Genetics, Vol. 162, 521-524, September 2002, Copyright © 2002

Identification of 1088 New Transposon Insertions of Caenorhabditis elegans: A Pilot Study Toward Large-Scale Screens

Edwige Martina, Hélène Lalouxa, Gaëlle Couettea, Thierry Alvareza, Catherine Bessoua, Oliver Hausera, Satis Sookhareeab, Michel Labouesseb, and Laurent Ségalata
a CGMC, CNRS-UMR 5534, Université Lyon1, 69100 Villeurbanne, France
b IGBMC, BP. 163, 67404 Illkirch, France

Corresponding author: Laurent Ségalat, Université Lyon1, 43 bld du 11 Novembre, 69622 Villeurbanne Cedex, France., segalat{at}maccgmc.univ-lyon1.fr (E-mail)

Communicating editor: P. ANDERSON


*  ABSTRACT
*TOP
*ABSTRACT
*LITERATURE CITED

We explored the feasibility of a strategy based on transposons to generate identified mutants of most Caenorhabditis elegans genes. A total of 1088 random new insertions of C. elegans transposons Tc1, Tc3, and Tc5 were identified by anchored PCR, some of which result in a mutant phenotype.


PROJECTS to build large-scale collections of mutants exist for several model organisms amenable to genetics, including yeast, flies, and mouse (ZAMBROWICZ et al. 1998 Down; LIAO et al. 2000 Down; VIDAN and SNYDER 2001 Down). In Caenorhabditis elegans, there are currently mutants for <10% of the estimated 19,000 genes of C. elegans. In an approach complementary to knockouts, nondirected transposon-based insertional mutagenesis can be used to generate collections of mutants. In the mutants obtained, insertion sites are determined a posteriori by molecular analysis. C. elegans Tc elements from the mariner family have been used extensively for both forward and reverse genetics purposes (ANDERSON 1995 Down; PLASTERK and VAN LUENEN 1997 Down). However, a systematic study of Tc distribution at the genome level in mutator strains and of their potential mutagenic effect is not available. In this study, we characterized random insertions of Tc1 and Tc3 elements of the mariner superfamily (PLASTERK et al. 1999 Down) and of the distantly related Tc5 element (COLLINS and ANDERSON 1994 Down) to assay the feasibility of such an approach to generate a large-scale collection of identified mutants of C. elegans.

A technical difficulty in C. elegans is that natural elements used for mutagenic purposes exist in multiple copies in all strains. Approximately 30 copies of Tc1, 20 copies of Tc3, and 6 copies of Tc5 are present in the reference N2 strains. As a consequence, molecular screens need to distinguish between new and preexisting transposon copies in genomes to be analyzed.

Detection of the insertions:
To generate new insertions of Tc1, Tc3, and Tc5, we propagated strains carrying the mut-7 mutation (KETTING et al. 1999 Down) over 10 generations. Worms were frozen to be included in the strain collection, and an aliquot was used to extract DNA. We detected insertions by a modification of the transposon display protocol (WICKS et al. 2000 Down), such that the radioactive and polyacrylamide gel steps were removed. Worms (15 µl) were collected in M9 buffer, frozen at -80° for at least 30 min, and incubated in 100 mM Tris-HCl (pH 8.5), SDS 1%, EDTA 50 mM, NaCl 0.1 M, and 100 µg/ml proteinase K for 3 hr at 65°. DNA was extracted with phenol/chloroform, precipitated with 0.1 vol of sodium acetate and 0.8 vol of isopropanol, and resuspended in 50 µl TE (10 mM Tris-HCl pH 7.6, 1 mM EDTA) + 10 µg/ml RNAse. Then 5 µl of genomic DNA was digested with restriction enzymes. For enzymes producing cohesive ends, fragments were blunted with the Klenow enzyme. After heat inactivation of the enzymes, a linker formed of 5'-ACCTGCCC-3' and 5'-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3' was ligated to the fragments. A nested PCR was performed on 0.5 µl of the ligation reaction, using primer AP1 and one of the Tc primers (see below) for the first round of PCR (20 cycles). The second round of PCR was performed on 0.01 µl of the first PCR product using primer AP2 and one of the Tc primers (30 cycles). PCRs were performed with the Eurobio enzyme (Evry, France) in the buffer provided by the manufacturer.

Primer sequences are as follows: AP1, CCATCCTAATACGACTCACTATAGGGC; AP2, ACTCACTATAGGGCTCGAGCGGC; TC1R1S, GATCGACTCGATGCCACGTCGTTG; TC1R2, GATTTTGTGAACACTGTGGTGAAG; TC3.1, GGTCCTATAGAAGTTTCACACTGG; TC3.2, TTCGGAAGTTCCTCAAACCTTC; TC5.1, GCCAAACCTGCTCTGAAGCAG; and TC5.4, GGATCATCTGTAACTATCCTCTATCG.

Annealing temperature was 58° for Tc1 and 48° for Tc3 and Tc5. PCR products were run on 2% agarose gels. Bands that were unique to a clone were picked with a plastic inoculator, quickly vortexed in 100 µl water, and re-PCRed using the set of primers used for the second round of PCR. The PCR products were purified on Promega (Madison, WI) Wizard columns and sequenced.

Each DNA sample was analyzed independently with three enzymes. Most sequences reported in this study were obtained using enzymes ClaI, HindIII, and PmlI. Only a fraction of the insertions were detected by each enzyme. On the basis of the number of insertions detected with each enzyme, we estimate that ~2/3 of the insertions are detected using this protocol.

A total of 862 clones were generated. On average, two extra bands per clone (corresponding to new insertions) were observed, reamplified, and sequenced. Sequences were subsequently compared to the C. elegans genome by Blast. A total of 1088 sequences resulted in unambigous Blast results (625 Tc1, 253 Tc3, 210 Tc5). The list of insertions can be found on http://cgmc.univ-lyon1.fr and on http://www.wormbase.org.

To validate the protocol, we assayed whether we could recover predicted insertions from frozen worms. This is a critical point because (1) the anchored-PCR technique might produce artifacts and (2) original plates might carry a mixture of heterozygous and homozygous animals. We designed insertion-specific primers located ~500 bp from the predicted insertion sites. Thawed worms were singled out and PCR tested using as primers the Tc-specific primer that had been used in the first instance and the insertion-specific primer. In this way, we could recover an insertion in 64 of 69 strains tested. In most cases, more than half of the worms carried the insertion.

Distribution of the insertions:
One goal of this study was to observe the distribution of randomly generated Tc insertions in the genome. The distribution of each transposon (Tc1, Tc3, and Tc5) is shown on the physical map (Fig 1). No gross bias for any of the three transposons is observed, and we detected insertions in all chromosomic regions. The greatest disequilibrium between chromosomes is seen for Tc1, for which chromosome V has three times as many insertions as chromosome III (two times if standardized to chromosome length). The current resolution is not sufficient to determine if some genes are more prone to transposon integration than others.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 1. Distribution of insertions on the C. elegans physical map. Tc1, Tc3, and Tc5 are shown separately. Each chromosome is shown in the standard orientation. The length of each bar indicates the number of insertions within a 300-kb interval.

Another important parameter of transposon distribution is the type of genomic region in which the transposons jump (exons, introns, intergenic regions). We observed that ~20% of the insertions are located in coding sequences, 30% in introns, and 5% in 5'- or 3'-untranslated regions (arbitrarily defined as 100 bp before and after the coding sequence as defined in ACeDB/Wormbase databases). The remainder are located in intergenic regions. Coding sequence accounts for 26% of the C. elegans genome and introns for 14% (C. ELEGANS CONSORTIUM 1998 Down). Results were similar for each of the transposons. A likely explanation for the high proportion of intronic insertions comes from the AT-rich content of introns (the target sequence of Tc1 and Tc3 is TA, whereas Tc5 recognizes TNA).

Mutagenic properties of insertions located in exons:
We next tried to assay the mutagenic properties of insertions located in exons by asking whether these insertions produced a phenotype comparable to that resulting from a reduction of gene function. The loss-of-function phenotype of 6 out of the 277 exon insertions was known, as a result of either genetic (4 genes) or RNAi (2 genes) studies. We performed RNAi on 92 additional genes that were chosen at random. Ten genes produced obvious phenotypes by RNAi (Table 1), a ratio similar to that published in systematic screens (FRASER et al. 2000 Down; GONCZY et al. 2000 Down; PIANO et al. 2000 Down; HANAZAWA et al. 2001 Down; MAEDA et al. 2001 Down). The corresponding 16 clones were thawed, and the insertion could be recovered in 14 of them. Homozygous insertions led to phenotypes resembling those obtained by mutation or inactivation of the gene in 7 out of 14 cases (Table 1). In most cases, the phenotype of the insertion was weaker than the one observed by mutation or RNAi, a feature that is common to transposon-induced mutations (ANDERSON 1995 Down).


 
View this table:
In this window
In a new window

 
Table 1. Phenotype associated with homozygous insertion alleles

The mutagenic properties of randomly generated transposon insertions in exons in C. elegans have been a matter for discussion for many years. It has been clearly demonstrated that insertions located in the coding sequence of several genes do not lead to a phenotype because the transposon is spliced out of the mRNA (RUSHFORTH and ANDERSON 1996 Down), but it is unclear how general this phenomenon is. Although n is limited, our results indicate that Tc insertions in exons are not silent; half of randomly generated insertions located in exons of genes having a visible phenotype led to a similar phenotype.

This work was designed as a pilot experiment to analyze the feasibility of a large-scale production of mutants based on C. elegans Tc elements. It performs a community service by providing novel Tc insertions in or near 600 genes. In addition, the issues addressed in this study will be relevant to other types of transposons that may be used as mutagenic tools in C. elegans in the future.


*  ACKNOWLEDGMENTS

The authors are grateful to J. Godet, J. Samarut, J.-A. Lepesant, M. Philippe, and P. Couble for their continuous support for this project. We also thank T. Drynda for help with the web site, S. Wicks for the transposon display protocol, and L. Stein for incorporating the data into public databases. This work was supported by the Centre National de la Recherche Scientifique (CNRS), the Rhône-Alpes district, and the Association Française pour la Recherche contre le Cancer (ARC).

Manuscript received December 26, 2001; Accepted for publication June 18, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*LITERATURE CITED

ANDERSON, P., 1995 Mutagenesis, pp. 31–58 in Caenorhabditis elegans, edited by H. F. EPSTEIN and D. C. SHAKES. Academic Press, San Diego.

Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2017.[Abstract/Free Full Text]

COLLINS, J. and P. ANDERSON, 1994  The Tc5 family of transposable elements in Caenorhabditis elegans.. Genetics 137:771-781.[Abstract]

FRASER, A. G., R. S. KAMATH, P. ZIPPERLEN, M. MARTINEZ-CAMPOS, and M. SOHRMANN et al., 2000  Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408:325-330.[Medline]

GOLDEN, J. W. and D. L. RIDDLE, 1984  A pheromone-induced developmental switch in Caenorhabditis elegans: temperature-sensitive mutants reveal a wild-type temperature-dependent process. Proc. Natl. Acad. Sci. USA 81:819-823.[Abstract/Free Full Text]

GONCZY, P., G. ECHEVERRI, K. OEGEMA, A. COULSON, and S. JONES et al., 2000  Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408:331-336.[Medline]

HANAZAWA, M., M. MOCHII, N. UENO, Y. KOHARA, and Y. IINO, 2001  Use of cDNA subtraction and RNA interference screens in combination reveals genes required for germ-line development in Caenorhabditis elegans.. Proc. Natl. Acad. Sci. USA 98:8686-8691.[Abstract/Free Full Text]

KETTING, R., T. HAVERKAMP, H. VAN LUENEN, and R. PLASTERK, 1999  Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99:133-141.[Medline]

LEWIS, J. A. and J. A. HODGKIN, 1977  Specific neuroanatomical changes in chemosensory mutants of the nematode Caenorhabditis elegans. J. Comp. Neurol. 172:489-510.[Medline]

LIAO, G., E. REHM, and G. RUBIN, 2000  Insertion site preferences of the P transposable element in Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 97:3347-3351.[Abstract/Free Full Text]

MAEDA, I., Y. KOHARA, M. YAMAMOTO, and A. SUGIMOTO, 2001  Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr. Biol. 11:171-176.[Medline]

PIANO, F., A. J. SCHETTER, M. MANGONE, L. STEIN, and K. J. KEMPHUES, 2000  RNAi analysis of genes expressed in the ovary of Caenorhabditis elegans.. Curr. Biol. 10:1619-1622.[Medline]

PLASTERK, R., and H. VAN LUENEN, 1997 Transposons, pp. 97–116 in C. elegans II, edited by D. RIDDLE, T. BLUMENTHAL, B. MEYER and J. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

PLASTERK, R., Z. IZSVAK, and Z. IVICS, 1999  Resident aliens. Trends Genet. 15:326-332.[Medline]

PRASAD, B. C., B. YE, R. ZACKHARY, K. SCHRADER, and G. SEYDOUX et al., 1998  unc-3, a gene required for axonal guidance in Caenorhabditis elegans, encodes a member of the O/E family of transcription factors. Development 125:1561-1568.[Abstract]

RUSHFORTH, A. and P. ANDERSON, 1996  Splicing removes the Caenorhabditis elegans transposon Tc1 from most mutant pre-mRNAs. Mol. Cell. Biol. 16:422-429.[Abstract]

VIDAN, S. and M. SNYDER, 2001  Large-scale mutagenesis: yeast genetics in the genome era. Curr. Opin. Biotechnol. 12:28-34.[Medline]

WATERSTON, R. H., 1989  The minor myosin heavy chain, mhcA, of Caenorhabditis elegans is necessary for the initiation of thick filament assembly. EMBO J. 8:3429-3436.[Medline]

WICKS, S., C. DE VRIES, H. VAN LUENEN, and R. PLASTERK, 2000  CHE-3, a cytosolic dynein heavy chain, is required for sensory cilia structure and function in Caenorhabditis elegans.. Dev. Biol. 221:295-307.[Medline]

ZAMBROWICZ, B., G. FRIEDRICH, E. BUXTON, S. LILLEBERG, and C. PERSON et al., 1998  Disruption and sequence identification of 2,000 genes in mouse embryonic stem cells. Nature 392:608-611.[Medline]




This article has been cited by other articles:


Home page
Mol Biol EvolHome page
A. D. Cutter, A. Dey, and R. L. Murray
Evolution of the Caenorhabditis elegans Genome
Mol. Biol. Evol., June 1, 2009; 26(6): 1199 - 1234.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Begin and D. J. Schoen
Low Impact of Germline Transposition on the Rate of Mildly Deleterious Mutation in Caenorhabditis elegans
Genetics, December 1, 2006; 174(4): 2129 - 2136.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y.-K. Bae, H. Qin, K. M. Knobel, J. Hu, J. L. Rosenbaum, and M. M. Barr
General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia
Development, October 1, 2006; 133(19): 3859 - 3870.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. Granger, E. Martin, and L. Segalat
Mos as a tool for genome-wide insertional mutagenesis in Caenorhabditis elegans: results of a pilot study
Nucleic Acids Res., August 13, 2004; 32(14): e117 - e117.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. Rizzon, E. Martin, G. Marais, L. Duret, L. Segalat, and C. Biemont
Patterns of Selection Against Transposons Inferred From the Distribution of Tc1, Tc3 and Tc5 Insertions in the mut-7 Line of the Nematode Caenorhabditis elegans
Genetics, November 1, 2003; 165(3): 1127 - 1135.
[Abstract] [Full Text] [PDF]