibit age-dependent intergenerational and somatic instabilities of CAG repeats comparable with those in DRPLA patients. Hum. Mol. Genet. 8:99-106.
SCHIESTL, R. H. and D. GIETZ, 1989 High efficency transformation of intact yeast cells by single stranded nucleic acids as carrier. Curr. Genet. 16:339-346.[Medline]
SCHMIDT, K. H., C. M. ABOTT, and D. R. F. LEACH, 2000 Two opposing effects of mismatch repair on CTG repeat instability in Escherichia coli.. Mol. Microbiol. 35:463-471.[Medline]
SCHWEITZER, J. K. and D. M. LIVINGSTON, 1997 Destabilization of CAG trinucleotide repeat tracts by mismatch repair mutations in yeast. Hum. Mol. Genet. 6:349-355.
SCHWEITZER, J. K. and D. M. LIVINGSTON, 1998 Expansions of CAG repeat tracts are frequent in a yeast mutant defective in Okazaki fragment maturation. Hum. Mol. Genet. 7:69-74.
SEKITO, T., J. THORNTON, and R. A. BUTOW, 2000 Mitochondia-to-nuclear signaling is regulated by the subcellular localization of the transcription factors Rtg1p and Rtg3p. Mol. Biol. Cell 11:2103-2115.
SEKITO, T., Z. LIU, J. THORNTON, and R. A. BUTOW, 2002 RTG-dependent mitochondria-to-nucleus signaling is regulated by MKS1 and is linked to formation of yeast prion. Mol. Biol. Cell 13:795-804. [URE3].
SEZNEC, H., A.-S. LIA-BALDINI, C. DUROS, C. FOUQUET, and C. LACROIX et al., 2000 Transgenic mice carrying large human genomic sequences with expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic instability. Hum. Mol. Genet. 9:1185-1194.
SHELBOURNE, P. F., N. KILLEEN, R. F. HEVNER, H. M. JOHNSTON, and L. TECOTT et al., 1999 A Huntington's disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural abnormalities in mice. Hum. Mol. Genet. 8:763-774.
SPIRO, C., R. PELLETIER, M. L. ROLFSMEIER, M. J. DIXON, and R. S. LAHUE et al., 1999 Inhibition of FEN-1 processing by DNA secondary structure at trinucleotide repeats. Mol. Cell 4:1079-1085.[Medline]
STRAND, M., T. A. PROLLA, R. M. LISKAY, and T. D. PETES, 1993 Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-276.[Medline]
TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997 A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263.[Medline]
TRAN, H. T., J. D. KEEN, M. KRICKER, M. A. RESNICK, and D. A. GORDENIN, 1997 Hypermutability of homonucleotide runs in mismatch repair and DNA polymerase proofreading yeast mutants. Mol. Cell. Biol. 17:2859-2865.
USDIN, K. and E. GRABCZYK, 2000 DNA repeat expansions and human disease. Cell. Mol. Life Sci. 57:914-931.[Medline]
WHEELER, V. C., W. AUERBACH, J. K. WHITE, J. SRINIDHI, and A. AUERBACH et al., 1999 Length-dependent gametic CAG repeat instability in the Huntington's disease knock-in mice. Hum. Mol. Genet. 8:115-122.
WHITE, P. J., R. H. BORTS, and M. C. HIRST, 1999 Stability of the human Fragile X (CGG)n triplet repeat array in Saccharomyces cerevisiae deficient in aspects of DNA metabolism. Mol. Cell. Biol. 19:5675-5684.
WIERDL, M., M. DOMINSKA, and T. D. PETES, 1997 Microsatellite instability in yeast: dependence on the length of the microsatellite. Genetics 146:769-779.[Abstract]
This article has been cited by other articles:
![]() |
A. Entezam and K. Usdin ATR protects the genome against CGG{middle dot}CCG-repeat expansion in Fragile X premutation mice Nucleic Acids Res., February 11, 2008; 36(3): 1050 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kim, M. J. Pytlos, W. A. Rosche, and R. R. Sinden (CAG){middle dot}(CTG) Repeats Associated with Neurodegenerative Diseases Are Stable in the Escherichia coli Chromosome J. Biol. Chem., September 22, 2006; 281(38): 27950 - 27955. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhattacharyya and R. S. Lahue Saccharomyces cerevisiae Srs2 DNA Helicase Selectively Blocks Expansions of Trinucleotide Repeats Mol. Cell. Biol., September 1, 2004; 24(17): 7324 - 7330. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Borghouts, A. Benguria, J. Wawryn, and S. M. Jazwinski Rtg2 Protein Links Metabolism and Genome Stability in Yeast Longevity Genetics, February 1, 2004; 166(2): 765 - 777. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Bhattacharyya, S.
- Articles by Lahue, R. S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Bhattacharyya, S.
- Articles by Lahue, R. S.






