- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Miller, J. H.
- Articles by Yang, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Miller, J. H.
- Articles by Yang, H.
Escherichia coli Strains (ndk) Lacking Nucleoside Diphosphate Kinase Are Powerful Mutators for Base Substitutions and Frameshifts in Mismatch-Repair-Deficient Strains
Jeffrey H. Millera, Pauline Funchaina, Wendy Clendenina, Tiffany Huanga, Anh Nguyena, Erika Wolffa, Annie Yeunga, Ju-Huei Chianga, Lilit Garibyana, Malgorzata M. Slupskaa, and Hanjing Yangaa Department of Microbiology, Immunology, and Molecular Genetics and The Molecular Biology Institute, University of California, Los Angeles, California 90095
Corresponding author: Jeffrey H. Miller, Immunology, and Molecular Genetics, UCLA, 405 Hilgard Ave., Los Angeles, CA 90095., jhmiller{at}mbi.ucla.edu (E-mail)
Communicating editor: H. OCHMAN
| ABSTRACT |
|---|
Nucleoside diphosphate (NDP) kinase is one of the enzymes that maintains triphosphate pools. Escherichia coli strains (ndk) lacking this enzyme have been shown to be modest base substitution mutators, and two members of the human family of NDP kinases act as tumor suppressors. We show here that in E. coli strains lacking NDP kinase high levels of mispairs are generated, but most of these are corrected by the mismatch-repair system. Double mutants that are ndk mutS, lacking both the NDP kinase and mismatch repair, have levels of base substitutions 15-fold higher and levels of certain frameshifts up to 10-fold higher than those of the respective mutations in mutS strains that are NDP kinase proficient. A sequence analysis of the specificity of base substitution mutations generated in ndk and ndk mutS backgrounds as well as other experiments suggests that NDP kinase deficiency stimulates polymerase errors that lead to A:T
G:C transitions and that the editing capacity of cells may be affected, leading to additional uncorrected mispairs and to A:T
T:A transversions.
NUCLEOSIDE diphosphate (NDP) kinase, a ubiquitous enzyme that maintains deoxynucleotide triphosphate pools by converting deoxynucleotide diphosphates to triphosphates, is highly conserved between bacteria, Drosophila, and humans (see reviews by ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We show here that in NDP kinase (NDK)-deficient strains of E. coli very high levels of mispairs are generated, but most of these are corrected by the mismatch-repair system and to some degree by the editing function (
) of DNA polymerase. These two systems normally safeguard the cell against polymerase errors (![]()
![]()
![]()
![]()
![]()
![]()
G:C transitions. The altered triphosphate pools may hinder the editing capacity of cells, leading to additional uncorrected mispairs. In the absence of mismatch repair (MMR-), the additional mispairs result in extremely high levels of mutations that are more than an order of magnitude greater than those seen in NDK-proficient MMR- strains. We consider these results with respect to the tumor suppressor activity of the human NDK protein and to the interaction of different alleles in generating cancer susceptibilities.
| MATERIALS AND METHODS |
|---|
Bacterial strains:
CC101-108, CC110, and CC111 have been described previously (![]()
![]()
(gpt-lac)5 thi/F'128 lacIZ proA+B+. The nature of the lacZ mutation differs in each case. In CC101-106 the lacZ mutation results from a base substitution at coding position 464 in lacZ. Reversion to Lac+ occurs by a different base substitution in each case (see Table 2). Strains CC107, -108, -110, and -111 carry a frameshift mutation in lacZ. Each reverts only via a specific frameshift (see Table 4). ndk, mutS, and ndk mutS derivatives of each of the CC101-111 strains were prepared by transduction of each strain with P1vir lysates (![]()
![]()
![]()
subunit of DNA polymerase III (![]()
![]()
(lac)RV thi.
|
|
|
|
Detection of insertions in ndk:
We employed mini-Tn10 derivatives to generate insertions in chromosomal genes. We looked for weak frameshift mutators using the same procedures that are described in detail in ![]()
![]()
Determination of mutation rates:
Rifr and Nalr mutants and Lac+ revertants were determined as described previously (![]()
![]()
100 cells and grown at 37°. Dilutions were plated on selective media and on Luria broth (LB; for determining the viable cell titer). For determining Lac+ revertants in mutS derivatives of CC107 and CC108, cultures were seeded with 10 cells or less. For determinations in ndk mutS derivatives of CC107, cultures used for plating were seeded with 1 or 2 cells by diluting a starting culture to the point where a drop delivered to a set of cultures resulted in one-third of the cultures receiving no cells. Lac+ frequencies were determined with a cell density of 109 cells per plate to prevent additional growth of cells leading to additional revertants. When <109 cells from the actual culture were plated, 109 cells of a scavenger (J93;
lac, see above) were added. Under these conditions 10-fold dilutions of the culture being tested yielded 10-fold fewer revertants. Mutant frequencies were determined, and the median frequency (f) from a set of cultures (the number of cultures varied from 11 to >50) was used to calculate the mutation rate (µ) per replication by the method of ![]()
![]()
Chromosomal DNA isolation and sequencing:
Chromosomal DNA was isolated using DNAzol reagent (GIBCO BRL, Rockville, MD) following the protocols supplied by the manufacturer. Portions of the rpoB gene were PCR amplified for cloning. The sequence of primers for amplifying the rpoB region encoding the main group of mutations (cluster II) was as follows: 5' GATATGATCAACGCCAAGCCGATTT 3' and 5' TTACACCGGAGTCAACGGCAACAGC 3'. The sequence of primers for amplifying the earlier region (cluster 1) was 5' AATGTCAAATCCGTGGCGT 3' and 5' CCAACCGCAGACAAGTCATA 3'. For some of the mutations in cluster II, the amplified fragments were cloned into the pCRII-TOPO vector using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced using vector primers. DNA sequencing was carried out by using [
-32P]dATP and a SequiTherm cycle sequencing kit (Epicentre Technologies, Madison, WI) with reagents and protocols supplied by the manufacturer. About one out of every five sequences yielded a secondary mutation, presumably introduced during the cloning step. In these cases the rpoB gene was cloned again from the same Rifr colony and resequenced. In each case one of the two mutations disappeared. We then confirmed many of the sequences by sequencing a PCR-amplified sample in the absence of cloning. Here, the rpoB gene was PCR amplified from genomic DNA using a different set of primers, which allowed us to sequence directly from the PCR product. The following primers were used for PCR: 5' CGTCGTATCCGTTCCGTTGG 3' and 5' TTCACCCGGATACATCTCGTC 3'. The PCR product was purified using the MinElute PCR purification kit (QIAGEN, Valencia, CA). The purified PCR products were then sequenced using the SequiTherm EXCEL II DNA sequencing kit (Epicentre Technologies). The following primers were used for sequencing straight from the PCR product: 5' CGTGTAGAGCGTGCGGTGAAA 3' for cluster II and 5' GAAGGCACCGTAAAAGACAT 3' for cluster I.
Purification of NDK and NM23-H2:
The E. coli ndk gene was amplified by PCR from E. coli genomic DNA and cloned into the NcoI and HindIII sites of the bacterial expression vector pQE60 (QIAGEN). The construct pQE60ndk allows the expression of a recombinant E. coli NDK protein that is the same as the native E. coli NDK protein. The open reading frame for the human NM23-H2 gene was amplified by PCR from the Hela cell line S3 cDNA library (Stratagene, La Jolla, CA). Standard site-directed mutagenesis (![]()
![]()
| RESULTS |
|---|
Mutation rates in strains lacking NDK and MMR: Base substitutions:
We detected inserts of miniTn10 in the ndk gene after a random search for weak frameshift mutators and verified their structure by DNA sequencing (see MATERIALS AND METHODS). We prepared double mutants, ndk mutS, by P1 transduction and assayed them initially for increases in Rifr and Nalr mutant frequencies. Table 1 presents these data in terms of mutation rate per replication, using the method of ![]()
![]()
Base substitutions in lacZ:
To analyze further the specificity of base substitutions generated in ndk and ndk mutS strains, we first looked at different derivatives of the series of strains CC101CC106, which measure each of the specific base substitutions at one site in the lacZ gene (![]()
T:A transverisons are the most prominent, although marginal effects are seen with other base substitutions. A:T
G:C transitions are elevated 10-fold at the one site examined (CC106), but the absolute rate of these mutations is still very low compared with other rates (see below). However, in ndk mutS double mutants A:T
G:C transitions are clearly elevated over the levels found in mutS strains alone. The level of A:T
G:C and A:T
TA changes in ndk mutS double mutants appears too low to account for the mutations in rpoB that generate Rifr mutants (Table 1), even when one takes into account the fact that a number of sites in rpoB can be mutated to yield the Rifr phenotype (![]()
Base substitutions in rpoB:
Sequence studies from a number of laboratories have analyzed mutations in rpoB leading to Rifr. ![]()
![]()
G:C changes at 8 sites, G:C
A:T changes at 12 sites, A:T
TA changes at 7 sites, A:T
C:G changes at 7 sites, G:C
T:A changes at 10 sites, and G:C
C:G changes at 3 sites. (A more complete description of the extended rpoB/Rifr system will be published elsewhere.)
We sequenced the rpoB mutations responsible for the Rifr phenotype in a total of >200 independent mutants from the following four backgrounds: wild type, ndk, mutS, and mutS ndk. The results are shown in Table 3. In the data set from the wild-type strain, all types of mutations are detected, although the A:T
G:C change at one particular site (base 1547) is the most prominent. In the other data sets, this is the predominant mutation detected. The percentage of mutations at this hotspot (A:T
G:C, 1547) varies from 15% of the spontaneous base substitutions detected to 77% in the ndk background. Although G:C
A:T changes are seen in the spontaneous and mutS backgrounds, none of these appear in the ndk or the mutS ndk backgrounds. Table 4 shows the surrounding sequence for each of the sites at which A:T
G:C substitutions are measured. Both the hotspot site and the second most represented A:T
G:C site have a 5'-G as nearest neighbor to the T that changes to a C. This 5'-G preference has been seen before for T
C transitions in a MMR- stain. (![]()
Frameshifts:
We originally detected the miniTn10 insertion in ndk during a search for frameshift mutators. Table 5 provides mutation rates for frameshifts using strains CC107, CC108, CC110, and CC111. These strains revert from the addition or loss of a single base pair from a run of six G's or six A's (see Table 7 and ![]()
|
|
|
Effect of mutD alleles:
We tested the effect of a partially impaired polymerase editing function,
, on an NDP kinase-deficient strain. We previously constructed a set of single-base changes in a dnaQ insert on the plasmid pBR329 that result in varying levels of mutator activity (mutD; ![]()
subunit. In otherwise wild-type strains, pBRmutD66 results in a moderate increase in mutations as measured by the Rifr assay. However, a double mutant that is ndk/pBRmutD66 has significantly increased mutation rates for rpoB (Rifr). We also tested whether the increase in A:T
T:A transversions in a ndk strain (Table 2) might be the result of a secondary effect of saturating the mutD-encoded (
) editing function, since A:T
T:A transversions are prominent in a mutD strain under certain conditions (![]()
T:A tranversion, in ndk, ndk/pBR, and WT/pBRmutD66 strains. As can be seen in Table 6, the ndk/pBRmutD66 strain displays a significant increase in reversion of the lacZ mutation in CC105 over that seen in ndk or ndk/pBRmutD66 strains alone. Although it is possible that the NDP kinase deficiency generates more polymerase errors that lead directly to A:A (or T:T) mispairs, the data in Table 6 are consistent with the increase in A:T
T:A transversions occurring indirectly as a result of inactivating the editing function (see DISCUSSION).
Complementation of E. coli ndk with human nm23-H2:
We expressed native NDK protein from both E. coli genomic and human cDNA (see MATERIALS AND METHODS), using the inducible bacterial expression vector pQE60 (QIAGEN) and the plasmid pREP4 (QIAGEN) that expresses the Lac repressor protein. Here, expression from pQE60 is increased in the presence of isopropyl thiogalactoside (IPTG). Table 7 shows the mutation rate for rpoB mutations leading to Rifr in strains lacking a functional chromosomal ndk gene. With the pQE60 lacking an insert, the mutation rate is high in the presence and absence of IPTG, since the NDK deficiency leads to a modest mutator phenotype (see Table 1). With the pQE60 carrying the E. coli ndk gene, the mutator effect is eliminated. The residual expression of the ndk gene on pQE60 in the absence of IPTG is still enough to provide sufficient NDK function. With the pQE60 carrying the human nm23-H2, the mutator effect is only partially overcome in the absence of IPTG, but completely nullified in the presence of IPTG, since the increased expression provides enough NDK function. This experiment shows that the human enzyme can provide NDK function to E. coli.
| DISCUSSION |
|---|
Understanding pathways of mutagenesis is relevant to the study of repair systems and to certain human diseases. As a tool, mutators, strains with a higher than normal mutation rate, have played an important role in the elucidation of DNA repair systems and the characterization of new pathways of mutagenesis, both in bacteria and in higher cells (see review by ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
It is well established that perturbing the dNTP pool balance can result in increased mutation and is relevant to human disease (see review by ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have examined the involvement of the E. coli ndk gene in mutagenesis. Earlier studies showed a moderate mutator activity for base substitutions of NDP kinase-deficient strains in E. coli (![]()
) of DNA polymerase.
Using a reversion system that detects specific base substitutions or frameshifts in the lacZ gene (![]()
![]()
T:A and the A:T
G:C changes are significantly increased in ndk strains (see Table 2). In a MMR- (mutS) background, ndk strains display a much greater increase of A:T
G:C transitions. No such effect of ndk was found for G:C
A:T transitions in a mutS background. However, the lacZ system utilizes only one site for each of the six base substitutions. Because of the possibility of surrounding sequence effects on mutation rate, we decided to investigate a wider spectrum of base substitution mutations by sequencing a portion of the rpoB gene in Rifr mutants. This rpoB/Rifr system has been developed and improved by several groups (![]()
![]()
![]()
![]()
![]()
![]()
The mutations detected by DNA sequencing of Rifr mutants (Table 3) show that whereas spontaneous mutations are distributed among many sites, 49 of 60 (82%) of the mutations seen in an ndk strain and 32/33 (97%) of the mutations in an ndk mutS strain are A:T
G:C transitions. All of the mutations seen in the sequenced sample from the mutS strain are transitions, of which 46/57 (81%) are A:T
G:C, and 11/57 (19%) are G:C
A:T). Although G:C
A:T transitions are found in the mutS spectrum, they are absent from the ndk and the mutS ndk spectrum. This propensity for increased A:T
G:C transitions in ndk and mutS ndk strains is consistent with increased pool sizes of dCTP and dGTP found in ndk strains (![]()
![]()
G:C, have a 5' G as the nearest neighbor to the T that is changed to a C (Table 4). This same preference for a 5' G nearest neighbor has been reported for lacI mutations in a mutS strain (![]()
![]()
The A:T
T:A substitutions seen in ndk strains (see Table 2 and Table 3) would be difficult to explain by the 20-fold increase in dCTP pools or the 7-fold increase in dGTP pools reported by Inoue and co-workers for ndk strains (![]()
T:A transversion is one of the signatures of a mutD strain, being the most prominent base change in the spectrum of lacI mutations in a mutD strain under certain conditions (![]()
![]()
![]()
![]()
The finding that strains lacking NDP kinase are hypermutable in mismatch-repair backgrounds provides an example of synergistic effects of different alleles, in this case ndk and mutS. Given the involvement of both NDP kinase deficiency (see ![]()
![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Tomas Lindahl and Edith Postel for helpful discussions. J.H.M. was supported by a grant from the National Institutes of Health (ES-0110875).
Manuscript received January 9, 2002; Accepted for publication June 21, 2002.
| LITERATURE CITED |
|---|
AALTONEN, L. A., P. PELTOMÄKI, F. S. LEACH, P. SISTONEN, and L. PYLKKÄNEN et al., 1993 Clues to the pathogenesis of familial colorectal cancer. Science 260:812-816.
BIGGS, J., N. TRIPOULAS, E. HERSPERGER, C. DEAROLF, and A. SHEARN, 1988 Analysis of the lethal interaction between the prune and Killer of prune mutations of Drosophila. Genes Dev. 2:1333-1343.
BIGGS, J., E. HERSPERGER, P. S. STEEG, L. A. LIOTTA, and A. SHEARN, 1990 A Drosophila gene that is homologous to a mammalian gene associated with tumor metastasis codes for a nucleoside diphosphate kinase. Cell 63:933-940.[Medline]
CHANG, C. L., X. X. ZHU, D. H. THORAVAL, D. UNGAR, and J. RAWWAS et al., 1994 Nm23H1 mutation in neuroblastoma. Nature 370:335-336.[Medline]
CUPPLES, C. G. and J. H. MILLER, 1989 A set of lacZ mutations in Escherichia coli that allow rapid determination of each of the six base substitutions. Proc. Natl. Acad. Sci. USA 86:5345-5349.
CUPPLES, C. G., M. CABRERA, C. CRUZ, and J. H. MILLER, 1990 A set of lacZ mutations in Escherichia coli that allow rapid detection of specific frameshift mutations. Genetics 125:275-280.[Abstract]
DIXON, W. J., and F. J. MASSEY, JR., 1969 Introduction to Statistical Analysis. McGraw-Hill, New York.
DRAKE, J. W., 1991 A constant rate of spontaneous mutation in DNA-based microbes. Proc. Natl. Acad. Sci. USA 88:7160-7164.
FISHEL, R., M. K. LESCOE, M. R. RAO, N. G. COPELAND, and N. A. JENKINS et al., 1993 The human mutator gene homolog MSH2 and its association with hereditary nonpolyposis colon cancer. Cell 75:1027-1038.[Medline]
FUNCHAIN, P., A. YEUNG, J. L. STEWART, R. LIN, and M. M. SLUPSKA et al., 2000 The consequences of growth of a mutator strain of Escherichia coli as measured by loss of function among multiple gene targets and loss of fitness. Genetics 154:959-970.
GARIBYAN, L., A. NGUYEN, T. HUANG, T. NGUYEN, and A. DIEP et al., 2002 Use of the rpoB gene to determine the specificity of base substitution mutations on the Escherichia coli chromosome. DNA Repair in press.
HAMBY, C. V., C. E. MENDOLA, L. POTLA, G. STAFFORD, and J. M. BACKER, 1995 Differential expression and mutation of NME genes in autologous cultured human melanoma cells with different metastatic potentials. Biochem. Biophys. Res. Commun. 211:579-585.[Medline]
HIGASHITANI, A., N. HIGASHITANI, S. YASUDA, and K. HORIUCHI, 1994 A general and fast method for mapping mutations on the Escherichia coli chromosome. Nucleic Acids Res. 22:2426-2427.
JIN, D. J. and C. A. GROSS, 1988 Mapping and sequencing of mutations in the Escherichia coli rpoB gene that lead to rifampicin resistance. J. Mol. Biol. 202:45-58.[Medline]
KARUNAKARAN, P. and J. DAVIES, 2000 Genetic antagonism and hypermutability in Mycobacterium smegmatis.. J. Bacteriol. 182:3331-3335.
KOLODNER, R., 1996 Biochemistry and genetics of eukaryotic mismatch repair. Genes Dev. 10:1433-1442.
KUNZ, B., A. KOHALMI, S. KOHALMI, T. A. KUNKEL, and C. K. MATHEWS et al., 1994 Deoxyribonucleoside triphosphate levels: a critical factor in the maintenance of genetic stability. Mutat. Res. 318:1-64.[Medline]
LACOMBE, M. L., L. MILON, A. MUNIER, J. G. MEHUS, and D. O. LAMBETH, 2000 The Human Nm23/nucleoside diphosphate kinases. J. Bioenerg. Biomembr. 32:247-258.[Medline]
LEACH, F. S., N. C. NICOLAIDES, N. PAPADOPOULOS, B. LIU, and J. JEN et al., 1993 Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell 75:1215-1225.[Medline]
LEONE, A., U. FLATOW, C. R. KING, M. A. SANDEEN, and I. M. MARGULIES et al., 1991 Reduced tumor incidence, metastatic potential, and cytokine responsiveness of nm23-transfected melanoma cells. Cell 65:25-35.[Medline]
LEONE, A., U. FLATOW, K. VANHOUTTE, and P. S. STEEG, 1993a Transfection of human nm23H1 into the human MDA-MB-435 breast carcinoma cell line: effects on tumor metastatic potential, colonization and enzymatic activity. Oncogene 8:2325-2333.[Medline]
LEONE, A., R. C. SEEGER, C. M. HONG, Y. Y. HU, and M. J. ARBOLEDA et al., 1993b Evidence for nm23 RNA overexpression, DNA amplification and mutation in aggressive childhood neuroblastomas. Oncogene 8:855-865.[Medline]
LEVY-LAHAD, E., A. LAHAD, S. EISENBERG, E. DAGAN, and T. PAPERNA et al., 2001 A single nucleotide polymorphism in the RAD51 gene modifies cancer risk in BRCA2 carriers. Proc. Natl. Acad. Sci. USA 98:3232-3236.
LOEB, L. A., 1991 Mutator phenotype may be required for multistage carcinogenesis. Cancer Res. 51:3075-3079.
LOMBARDI, D., M. L. LACOMBE, and M. G. PAGGI, 2000 nm23: unraveling its biological function in cell differentiation. J. Cell. Physiol. 182:144-149.[Medline]
LU, Q., X. ZHANG, N. ALMAULA, C. K. MATHEWS, and M. INOUYE, 1995 The gene for nucleoside diphosphate kinase functions as a mutator gene in Escherichia coli.. J. Mol. Biol. 254:337-341.[Medline]
MENDELMAN, L. V., J. PETRUSKA, and M. F. GOODMAN, 1990 Base mispair extension kinetics. Comparison of DNA polmerase
and reverse transcriptase. J. Biol. Chem. 265:2338-2346.
MILLER, J. H., 1992 A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MILLER, J. H., 1998 Mutators in Escherichia coli.. Mutat. Res. 409:99-106.[Medline]
MODRICH, P., 1997 Strand-specific mismatch repair in mammalian cells. J. Biol. Chem. 272:24727-24730.
MODRICH, P. and R. LAHUE, 1996 Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133.[Medline]
MUSSER, J. M., 1995 Antimicrobial agent resistance in mycobacteria: molecular genetic insights. Clin. Microbiol. Rev. 8:496-514.[Abstract]
NOWELL, P. C., 1976 The clonal evolution of tumor cell populations. Science 194:23-28.
OTSUKI, Y., M. TANAKA, S. YOSHII, N. KAWAZOE, and K. NAKAYA et al., 2001 Tumor metastasis suppressor nm23H1 regulates Rac1 GTPase by interaction with Tiam1. Proc. Natl. Acad. Sci. USA 98:4385-4390.
PELTOMÄKI, P., R. A. LOTHE, L. A. AALTONEN, L. PYLKKÄNEN, and M. NYSTRÖM-LAHTI et al., 1993 Microsatellite instability is associated with tumors that characterize the hereditary non-polyposis colorectal carcinoma syndrome. Cancer Res. 53:5853-5855.
POSTEL, E. H., S. J. BERBERICH, S. J. FLINT, and C. A. FERRONE, 1993 Human c-myc transcription factor PuF identified as nm23H2 nucleoside diphosphate kinase, a candidate suppressor of tumor metastasis. Science 261:478-480.
POSTEL, E. H., B. M. ABRAMCZYK, M. N. LEVIT, and S. KYIN, 2000 Catalysis of DNA cleavage and nucleoside triphosphate synthesis by NM23H2/NDP kinase share an active site that implies a DNA repair function. Proc. Natl. Acad. Sci. USA 97:14194-14199.
RADMAN, M. and R. WAGNER, 1986 Mismatch repair in Escherichia coli.. Annu. Rev. Genet. 20:523-538.[Medline]
RAMPINO, N., H. YAMAMOTO, Y. IONOV, Y. LI, and H. SAWAI et al., 1997 Somatic frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator phenotype. Science 275:967-969.
RANGARAJAN, S., G. GUDMUNDSSON, Z. QUI, P. L. FOSTER, and M. F. GOODMAN, 1997 Escherichia coli DNA polymerase II catalyzes chromosomal and episomal DNA synthesis in vivo. Proc. Natl. Acad. Sci. USA 94:946-951.
ROBERTS, J. D. and T. A. KUNKEL, 1988 Fidelity of a human cell DNA replication complex. Proc. Natl. Acad. Sci. USA 85:7064-7068.
ROBERTS, J. D., D. C. THOMAS, and T. A. KUNKEL, 1991 Exonucleolytic proofreading of leading and lagging strand DNA replications errors. Proc. Natl. Acad. Sci. USA 88:3465-3469.
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCHAAPER, R. M., 1988 Mechanisms of mutagenesis in the Escherichia coli mutator mutD5: role of DNA mismatch repair. Proc. Natl. Acad. Sci. USA 85:8126-8130.
SCHAAPER, R. M. and R. L. DUNN, 1987 Spectra of spontaneous mutations in Escherichia coli strains defective in mismatch correction: the nature of in vivo DNA replication errors. Proc. Natl. Acad. Sci. USA 84:6220-6224.
SCHEUERMANN, R. H. and H. ECHOLS, 1984 A separate editing exonuclease for DNA replication: the epsilon subunit of Escherichia coli DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. USA 81:7747-7751.
SEVERINOV, K., M. SOUSHKO, A. GOLDFARB, and V. NIKIFOROV, 1993 Rifampicin region revisited. New rifampicin-resistant and streptolydigin-resistant mutants in the beta subunit of Escherichia coli RNA polymerase. J. Biol. Chem. 268:14820-14825.
SLUPSKA, M. M., A. G. KING, L. I. LU, R. H. LIN, and E. F. MAO et al., 1998 Examination of the role of DNA polymerase proofreading in the mutator effect of miscoding tRNAs. J. Bacteriol. 180:5712-5717.
SLUPSKA, M. M., J. H. CHIANG, W. M. LUTHER, J. L. STEWART, and L. AMII et al., 2000 Genes involved in the determination of the rate of inversions at short inverted repeats. Genes Cells 5:425-437.[Abstract]
WU, X., J. GU, C. I. AMOS, H. JIANG, and W. K. HONG et al., 1998 A parallel study of in vitro sensitivity to benzo[a]pyrene diol epoxide and bleomycin in lung carcinoma cases and controls. Cancer 83:1118-1127.[Medline]
This article has been cited by other articles:
![]() |
N. Nakashima and T. Tamura Conditional gene silencing of multiple genes with antisense RNAs and generation of a mutator strain of Escherichia coli Nucleic Acids Res., June 10, 2009; (2009) gkp498v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gawel, M. D. Hamilton, and R. M. Schaaper A Novel Mutator of Escherichia coli Carrying a Defect in the dgt Gene, Encoding a dGTP Triphosphohydrolase J. Bacteriol., November 1, 2008; 190(21): 6931 - 6939. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nordman and A. Wright The relationship between dNTP pool levels and mutagenesis in an Escherichia coli NDP kinase mutant PNAS, July 22, 2008; 105(29): 10197 - 10202. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zeibell, S. Aguila, V. Yan Shi, A. Chan, H. Yang, and J. H. Miller Mutagenesis and Repair in Bacillus anthracis: the Effect of Mutators J. Bacteriol., March 15, 2007; 189(6): 2331 - 2338. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Bai and A-L. Lu Physical and Functional Interactions between Escherichia coli MutY Glycosylase and Mismatch Repair Protein MutS J. Bacteriol., February 1, 2007; 189(3): 902 - 910. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Goswami, J.-H. Yoon, B. M. Abramczyk, G. P. Pfeifer, and E. H. Postel Molecular and Functional Interactions between Escherichia coli Nucleoside-diphosphate Kinase and the Uracil-DNA Glycosylase Ung J. Biol. Chem., October 27, 2006; 281(43): 32131 - 32139. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Mathews DNA precursor metabolism and genomic stability FASEB J, July 1, 2006; 20(9): 1300 - 1314. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Gabrovsky, M. L. Yamamoto, and J. H. Miller Mutator Effects in Escherichia coli Caused by the Expression of Specific Foreign Genes J. Bacteriol., July 15, 2005; 187(14): 5044 - 5048. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Hong, A. Yeung, P. Funchain, M. M. Slupska, and J. H. Miller Mutants with Temperature-Sensitive Defects in the Escherichia coli Mismatch Repair System: Sensitivity to Mispairs Generated In Vivo J. Bacteriol., February 1, 2005; 187(3): 840 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Bennett, C.-Y. Chen, and D. W. Mosbaugh Escherichia coli nucleoside diphosphate kinase does not act as a uracil-processing DNA repair nuclease PNAS, April 27, 2004; 101(17): 6391 - 6396. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Postel and B. M. Abramczyk Escherichia coli nucleoside diphosphate kinase is a uracil-processing DNA repair nuclease PNAS, November 11, 2003; 100(23): 13247 - 13252. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kim, T. Huang, and J. H. Miller Competition between MutY and Mismatch Repair at A {middle dot} C Mispairs In Vivo J. Bacteriol., August 1, 2003; 185(15): 4626 - 4629. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Miller, J. H.
- Articles by Yang, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Miller, J. H.
- Articles by Yang, H.




