- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mohr, S. E.
- Articles by Gelbart, W. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mohr, S. E.
- Articles by Gelbart, W. M.
Using the P{wHy} Hybrid Transposable Element to Disrupt Genes in Region 54D-55B in Drosophila melanogaster
Stephanie E. Mohra and William M. Gelbartaa Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts 02138
Corresponding author: William M. Gelbart, Cambridge, MA 02138., gelbart{at}morgan.harvard.edu (E-mail)
Communicating editor: T. SCHÜPBACH
| ABSTRACT |
|---|
Understanding the function of each gene in the genome of a model organism such as Drosophila melanogaster is an important goal. The development of improved methods for uncovering the mutant phenotypes of specific genes can accelerate achievement of this goal. The P{wHy} hybrid transposable element can be used to generate nested sets of precisely mapped deletions in a given region of the Drosophila genome. Here we use the P{wHy} method to generate overlapping, molecularly defined deletions from a set of three P{wHy} insertions in the 54E-F region of chromosome 2. Deletions that span a total of 0.5 Mb were identified and molecularly mapped precisely. Using overlapping deletions, the mutant phenotypes of nine previously uncharacterized genes in a 101-kb region were determined, including identification of new loci required for viability and female fertility. In addition, the deletions were used to molecularly map previously isolated lethal mutations. Thus, the P{wHy} method provides an efficient method for systematically determining the phenotypes of genes in a given region of the fly genome.
THE availability of the genome sequence of Drosophila melanogaster has given researchers a glimpse of the complete set of Drosophila genes. The annotation of these genes continues to improve with computational and experimental methods, making the sequence of the
13,600 Drosophila genes available from any web terminal on the globe (![]()
Classic genetic approaches have yielded invaluable insight into gene function at the levels of biochemical function, function in a particular pathway, and function in a particular cell type, tissue, or organ. Indeed, the Berkeley Drosophila Genome Project (BDGP) has set a goal of obtaining a mutation in every gene in the fly genome to help elucidate gene function (![]()
![]()
![]()
![]()
A major advantage of P-element disruption over chemical or high-energy radiation mutagenesis is that P elements provide a molecular foothold from which researchers can identify the site of insertion by molecular methods such as inverse PCR (iPCR; ![]()
![]()
![]()
![]()
![]()
Clearly, new methods could accelerate the pace of understanding gene function by facilitating the study of mutant phenotypes. Although both RNA-mediated interference and homologous recombination approaches have been reported (![]()
![]()
![]()
Another approach is the P{wHy} hybrid transposable-element-based method for creating genomic deletions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Here we use the P{wHy} method to disrupt and characterize genes by generating deletions from adjacent starting insertion sites and then placing overlapping deletions in trans to one another. The deletions cover an
0.5-Mb region in cytological region 54D-55B of chromosome 2 between the cytogenetically defined loci abero (54E; ![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Fly stocks and culturing:
Fly strains were maintained at 25° using standard protocols for media preparation and culturing. Strains carrying the following mutations were obtained from the National Drosophila Stock Center (Bloomington, IL): grhs2140, grhIM, grh06850, halDB48, stau1, staury9, thr1, thrk07805b, Df(2R) Pcl7B, l(2)k11505, l(2)k11311, l(2)k09924, and l(2)PC4-A139, l(2)PC4-B110, l(2)PC4-D202, l(2)PC4-E119, l(2)PC4-F198, l(2)PC4-G223, and l(2)PC4-M420 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
P{wHy} insertion site identification:
Autosomal insertions of P{wHy} were molecularly mapped on the 3' end using iPCR (![]()
![]()
The P{wHy}14F06, 14H10, and 02B10 insertion sites were confirmed by using genomic DNA-specific primers 5' or 3' of the insert site (below) with Pendout2 (cgacgggaccaccttatgtt) in PCR assays, and PCR products were sequenced with Pendout2 to confirm the insertion sites. The genomic DNA-specific primers were as follows: for 14F06, 5'-atctcctcctcgctggactcggact and 5'-cttttgcacgcaagcgcagc; for 14H10, 5'-agtttaaataggatctcgcc and 5'-gatgtagtagtgttgaaaggtga; for 02B10, 5'-gatgtggaaattgtatgagagtag and 5'-tagtagtctttttcgaagctctg.
Generation and identification of genomic disruptions:
To mobilize hobo in P{wHy}14F06, 14H10, and 02B10, homozygous or heterozygous males carrying an insertion were crossed to virgin females carrying a source of hobo transposase (y- w-;Gla/CyO-P{hsH\\T-2}). The resulting larvae were heat-shocked for 30 min at 37° on the second, fourth, and sixth days after crossing the adults. In the F1 cross, individual y- w-;P{wHy}/CyO-P{hsH\\T-2} males were crossed to y- w-; Gla/SM6a virgin females. Phenotypically w+ y- and w- y+ lines were recovered from the F2 and crossed to y- w-; Gla/SM6a virgin females to establish balanced stocks. The 5' and 3' genomic DNA-specific primers that flank the insertion site described above were used with the Pendout2 primer in a one-tube PCR assay to test for the presence of 5' and 3' ends. Lines in which both the 5' and 3' products were present were discarded (these represent deletions of the marker genes without associated disruption of flanking genomic DNA). Lines in which only the predicted P end was detected were retained (see Fig 1B and Fig C).
Mapping of hobo insertion sites:
The 5' hobo insertion sites (w+ y- lines) and 3' hobo insertion sites (w- y+) were mapped by iPCR (![]()
![]()
![]()
For UFW 5' hobo mapping, the following primers were used (listed in the order in which they were used): h5-1, 5'-actacctacgagaccactcg; h5-2, 5'-tttaggcactgtgtgagcgg(n10); h5-3, 5'-taacggtatacccacaagtg; h5-4, 5'-acgcaaacacctattgattcgg; and h5-5, 5'-gatgtgcgtggcgagtagcaccc. For UFW 3' hobo mapping, the following primers were used: h3-1, 5'-ccgaatcaatacggtgttttgcgt; h3-2, 5'-cgagtggtctcgtaggtact(n10); h3-3, cacttgtgggtataccgtta; h3-4, 5'-gatcgttgactgtgcgtccactca; h3-5, 5'-acacaacgtcggtaaaacactcga.
Complementation analysis and fertility tests:
Complementation analysis was performed by crossing heterozygous virgin females of one genotype to heterozygous males of the other genotype. All genotypes were balanced over SM6a or CyO second chromosome balancers, and the Cy+ phenotype was used to identify trans-heterozygous individuals resulting from the cross (n > 100 adults scored in all cases). Whenever possible, additional markers were scored. For example, for P{3'wHy}02B10 crosses to P{5'wHy}14H10 lines (balanced with SM6a in all cases), it was possible to identify trans-heretozygotes as the w+, y+, Cy+ class. All viable trans-heterozygous combinations were tested for female fertility by crossing trans-heterozygous females to wild-type males; all homozygous viable genomic disruption strains were also tested for female fertility.
| RESULTS |
|---|
Three insertions define a 101-kb region in polytene region 54:
Using iPCR, several independent insertions of the P{wHy} hybrid transposable element (Fig 1A) were molecularly mapped from a collection of autosomal insertions. Sequencing of flanking DNA revealed that three inserts, P{wHy}14F06, P{wHy}14H10, and P{wHy}02B10 (hereafter, 14F06, 14H10, and 02B10), are in a region in which little genetic data are connected with molecularly defined genes in the region (Fig 1D; GenBank accession nos.
BH836458,
BH836459,
BH836460,
BH836461,
BH836462,
BH836463,
BH836464,
BH836465,
BH836466,
BH836467,
BH836468,
BH836469). The three inserts have the same orientation of insertion and are within 101 kb of one another between the cytogenetically defined loci abero (54E; ![]()
![]()
![]()
![]()
![]()
![]()
|
Each of the three P{wHy} inserts is predicted to disrupt a transcript (Fig 2). Whereas the 14F06 insertion chromosome is homozygous lethal, the 14H10 and 02B10 insertion chromosomes are homozygous viable. The 14F06 insertion disrupts the eIF3-S8 gene, which encodes a highly conserved translation factor (![]()
![]()
|
Mobilization of hobo in 14F06, 14H10, and 02B10 results in disruption of genomic DNA:
To generate and isolate unidirectional deletions from each of the three starting P{wHy} insertions, we introduced hobo transposase to generate deletions (see MATERIALS AND METHODS; ![]()
Since the 14H10 insertion is between 02B10 and 14F06, events in both directions are useful for obtaining overlapping deletions. Therefore, about twice as many crosses were performed with 14H10 as with the others. With 14F06, 273 fertile crosses resulted in 78 w+ y- and w- y+ strains; 35 of these are genomic disruptions. With 14H10, 559 fertile crosses resulted in identification of 174 w+ y- and w- y+ strains; 78 of these are genomic disruptions. With 02B10, 204 fertile crosses resulted in identification of 55 w+ y- and w- y+ strains; 25 of these are genomic disruptions.
To determine the extent of the putative deletions in each genomic disruption, the new 5' or 3' hobo insertion points in P{5'wHy} and P{3'wHy} strains were sequenced by iPCR or UFW. Of the 96 genomic disruptions analyzed, 67 unambiguously map to the 54D-55B region and carry single insertions of hobo. Genetic data with the unmapped lines are consistent with disruption of adjacent genomic DNA, but these lines may have multiple hobo insertions or rearrangements that preclude molecular mapping, and thus were excluded from the analysis presented below. The GenBank accession numbers corresponding to the flanking DNA sequence from hobo mapping are provided for each genomic disruption in Table 1 (14F06), Table 2 (14H10), and Table 3 (02B10).
|
|
|
Two observations based on the sequence data support the idea that the genomic disruptions are deletions. First, the hobo flanking sequence is in the orientation expected for a simple deletion. Second, the positions of the putative deletion breakpoints relative to the starting insertion sites are consistent with simple deletions in the direction predicted from the marker gene phenotype (w+ y- or w- y+). Thus, together with the original insertion point of the P{wHy} element, the hobo mapping data indicate the predicted extent of the deletions. The putative deletions range in size from 412 to 377,752 bp (Table 1, Table 2, and Table 3; Fig 2). Together, the deletions extend over >0.5 Mb between CG10936 (![]()
![]()
Genomic disruptions fail to complement previously identified loci in 54D-55B:
If the genomic disruptions are deletions, then they should fail to complement existing mutations in the 54D-55B region in a predictable pattern. Therefore, we tested whether the genomic disruption strains have complementation patterns consistent with deletions of the predicted sizes. Mutations in several previously identified loci were useful for this analysisnamely, the recessive lethal loci grainyhead (grh; ![]()
![]()
![]()
![]()
Some of the genomic disruptions extending distally from 02B10 and 14H10 are predicted to delete grh and thr (Fig 4A). We observe the expected complementation pattern between deletions of specific predicted sizes and mutant alleles of these genes (Fig 4B). Similarly, three deletions extending proximally from 14H10 that are predicted to remove eIF3-S8 (P{3'wHy}14H10Y-51, P{3'wHy}14H10Y-52, and P{3'wHy}14H10Y-53; Table 2) fail to complement the lethality of eIF3-S814F06. The distal breakpoint of the longest deletion, P{5'wHy}14H10W-35, is 1424 bp 3' of the end of the stau coding region and thus is not expected to disrupt stau function (Fig 4A). As expected, the P{5'wHy}14H10W-35 deletion complements stau and eIF3-S814F06 but fails to complement grh, thr, and Df(2R)Pcl7B (![]()
![]()
![]()
![]()
![]()
|
Overlapping deletions define regions required for viability:
We were particularly interested in the region between 14F06 and 02B10, since no previously identified mutations have been associated with the genes in this interval. To test the requirement for specific regions of DNA between 14F06 and 02B10, strains with deletions extending distally from 14F06 and 14H10 were crossed to those with deletions extending proximally from 02B10 and 14H10 (Fig 3A). The gene proximal to the 14H10 insertion (CG6401) is essential, since deletions that extend proximally from 14H10 that disrupt this gene or larger regions (for example, P{3'wHy}14H10Y-39) are inviable in trans to deletions that remove the entire region (Fig 3). No further phenotypic information about the genes between eIF3-S8 and CG6401 can be uncovered because shorter deletions from 14F06 and 14H10 fail to overlap, and longer deletions from 14H10 delete the essential gene eIF3-S8 (Fig 2). A larger sample size of deletions extending from 14F06 toward 14H10 would increase the chance that deletions that overlap to remove genes between CG6401 and eIF3-S8 could be identified.
The most informative analysis was in the region between the 14H10 and 02B10 insertions. As shown in Fig 3, deletions that disrupt HLH54F (![]()
![]()
Overlapping deletions define a region required for female fertility:
In addition to uncovering essential loci, the analysis shows that a locus is required for female fertility in the region between 14H10 and 02B10 (Fig 3). Females with class B deletions are sterile in trans to class III deletions, as are homozygous P{5'wHy}14H10W-15 females and trans-heterozygous P{5'wHy}14H10W-15/P{5'wHy}14H10W-16 females. These females fail to lay eggs, and their ovaries are smaller than those of wild type (data not shown). The locus is limited proximally by P{5'wHy}14H10W-14, the largest class A deletion tested that complements class III deletions for fertility, and distally by P{3'wHy}02B10Y-12, the largest class II deletion that complements class B deletions for fertility (Fig 3). The deletions complement a mutation in haulted, which maps genetically to the 54-55 region (![]()
Mapping anonymous EMS-induced mutations with P{wHy} deletions:
In addition to helping to uncover knockout phenotypes of genes between 14F06 and 02B10, the deletions in our collection have proven useful for molecular mapping of existing lesions that map genetically to the 54D-55B region. We performed complementation analysis between distally extending deletions from 14H10 and 02B10 and strains from a collection of lethal mutations that were isolated in a screen for EMS-induced mutations that fail to complement Df(2R)PC4 [55A1; 55F1-2] (![]()
The l(2)PC4-B, -E, -F, -G, and -M mutations that were tested complement the largest deletion in the region, P{5'wHy}14H10W-35, suggesting that the lesions are distal to stau in 55B. Both l(2)PC4-D202 and l(2)PC4-A139 fail to complement a subset of the P{wHy}-generated deletions (Table 4). The l(2)PC4-A locus is within an
239-kb region, limited proximally by P{5'wHy} 14H10W-34, the longest deletion that complements l(2)PC4-A139, and distally by P{5'wHy}14H10W-35, which fails to complement l(2)PC4-A139 (Table 4; Fig 4). At the level of known and predicted transcripts, this region extends from Black cells to stau and includes many candidate transcription units for the l(2)PC4-A locus. The l(2)PC4-D locus maps to a 24-kb region limited proximally by P{5'wHy}14H10W-25, which complements l(2)PC4-D202, and distally by P{5'wHy}14H10W-27, which fails to complement l(2)PC4-D202 (Table 4; Fig 5). Three transcripts map to this interval: UbcD10, EG:52C10.1, and EG:52C10.2 (![]()
![]()
|
|
| DISCUSSION |
|---|
P{wHy}-generated genomic disruptions behave as deletions:
We mobilized the hobo transposon in P{wHy} insertions in 54E/F to generate genomic disruptions and screened for events that remove flanking genomic DNA proximally or distally from the starting insertion. By mapping the new hobo insertion point, we were able to identify the breakpoint ends of putative deletions. Molecular evidence and results of complementation analyses with eIF3-S814F06 and previously isolated mutations of grh and thr (![]()
![]()
1000 crosses), deletions that extend >0.5 Mb can be identified and recovered.
Overlapping P{wHy}-generated deletions reveal mutant phenotypes:
A subset of the genomic disruptions from 14F06, 14H10, and 02B10 are predicted to remove overlapping regions of DNA (Fig 2). The 14H10 and 02B10 insertions disrupt CG4996 and CG6370, respectively, but are fully viable and fertile. Deletion of CG4996 or CG6370 also has no discernible effect on viability, fertility, or gross morphology (Fig 3). Complementation of class B with class II deletions suggests that the following genes are similarly dispensable: CG10931 and CG5002, which are completely removed in class B/class II animals, and CG6385, which is disrupted in class B/class II animals (Fig 3).
Clearly, these five genes do not provide nonredundant information required for overall survival to adulthood, gross morphology, or fertility. Obviously, tests for more subtle phenotypes need to be applied. Moreover, there is great value in knowing that deletion of a specific gene has no obvious visible lethal or sterile phenotype.
Combining the complementation data with the molecular map also reveals that the regions of DNA required for viability correlate to the eIF3-S8, CG6401, and GH07485 genes (Fig 2 and Fig 3; ![]()
![]()
![]()
![]()
A subset of deletions define a region of DNA required for female fertility. The region is limited proximally by the P{5'wHy}14H10W-14 breakpoint and distally by the P{3'wHy}02B10Y-12 breakpoint. Therefore, it is likely to result from the disruption of CG12298 and/or CG14487 (Fig 3). The CG12298 gene encodes a kinesin-like protein. Conceptual translation of CG14487 reveals no significant similarity to proteins outside of Drosophila, but does show significant similarity to a family of predicted proteins in the fly genome with the closest similarity to the CG12960, CG12961, CG17379, CG17381, CG13582, CG14584, and CG12525 proteins.
In the absence of genomic disruptions that separate these candidate genes, further experiments will be necessary to determine which gene(s) in the region are required for female fertility. Clearly, the set of
70 deletions described is not sufficient to achieve the goal of removing each transcript individually as was accomplished for HLH-54F. This appears to reflect the fact that our initial screen was fairly modest (
1000 chromosomes), rather than reflecting a general limitation of the P{wHy} approach. ![]()
100 deletions from a single starting insertion would be needed to resolve every transcript in a 50-kb region. Thus, a larger-scale screen would likely provide useful reagents for targeting individual transcripts and enable us to limit the region required for fertility to a single transcription unit.
The P{wHy} method complements other methods for gene disruption:
We have shown that P{wHy}-generated deletions from adjacent insertions can be used to remove specific genes. The advantages of this technique include: (1) transposon insertions into intergenic regions are not disadvantageous; (2) a given phenotype can be precisely mapped to a small interval on the genomic DNA independently of gene annotation in the region; (3) conversely, even in the absence of a phenotype, one can be confident that a gene or genes have been deleted; and (4) data for the 54D-55B region suggest that the method provides a relatively efficient approach for determining the mutant phenotypes of all the genes in a specific region.
Like P-element mobilization or PMR (![]()
![]()
50 kb apart), larger screens for genomic disruptions will be necessary, as longer disruptions are less common than shorter ones (this work; ![]()
Combining P{wHy} with other approaches:
The P{wHy} method seems particularly well suited for use in conjunction with EMS screens for mutations that fail to complement a deletion of the region of interest. In this case, we benefited from an EMS screen having been performed with Df(2R)PC4 (![]()
X- and gamma-ray-induced deletions commonly used for EMS screens can often have >100 kb of genomic DNA deleted. This is beyond the
50- to 60-kb region well covered in a P{wHy} screen for deletions from a single starting insertion (![]()
The advantages of combining overlapping P{wHy} deletion analysis with an EMS screen are threefold. First, P{wHy}-generated deletions can be used to determine loss-of-function phenotypes (or lack thereof), assisting a focused effort in screening for EMS-induced mutations. Second, P{wHy} deletions can be used to map EMS-generated mutations to particular regions of the DNA, as shown here for l(2)PC4-A and l(2)PC4-D. Third, the EMS alleles can then provide genetic reagents for analyses such as mosaic analysis that are not feasible with the overlapping P{wHy} deletion approach. Thus, both on its own and in conjunction with other approaches, the P{wHy} strategy for determining complete loss-of-function phenotypes with overlapping deletions can contribute to our understanding of gene function in Drosophila and other organisms.
| ACKNOWLEDGMENTS |
|---|
The authors thank Adam Casterano, Phillip Chan, Madeline Crosby, Francois Huet, Yevgenya Kraytsberg, Todd Martin, Sara McKinley, Jaitra Murthy, and Kyl Myrick for technical support and many helpful discussions. We thank Kathy Matthews at the National Drosophila Stock Center and Christos Samakovlis at Umea University for providing us with mutant strains used for this study. Lastly, thanks go to Ines Alvarez-Garcia and Madeline Crosby for critical review of the manuscript. This work was supported by grant no. R37 GM28669 from the National Institutes of Health to W.M.G.
Manuscript received December 3, 2001; Accepted for publication June 6, 2002.
| LITERATURE CITED |
|---|
ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000 The genome sequence of Drosophila melanogaster.. Science 287:2185-2195.
AGUILERA, M., M. OLIVEROS, M. MARTINEZ-PADRON, J. A. BARBAS, and A. FERRUS, 2000 Ariadne-1: A vital Drosophila gene is required in development and defines a new conserved family of ring-finger proteins. Genetics 155:1231-1244.
ASHBURNER, M., S. MISRA, J. ROOTE, S. LEWIS, and R. BLAZEJ et al., 1999 An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region. Genetics 153:179-219.
BLACKMAN, R. K., R. GRIMAILA, M. M. D. KOEHLER, and W. M. GELBART, 1987 Mobilization of hobo elements residing within the decapentaplegic gene complex: suggestion of a new hybrid dysgenesis system in Drosophila melanogaster. Cell 49:497-505.[Medline]
CALVI, B. R., 1993 The hobo transposable element in Drosophila: evolution, regulation, and use as a genetic tool. Ph.D. Thesis, Harvard University, Cambridge, MA.
COOLEY, L., R. KELLEY, and A. SPRADLING, 1988 Insertional mutagenesis of the Drosophila genome with single P elements. Science 239:1121-1128.
CRIMAUDO, C., M. HORTSCH, H. GAUSEPOHL, and D. I. MEYER, 1987 Human ribophorins I and II: the primary structure and membrane topology of two highly conserved rough endoplasmic reticulum-specific glycoproteins. EMBO J. 6:75-82.[Medline]
D'ANDREA, R. J., R. STRATMANN, C. F. LEHNER, U. P. JOHN, and R. SAINT, 1993 The three rows gene of Drosophila melanogaster encodes a novel protein that is required for chromosome disjunction during mitosis. Mol. Biol. Cell 4:1161-1174.[Abstract]
DUNCAN, I. M., 1982 Polycomblike: a gene that appears to be required for the normal expression of the Bithorax and Antennapedia gene complexes of Drosophila melanogaster.. Genetics 102:49-70.
DYNLACHT, B. D., L. D. ATTARDI, A. ADMON, M. FREEMAN, and R. TJIAN, 1989 Functional analysis of NTF-1, a developmentally regulated Drosophila transcription factor that binds neuronal cis elements. Genes Dev. 3:1677-1688.
EGGLESTON, W. B., D. M. JOHNSON-SCHLITZ, and W. R. ENGELS, 1988 P-M hybrid disgenesis does not mobilize other transposable element families in D. melanogaster.. Nature 331:368-370.[Medline]
ENGLUND, C., A. E. UV, R. CANTERA, L. D. MATHIES, and M. A. KRASNOW et al., 1999 adrift, a novel bnl-induced Drosophila gene, required for tracheal pathfinding into the CNS. Development 126:1505-1514.[Abstract]
FLYBASE,, 1999 The FlyBase database of the Drosophila genome projects and community literature. Nucleic Acids Res. 27:85-88. http://flybase.bio.indiana.edu/(.
FOURNIER, B., J. M. SAUDUBRAY, B. BENICHOU, S. LYONNET, and A. MUNNICH et al., 1994 Large deletion of the peroxisomal acyl-CoA oxidase gene in pseudoneonatal adrenoleukodystrophy. J. Clin. Invest. 94:526-531.
GEORGIAS, C., M. WASSER, and U. HINZ, 1997 A basic-helix-loop-helix protein expressed in precursors of Drosophila longitudinal visceral muscles. Mech. Dev. 69:115-124.[Medline]
HUET, F., J. T. LU, K. V. MYRICK, L. R. BAUGH, and M. A. CROSBY et al., 2002 A deletion-generator compound element allows deletion saturation analysis for genomewide phenotypic annotation. Proc. Natl. Acad. Sci. USA 99:9948-9953.
KANIA, A., A. SALZBERG, M. BHAT, D. D'EVELYN, and Y. HE et al., 1995 P-element mutations affecting embryonic peripheral nervous system development in Drosophila melanogaster. Genetics 139:1663-1678.[Abstract]
KENNERDELL, J. R. and R. W. CARTHEW, 1998 Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled2 act in the Wingless pathway. Cell 95:1017-1026.[Medline]
LASKO, P., 2000 The Drosophila melanogaster genome: translation factors and RNA binding proteins. J. Cell Biol. 150:F51-F56.
LIM, J. K. and M. J. SIMMONS, 1994 Gross chromosome rearrangements mediated by transposable elements in Drosophila melanogaster.. Bioessays 16:269-275.[Medline]
MIYATA, T., J. TAKEDA, Y. IIDA, N. YAMADA, and N. INOUE et al., 1993 The cloning of PIG-A, a component in the early step of GPI-anchor biosynthesis. Science 259:1318-1320.
MYRICK, K. V. and W. M. GELBART, 2002 Universal fast walking for direct and versatile method determination of flanking sequence. Gene 284:125-131.[Medline]
OCHMAN, H., A. S. GERBER, and D. L. HARTL, 1988 Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.
PRESTON, C. R., J. A. SVED, and W. R. ENGELS, 1996 Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144:1623-1638.[Abstract]
ROBERTSON, H. M., C. R. PRESTON, R. W. PHILLIS, D. M. JOHNSON-SCHLITZ, and W. K. BENZ et al., 1988 A stable genomic source of P-element transposase in Drosophila melanogaster. Genetics 118:461-470.
RONG, Y. S. and K. G. GOLIC, 2000 Gene targeting by homologous recombination in Drosophila.. Science 288:2013-2018.
RONG, Y. S. and K. G. GOLIC, 2001 A targeted gene knockout in Drosophila. Genetics 157:1307-1312.
RØRTH, P., K. SZABO, A. BAILEY, T. LAVERTY, and J. REHM et al., 1998 Systematic gain-of-function genetics in Drosophila. Development 125:1049-1057.[Abstract]
RUBIN, G. M., L. HONG, P. BROKSTEIN, M. EVANS-HOLM, and E. FRISE et al., 2000 A Drosophila complementary DNA resource. Science 287:2222-2224.
SCHÜPBACH, T. and E. WIESCHAUS, 1991 Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics 129:1119-1136.[Abstract]
SHEEN, F., J. K. LIM, and M. J. SIMMONS, 1993 Genetic instability in Drosophila melanogaster mediated by hobo transposable elements. Genetics 133:315-334.[Abstract]
SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999 The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177.
ST. JOHNSTON, R. D., D. BEUCHLE, and C. NUSSLEIN-VOLHARD, 1991 staufen, a gene required to localize maternal RNAs in the Drosophila egg. Cell 66:51-63.[Medline]
TRIGLIA, T., M. G. PETERSON, and D. J. KEMP, 1988 A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res. 16:8186.
VOLPE, A. M., H. HOROWITZ, C. M. GRAFER, S. M. JACKSON, and C. A. BERG, 2001 Drosophila rhino encodes a female-specific chromo-domain protein that affects chromosome structure and egg polarity. Genetics 159:1117-1134.
This article has been cited by other articles:
![]() |
K. V. Myrick, F. Huet, S. E. Mohr, I. Alvarez-Garcia, J. T. Lu, M. A. Smith, M. A. Crosby, and W. M. Gelbart Large-Scale Functional Annotation and Expanded Implementations of the P{wHy} Hybrid Transposon in the Drosophila melanogaster Genome Genetics, July 1, 2009; 182(3): 653 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Weiler E(var)3-9 of Drosophila melanogaster Encodes a Zinc Finger Protein Genetics, September 1, 2007; 177(1): 167 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Rusten, L. M.W. Rodahl, K. Pattni, C. Englund, C. Samakovlis, S. Dove, A. Brech, and H. Stenmark Fab1 Phosphatidylinositol 3-Phosphate 5-Kinase Controls Trafficking but Not Silencing of Endocytosed Receptors Mol. Biol. Cell, September 1, 2006; 17(9): 3989 - 4001. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Bellen, R. W. Levis, G. Liao, Y. He, J. W. Carlson, G. Tsang, M. Evans-Holm, P. R. Hiesinger, K. L. Schulze, G. M. Rubin, et al. The BDGP Gene Disruption Project: Single Transposon Insertions Associated With 40% of Drosophila Genes Genetics, June 1, 2004; 167(2): 761 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ryder, F. Blows, M. Ashburner, R. Bautista-Llacer, D. Coulson, J. Drummond, J. Webster, D. Gubb, N. Gunton, G. Johnson, et al. The DrosDel Collection: A Set of P-Element Insertions for Generating Custom Chromosomal Aberrations in Drosophila melanogaster Genetics, June 1, 2004; 167(2): 797 - 813. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mohr, S. E.
- Articles by Gelbart, W. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mohr, S. E.
- Articles by Gelbart, W. M.






