- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sandal, N.
- Articles by Stougaard, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sandal, N.
- Articles by Stougaard, J.
A Genetic Linkage Map of the Model Legume Lotus japonicus and Strategies for Fast Mapping of New Loci
Niels Sandala, Lene Krusella, Simona Radutoiua, Magdalena Olbryta, Andrea Pedrosab, Silke Strackec, Shusei Satod, Tomohiko Katod, Satoshi Tabatad, Martin Parniskec, Andreas Bachmairb, Tina Ketelsena, and Jens Stougaardaa Laboratory of Gene Expression, Department of Molecular and Structural Biology, University of Aarhus, DK-8000 Aarhus C, Denmark,
b Department of Cell Biology and Genetics, University of Vienna, A-1030 Vienna, Austria,
c Sainsbury Laboratory, John Innes Centre, Norwich NR4 7UH, United Kingdom
d Kazusa DNA Research Institute, Kisarazu, Chiba, 292-0812, Japan
Corresponding author: Niels Sandal, Department of Molecular and Structural Biology, University of Aarhus, Gustav Wieds Vej 10, DK-8000 Aarhus C, Denmark., sandal{at}biobase.dk (E-mail)
Communicating editor: V. SUNDARESAN
| ABSTRACT |
|---|
A genetic map for the model legume Lotus japonicus has been developed. The F2 mapping population was established from an interspecific cross between L. japonicus and L. filicaulis. A high level of DNA polymorphism between these parents was the source of markers for linkage analysis and the map is based on a framework of amplified fragment length polymorphism (AFLP) markers. Additional markers were generated by restriction fragment length polymorphism (RFLP) and sequence-specific PCR. A total of 524 AFLP markers, 3 RAPD markers, 39 gene-specific markers, 33 microsatellite markers, and six recessive symbiotic mutant loci were mapped. This genetic map consists of six linkage groups corresponding to the six chromosomes in L. japonicus. Fluorescent in situ hybridization (FISH) with selected markers aligned the linkage groups to chromosomes as described in the accompanying article by ![]()
THE legume family (Leguminoseae) is one of the largest families of the angiosperms. It includes several important crop plants producing protein and oil for human consumption and animal fodder. Cultivation of legumes is favored by their independence of external supply of nitrogen fertilizers and for many species by their ability to grow in poor soils. Part of this pioneer behavior stems from the genetic predisposition to develop endosymbiosis with nitrogen-fixing bacteria belonging to several genera including Rhizobium, Bradyrhizobium, and Mesorhizobium (![]()
![]()
![]()
![]()
![]()
New possibilities for genetic studies in the L. japonicus model legume have recently opened as a result of the genome sequencing initiative and the espressed sequence tag (EST) sequencing programs started on L. japonicus (![]()
![]()
![]()
432 Mb (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Amplified fragment length polymorphism (AFLP) marker technology (![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Plant material:
The inbred L. japonicus B-129-S9 Gifu germplasm is described by ![]()
![]()
![]()
The L. filicaulis plant used in the cross had not been selfed in several generations in our laboratory. Therefore we included five individual L. filicaulis plants in our AFLP analysis in addition to the one used for the cross. We never observed differences in AFLP pattern between the individual L. filicaulis plants. So the level of heterozygosity in the L. filicaulis plant used for crossing is very low and markers would not be expected to segregate within L. filicaulis.
Progeny of the L. japonicus Gifu cross to L. filicaulis have reduced fertility. Plants in the F1 and the F2 generations produce 15 seeds per pod compared to the 1520 seeds produced by the parents.
RAPD:
The PCR program used for randomly amplified polymorphic DNA (RAPD; ![]()
AFLP:
AFLP was performed according to ![]()
Specific bases on AFLP primers were E31, AAA; E32, AAC; E33, AAG; E34, AAT; E35, ACA; E36, ACC; E37, ACG; E38, ACT; E39, AGA; E43, ATA; E44, ATC; E45, ATG; E46, ATT; M31, AAA; M34, AAT; M40, AGC; M41, AGG; M44, ATC; M45, ATG; M50, CAT; M51, CCA; M57, CGG; M58, CGT; M59, CTA; M60, CTC; M61, CTG; and M62, CTT.
For rapid mapping the following primer combinations are recommended: E32M44, E33M40, E33M58, E34M59, E34M61, E37M50, and E46M41.
RFLP:
Five micrograms of genomic DNA from each of the 165 plants of the mapping population was digested with EcoRI, EcoRV, HindIII, XbaI, or BamHI and used for genomic Southern blots. To identify RFLPs, a corresponding parental filter was tested before hybridization on the population filters. The filters were stored at -20° and stripped in boiling 0.1% SDS before hybridization with the next probe.
RFLP probes from pea were Chs2 (![]()
![]()
![]()
L. japonicus RFLP probes used were Nin (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Gene-specific markers:
The sequence of a number of gene fragments was determined on PCR fragments from both parents. Sequence differences [single nucleotide polymorphisms (SNPs) or size differences] were used to design specific primers and the specific PCR conditions were determined experimentally. For some of the genes it was possible to develop codominant cleaved amplified polymorphic sequence (CAPS) markers (![]()
![]()
- The following primers were used [listed by gene name, L. japonicus EST accession number, forward primer, reverse primer, restriction enzyme, codominant (cod.), or L. filicaulis (fil.) or L. japonicus Gifu specificity]:
- 2,3aldo2, gi-7745577 AV416397, GCTGCCAAGTTACAGGGGTGACAATGTG, CTGTCGTAGTCATGATCGAATGCTCAGG, SspI;
- Ca-ATPase, AV420121, GATGCCCCAGCCCTGCATGAAGCAG, TGCAAGAGCAAGTGCTCCCAGGGTG, MseI;
- GTPase, AV426691, AV410879, AV428898, AW720321, AV409846, AV419535, AV428102, ACGATCAGATACCGTCCTAGTCTCAACC, CTGTCAGACACTCCGAGTGTACCCTCAC, cod.;
- Myo1, AW720674, AW719358, AW164058, GAGATATTCATGGGTGGAAAGAACACA, CAGGAGCCAATCCAACACAAGCTCTCAG, HpaII;
- Myo2, AU089593, AU089207, GAGATATTCATGGGTGGAAAGAACACC, CTGGTGGAACAAGAGGAGCCTTGGTCAA, MseI;
- Rer, AV427249, AV423094, AV421125, CTCTTGATCGGGTTTCTTTCACCTCTC, AGCAATATTGGCCAGAAGACAGGAACA, ApoI;
- Sdd, AV420480, CCAAGCTTCACCAACCCTTCAATTCTCAAAC, TCACATTTCCTGCTCCAATAGCAAAAACACC, BstUI;
- AN1, ACTTCATGCTATGTGGCGACT, CACAGCTGTCCTTGAAAATGA, cod.;
- M37RsaI, GAGAACTGGGGAAAAACGCAGCAGTAG, CCCTTGCTGCTGTCATCATCCTTCTTGGTCGCGAGCTCCT, RsaI;
- Cyc1, CAGGAGAAGCTGATGGTGAACACATTG, CGTATCTGAGATGGAGGGAACTTCAGC, cod.;
- Cyc2, GACCGCAAGCTCACCAAACC, AGTATGATTCCATCATGCTATCC, Gifu;
- SO, TCGACGGATCATCATCGGTGCCGGCGTC, TCGACGAGAGCGTGAATGA, fil.;
- Nlp1, GAGGAGCTTCTTGTGATTCATG, CCTGATTATGGGGGATGGTG Gifu, CCTGATTATGGGGGATGGTT fil.;
- Nlp2, CCCATTTTGTAATTTGAATCTCG, GATAATGATGAGGTTGTTGAACT Gifu, GAATGATGAGGTTGTTGAATG fil.;
- Imp, GGAAAGCCCCTATTTGGTACTC, GCAGTCACAGCCATACAATGG, cod.;
- Caj, TAAGGCATTTACTCTATA, CACTGGGATCCAAGTTTTTT, fil.;
- 50I19, CTTTCCATCATTGCCGCCAC, CATGTTGAGTTGCTATGATTTTT, fil.
Microsatellite markers:
TM markers polymorphic between L. japonicus ecotypes Gifu and Miyakojima for each of the sequenced TAC clones were used for mapping (![]()
Map calculation and map drawing:
Joinmap version 2.0 for Apple computers (![]()
![]()
![]()
BAC clones:
BAC clones used for in situ experiments were isolated from a library of 32,000 clones made from a BamHI partial digest of L. japonicus Gifu DNA (N. SANDAL, N. ELLIS and J. STOUGAARD, unpublished results).
| RESULTS |
|---|
DNA polymorphism between ecotypes and diploid Lotus species:
The highly inbred L. japonicus B-129-S9 Gifu germplasm (![]()
![]()
![]()
![]()
![]()
Development of an interspecific L. filicaulis x L. japonicus linkage map:
On the basis of the high level of polymorphism, a cross to L. filicaulis was used to develop the linkage map. A mapping population of 165 F2 plants was raised and when necessary maintained by propagation of cuttings. DNA was extracted from the 165 F2 plants and markers were generated primarily by AFLP but also by RFLP, RAPD, and sequence-specific PCR. In the AFLP analysis, up to 45 polymorphic loci were detected per primer combination. An example of an AFLP gel resolving 19 markers is shown in Fig 1. In total, 524 AFLP markers generated from 26 primer combinations were included in the present linkage map shown in Fig 2. The general linkage map includes 3 additional anonymous RAPD markers. Gene-specific markers corresponding to known genes were produced by RFLP and sequence-specific PCR (Fig 2 and Fig 3). A total of 23 RFLP markers were mapped by scoring Southern blots (EcoRI, HindIII, BamHI, XbaI, or EcoRV) hybridized with gene or cDNA probes. The 18 sequence-specific PCR markers were developed from L. japonicus EST and genomic sequences. The corresponding sequences from L. filicaulis were determined and sequence differences were used to develop dominant parent-specific SNP markers or codominant microsatellite/deletion markers. In a few cases codominant CAPS markers were generated using parent-specific restriction enzyme recognition sites. In addition, as part of the L. japonicus genome sequencing program, a number of microsatellite markers (TM markers) were developed for mapping in an intraspecific cross between L. japonicus ecotypes Gifu and Miyakojima (![]()
|
|
|
|
Initially seven linkage groups were defined by the genetic analysis, but after combining the linkage analysis with the cytogenetic chromosome characterization (![]()
![]()
Linkage groups:
The primary result of our mapping compiled by the Joinmap program was seven linkage groups, IA, IB, II, III, IV, V, and VI, one group more than expected to account for six chromosomes in L. japonicus. The assignment of markers to map positions and the construction of linkage groups was therefore checked manually using colormapping (![]()
![]()
![]()
The genome-wide alignment of the linkage groups to chromosomes and the FISH approach used for the analysis is described in the accompanying article by ![]()
Variation in marker segregation ratios along the chromosomes:
A high level of DNA polymorphism is an advantage for detection of DNA-based markers but differences in DNA sequence also negatively influence the chromosome pairing and the frequency of meiotic recombination. In our mapping population the observed segregation of markers from the L. japonicus and L. filicaulis parents illustrates this paradox. Segregation of the parent-specific dominant AFLP markers close to the expected ratio (3:1) is observed only in certain sections of the genetic map, while very distorted segregation is observed in other sections. See Fig 4 for an overview of the segregation of AFLP markers along the six chromosomes. Apart from linkage group III, where Gifu alleles are overrepresented, there is generally an overrepresentation of L. filicaulis alleles. In linkage group IV both L. japonicus and L. filicaulis alleles are represented above 75%, indicating a selection for heterozygosity. A very distorted segregation was found for markers in linkage group I. Normal segregation was observed for markers at the chromosome ends but internally on chromosome 1 there is a very strong overrepresentation of the L. filicaulis alleles, culminating around 77 cM, where only 1 heterozygous plant out of 165 plants carried the L. japonicus allele. Judged from the almost symmetrical and gradual decrease in L. japonicus alleles toward the 77 cM position, a strong selection for one or more L. filicaulis allele(s) present here appears to occur. In an attempt to determine possible causes of this distortion we raised an F2 population of the reciprocal cross L. japonicus Gifu x L. filicaulis. Distorted segregation in the same region of chromosome 1 indicated that the observed distortion was independent of maternal and paternal effects.
|
Local clustering of AFLP markers, indicative of reduced recombination frequency, was observed in all six linkage groups and judged from the position, some clusters might well be in the centromeric region of the chromosomes. One exception was a cluster of AFLP markers in linkage group III in a position corresponding to the short arm of chromosome 3. Chromosome analysis in L. japonicus and L. filicaulis demonstrated an inversion comprising this region (![]()
![]()
Judged from the degree of marker resolution, the extent of distorted marker segregation, and the relation between physical and genetic distances, we believe that map-based cloning of genes located in the following chromosomal regions can be approached in the L. filicaulis x L. japonicus Gifu cross: (a) two regions each covering
10 cM from the ends of chromosome 1; (b) a region of
30 cM covering the long arm of chromosome 2; (c) a region of
25 cM covering the long arm of chromosome 3; (d) a region of
20 cM covering the long arm of chromosome 4; (e)
55 cM covering chromosome 5 and
55 cM covering chromosome 6. This estimate covers a total of 205 cM or 56% of the map length (Fig 3).
Fast mapping of new loci:
The advantage of L. filicaulis as a mapping partner is its very high level of polymorphism. In practice this makes it easy to map genes with known sequence. Furthermore, it is possible to scan the genome for markers linked to genetic loci, e.g., sym loci, by running only a fraction of the AFLP reactions that would be needed for one of the ecotypes mentioned above. In Fig 5 we have shown the genome coverage of molecular markers obtained by only three AFLP primer combinations (E32M44, E34M61, and E37M50) in the interspecific L. filicaulis x L. japonicus Gifu F2 population. Scanning with a few such primer combinations would quickly map a new locus to a chromosomal region and higher resolution mapping can then be accomplished with additional markers covering this section of the general linkage map. In MATERIALS AND METHODS we have listed seven primer combinations that are useful for rapid mapping. Prescreening for cosegregation with one of the PCR markers shown in Fig 3, followed by higher resolution mapping with AFLP markers in the region, in some cases could be simpler and faster. We report here 51 sequence-specific PCR markers distributed over most of the chromosome arms.
|
Mapping of mutant loci:
The AFLP markers available for rapid mapping as outlined in Fig 5 enable efficient mapping of mutant loci with bulked segregant analysis (MICHELMORE et al. 1997). However, distorted segregation may influence the efficiency and ease of mapping mutant loci onto the linkage map and complicate map-based cloning. To investigate the feasibility of map-based cloning using L. filicaulis as wild-type partner, we mapped and followed the segregation of three symbiotic mutant loci, Ljsym1 (![]()
![]()
![]()
![]()
![]()
Segregation of the non-nodulating Ljsym5 mapped to chromosome 2 was less distorted, namely, 60 wild-type to 7 mutants (9:1). The number of mutant plants is still low, and to investigate whether loci disturbing segregation could be segregated away, progeny from individual heterozygous plants were tested for segregation of Ljsym5 mutants. Out of 16 heterozygous Sym5/sym5 plants tested, 3 showed normal segregation, 21:7, 42:16, and 29:8, respectively. These heterozygous F2 plants can now be used to develop large mapping populations for identification of closely linked markers and fine mapping.
The hypernodulating Ljhar1-3 locus segregated 1796 wild-type to 689 mutants (2.6:1) and behaved as a recessive monogenic trait. The Ljhar1-3 locus mapped to chromosome 3 (Fig 2 and Fig 3) in a region with normal segregation and this has enabled fast progress in cloning the Ljhar1-3 hypernodulating locus (L. KRUSELL, unpublished results). The analysis of these three Sym loci supports the estimate of chromosomal regions where map-based cloning is possible using a L. filicaulis cross.
Mapping of symbiosis-related genes and genes assigned by genome sequencing:
One of the interests in L. japonicus is the study of endosymbiosis with Mesorhizobium loti and mycorrhizal fungi. A well-developed genetic map containing map data on both symbiotic mutant loci and genes expressed during endosymbiosis would therefore be an asset for the system. Using ESTs or genomic sequences we have mapped a number of mainly nodule-expressed genes onto the map by RFLP analysis. The position of these genes is shown in Fig 2 and Fig 3. The L. japonicus leghemoglobin (Lb) genes are clustered in one area of linkage group V. This is in contrast to other legumes where the Lb genes are found on more than one chromosome. The map positions of the different nodulation-related genes do not correspond to any of the mapped sym mutant loci.
The Nin gene, which is necessary for nodule inception (![]()
![]()
The first release of sequences from the L. japonicus genome sequencing program consists of 56 randomly selected TAC clones covering 5.4 Mb of the genome. From this sequence information, 56 mainly codominant markers (TM markers) were developed for mapping the sequenced TAC clones in a Gifu x Miyakojima population (![]()
330 genes can be directly assigned a map position by their presence on a mapped TAC.
| DISCUSSION |
|---|
We have used AFLP, RFLP, RAPD, and sequence-specific gene and microsatellite markers to develop a genetic linkage map for L. japonicus. The highly polymorphic species L. filicaulis was used as a crossing partner, allowing fast mapping of sequenced genes and rapid scanning for markers linked to genetic loci as illustrated in Fig 5. In total, 524 dominant AFLP markers, 3 RAPD markers, 23 gene-specific RFLP markers, and 51 gene-/sequence-specific PCR markers were mapped. The sequence-specific markers position
370 known or predicted genes. The total length of the genetic map is 367 cM. We estimate that map-based cloning is possible in regions covering 56% of the linkage map length. In the accompanying article by ![]()
![]()
![]()
![]()
![]()
![]()
For genes located in regions with very distorted segregation, map-based cloning will not be possible with the L. filicaulis cross and a cross to, e.g., ecotype Miyakojima will be more useful. It is now possible to predict from a linked marker position which of the crossing partners will be advantageous for fine mapping and map-based cloning of that particular trait (Fig 3). Without prior knowledge of map position we recommend establishing mapping populations using both L. filicaulis and Miyakojima.
AFLP mapping with EcoRI/MseI primers often gives clustering of markers. The same clustering has not been seen with PstI/MseI AFLP (![]()
![]()
![]()
![]()
![]()
![]()
![]()
In Fig 3 we have indicated the chromosomal regions where genetic mapping will be most informative and where map-based cloning should be possible with L. filicaulis-based mapping populations. The feasibility of positional cloning was confirmed for the Ljsym5 and Ljhar1-3 loci where map-based cloning and molecular characterization are progressing rapidly. Plants of L. japonicus and L. filicaulis differ in several morphological markers (![]()
In this perspective gene identification in crop legumes using genetic map information and genome data from more amenable model legumes is within reach. Agriculturally important traits such as seed development and pod dehiscence, for example, could be studied taking advantage of the genetic map and the straight L. japonicus seed pods giving easy access to the developing seeds.
| ACKNOWLEDGMENTS |
|---|
We thank M. Kawaguchi and W. F. Grant for providing seeds and N. Ellis, C. Kistner, M. Koyama, and our colleagues at the Laboratory of Gene Expression, University of Aarhus, for additional probes and primer information. M. Vinther and S. Rye are thanked for assistance. A.P. was supported by a grant from the Conselho Nacional de Desenvolvimento Científico e Tecnológico/Brazil (200249/99-1). The work was supported by the Österreichische Nationalbank grant P7172 to D.S. and, in part, by the grant S8211 from the Austrian Science Foundation. L.K. was supported by Direktoratet for FoedevareErhverv (KUL97-3) and the Danish Agricultural and Veterinary Research Council (53-00-0223). M.O. was supported by the EU Socrates program. S.R. was supported by an EU Marie-Curie Fellowship (QLK5-CT-2000-51222).
Manuscript received January 28, 2002; Accepted for publication May 13, 2002.
| LITERATURE CITED |
|---|
ALONSO-BLANCO, C., A. J. M. PEETERS, M. KOORNNEEF, C. LISTER, and C. DEAN et al., 1998 Development of an AFLP based linkage map of Ler, Col and Cvi Arabidopsis thaliana ecotypes and construction of a Ler/Cvi recombinant inbred line population. Plant J. 14:259-271.[Medline]
ASAMIZU, E., M. WATANABE, and S. TABATA, 2000 Large scale structural analysis of cDNAs in the model legume, Lotus japonicus.. J. Plant Res. 113:451-455.
BORG, S., B. BRANDSTRUP, T. J. JENSEN, and C. POULSEN, 1997 Identification of new protein species among 33 different small GTP-binding proteins encoded by cDNAs from Lotus japonicus, and expression of corresponding mRNA in developing root nodules. Plant J. 11:237-250.[Medline]
BORG, S., L. PØDENPHANT, T. J. JENSEN, and C. POULSEN, 1999 Plant cell growth and differentiation may involve GAP regulation of Rac activity. FEBS Lett. 453:341-345.[Medline]
BORISOV, A. Y., E. M. BARMICHEVA, L. M. JACOBI, V. E. TSYGANOV, and V. A. VOROSHILOVA et al., 2000 Pea (Pisum sativum L.) Mendelian genes controlling development of nitrogen-fixing nodules and arbuscular mycorrhiza. Czech J. Genet. Plant Breed. 36:106-110.
CHRISTIANSEN, H., A. C. HANSEN, I. VIJN, N. PALLISGAARD, and K. LARSEN et al., 1996 A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter. Plant Mol. Biol. 32:809-821.[Medline]
CYRANOSKI, D., 2001 Japanese legume project may help to fix nitrogen problem. Nature 409:272.[Medline]
FISHMAN, L., A. J. KELLY, E. MORGAN, and J. H. A. WILLIS, 2001 A genetic map in the Mimulus guttatus species complex reveals transmission ratio distortion due to heterospecific interactions. Genetics 159:1701-1716.
FLEMETAKIS, E., N. KAVROULAKIS, N. E. M. QUAEDVLIEG, H. P. SPAINK, and M. DIMOU et al., 2000 Lotus japonicus contains two distinct ENOD40 genes that are expressed in symbiotic, nonsymbiotic, and embryonic tissues. Mol. Plant-Microbe Interact. 13:987-994.[Medline]
GRANT, W. F., M. R. BULLEN, and D. DE NETTANCOURT, 1962 The cytogenetics of Lotus. I. Embryo-cultured interspecific diploid hybrids closely related to L. corniculatus L. Can. J. Genet. Cytol. 4:105-128.
GRESSHOFF, P. M., D. LOHAR, C. ZAHARIA, S. RADUTOIU, I. PETRISOR et al., 2000 Lateral root and early nodule genes trapped by promoterless gus in Lotus japonicus, p. 61 in Molecular Genetics of Model Legumes: Impact for Legume Biology and Breeding, edited by M. PARNISKE and N. ELLIS. Keely Print, Beccles, Norwich, UK.
HAANSTRA, J. P. W., J. WYE, H. VERBAKEL, F. MEIJER-DEKENS, and P. VAN DEN BERG et al., 1999 An integrated high-density RFLP-AFLP map of tomato based on two Lycopersicum esculentum x L. pennellii F2 populations. Theor. Appl. Genet. 99:254-271.
HANDBERG, K. and J. STOUGAARD, 1992 Lotus japonicus, an autogamous, diplod legume species for classical and molecular genetics. Plant J. 2:487-496.
HARKER, C. L., T. H. ELLIS, and E. S. COEN, 1990 Identification and genetic regulation of the chalcone synthase multigene family in pea. Plant Cell 2:185-194.
HAYASHI, M., A. MIYAHARA, S. SATO, T. KATO, and M. YOSHIKAWA et al., 2001 Construction of a genetic linkage map of the model legume Lotus japonicus using an intraspecific F2 population. DNA. Res. 8:301-310.[Abstract]
HOFER, J., L. TURNER, R. HELLENS, M. AMBROSE, and P. MATTHEWS et al., 1997 UNIFOLIATA regulates leaf and flower morphogenesis in pea. Curr. Biol. 7:581-587.[Medline]
IMAIZUMI-ANRAKU, H., M. KAWAGUCHI, H. KOIWA, S. AKAO, and K. SYONO, 1997 Two ineffective-nodulating mutants of Lotus japonicus: different phenotypes caused by the blockage of endocytotic bacterial release and nodule maturation. Plant Cell Physiol. 38:871-881.
JENCZEWSKI, E., M. GHERARDI, I. BONNIN, J. M. PROSPERI, and I. OLIVIERI et al., 1997 Insight on segregation distortion in two intraspecific crosses between species of Medicago (Leguminosae). Theor. Appl. Genet. 94:682-691.
JIANG, Q. and P. M. GRESSHOFF, 1997 Classical and molecular genetics of the model legume Lotus japonicus. Mol. Plant-Microbe Interact. 10:59-68.[Medline]
KAWAGUCHI, M., 2000 Lotus japonicus Miyakojima MG-20: an early-flowering accession suitable for indoor handling. J. Plant Res. 113:507-509.
KISS, G. B., A. KERESZT, P. KISS, and G. ENDRE, 1998 Colormapping: a non-mathematical procedure for genetic mapping. Acta Biol. Hungarica 49:125-142.
KONIECZNY, A. and F. M. AUSUBEL, 1993 A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR based markers. Plant J. 4:403-410.[Medline]
LYTTLE, T. W., 1991 Segregation distorters. Annu. Rev. Genet. 25:511-557.[Medline]
MICHELMORE, R. W., I. PARAN, and R. V. KESSELI, 1991 Identification of markers linked to disease resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions using segregating populations. Proc. Natl. Acad. Sci. USA 88:9828-9832.
NEFF, M. M., J. D. NEFF, J. CHORY, and A. E. PEPPER, 1998 dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J. 14:387-392.[Medline]
PEDROSA, A., N. SANDAL, J. STOUGAARD, D. SCHWEIZER, and A. BACHMAIR, 2002 Chromosomal map of the model legume Lotus japonicus. Genetics 161:1661-1672.
ROBERTS, N. J., J. BRINGHAM, B. WU, J. B. MURPHY, and H. VOLPIN et al., 1999 A Nod factor-binding lectin is a member of a distinct class of apyrases that may be unique to the legumes. Mol. Gen. Genet. 262:261-267.[Medline]
SATO, S., T. KANEKO, Y. NAKAMURA, E. ASAMIZU, and T. KATO et al., 2001 Structural analysis of a Lotus japonicus genome. I. Sequence features and mapping of fifty-six TAC clones which cover the 5.4 Mbp regions of the genome. DNA Res. 8:311-318.[Abstract]
SCHAUSER, L., L. CHRISTENSEN, S. BORG, and C. POULSEN, 1995 PZF, a cDNA isolated from Lotus japonicus and soybean root nodule libraries, encodes a new member of the RING-finger family of zinc-binding proteins. Plant Physiol. 107:1457-1458.[Medline]
SCHAUSER, L., K. HANDBERG, N. SANDAL, J. STILLER, and T. THYKJÆR et al., 1998 Symbiotic mutants deficient in nodule establishment identified after T-DNA transformation of Lotus japonicus.. Mol. Gen. Genet. 259:414-423.[Medline]
SCHAUSER, L., A. ROUSSIS, J. STILLER, and J. STOUGAARD, 1999 A plant regulator controlling development of symbiotic root nodules. Nature 402:191-195.[Medline]
SCHULTZE, M. and A. KONDOROSI, 1998 Regulation of symbiotic root nodule development. Annu. Rev. Genet. 32:33-57.[Medline]
STAM, P., and J. W. VAN OOIJEN, 1995 Joinmap, version 2.0: software for the calculation of genetic linkage maps. CPRO-DLO, Wageningen, The Netherlands.
STILLER, J., L. MARTIRANI, S. TUPPALE, R.-J. CHIAN, and M. CHIURAZZI et al., 1997 High frequency transformation and regeneration of transgenic plants in the model legume Lotus japonicus.. J. Exp. Bot. 48:1357-1365.
STOUGAARD, J., 2001 Genetics and genomics of root symbiosis. Curr. Opin. Plant Biol. 4:328-335.[Medline]
STOUGAARD, J. and P. R. BEUSELINCK, 1996 Registration of GIFU B-129S9 Lotus japonicus germplasm. Crop Sci. 36:476.
SZCZYGLOWSKI, K., R. S. SHAW, J. WOPEREIS, S. COPELAND, and D. HAMBURGER et al., 1998 Nodule organogenesis and symbiotic mutants of the model legume Lotus japonicus.. Mol. Plant-Microbe Interact. 11:684-697.
THYKJÆR, T., D. DANIELSEN, Q. SHE, and J. STOUGAARD, 1997 Organization and expression of genes in the genomic region surrounding the glutamine synthetase Gln1 from Lotus japonicus.. Mol. Gen. Genet. 255:628-636.[Medline]
TURNER, S. R., R. HELLENS, R. IRELAND, N. ELLIS, and S. RAWSTHORNE, 1993 The organisation and expression of the genes encoding the mitochondrial glycine decarboxylase complex and serine hydroxymethyltransferase in pea (Pisum sativum). Mol. Gen. Genet. 236:402-408.[Medline]
VOORRIPS, R., 2001 Mapchart, version 2.0: Windows software for the graphical presentation of linkage maps and QTLs. Plant Research International, Wageningen, The Netherlands.
VOS, P., R. HOGERS, M. BLEEKER, M. REIJANS, and T. VAN DE LEE et al., 1995 AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23:4407-4414.
VUYLSTEKE, V., R. MANK, R. ANTONISE, E. BASTIAANS, and M. L. SENIOR et al., 1999 Two high-density AFLP linkage maps of Zea mays L.: analysis of distribution of AFLP markers. Theor. Appl. Genet. 99:921-935.
WEBB, K. J., L. SKØT, M. N. NICHOLSON, B. JØRGENSEN, and S. MIZEN, 2000 Mesorhizobium loti increases root-specific expression of a calcium-binding protein homologue identified by promoter tagging in Lotus japonicus.. Mol. Plant-Microbe Interact. 13:606-616.[Medline]
WEGEL, E., L. SCHAUSER, N. SANDAL, J. STOUGAARD, and M. PARNISKE, 1998 Mycorrhiza mutants of Lotus japonicus define genetically independent steps during symbiotic infection. Mol. Plant-Microbe Interact. 11:933-936.
WILLIAMS, J. G. K., A. R. KUBELIK, K. J. LIVAK, J. A. RAFALSKI, and S. V. TINGEY, 1990 DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531-6535.
WOPEREIS, J., E. PAJUELO, F. B. DAZZO, Q. JIANG, and P. M. GRESSHOFF et al., 2000 Short root mutants of Lotus japonicus with a dramatically altered symbiotic phenotype. Plant J. 23:97-114.[Medline]
YOUNG, W. P., J. M. SCHUPP, and P. KEIM, 1999 DNA methylation and AFLP marker distribution in the soybean genome. Theor. Appl. Genet. 99:785-790.
This article has been cited by other articles:
![]() |
X. Wang, S. Sato, S. Tabata, and S. Kawasaki A High-density Linkage Map of Lotus japonicus Based on AFLP and SSR Markers DNA Res, October 1, 2008; 15(5): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sato, Y. Nakamura, T. Kaneko, E. Asamizu, T. Kato, M. Nakao, S. Sasamoto, A. Watanabe, A. Ono, K. Kawashima, et al. Genome Structure of the Legume, Lotus japonicus DNA Res, August 1, 2008; 15(4): 227 - 239. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanamori, L. H. Madsen, S. Radutoiu, M. Frantescu, E. M. H. Quistgaard, H. Miwa, J. A. Downie, E. K. James, H. H. Felle, L. L. Haaning, et al. From The Cover: A nucleoporin is required for induction of Ca2+ spiking in legume nodule development and essential for rhizobial and fungal symbiosis PNAS, January 10, 2006; 103(2): 359 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Krusell, K. Krause, T. Ott, G. Desbrosses, U. Kramer, S. Sato, Y. Nakamura, S. Tabata, E. K. James, N. Sandal, et al. The Sulfate Transporter SST1 Is Crucial for Symbiotic Nitrogen Fixation in Lotus japonicus Root Nodules PLANT CELL, May 1, 2005; 17(5): 1625 - 1636. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. VandenBosch and G. Stacey Summaries of Legume Genomics Projects from around the Globe. Community Resources for Crops and Models Plant Physiology, March 1, 2003; 131(3): 840 - 865. [Full Text] [PDF] |
||||
![]() |
A. Y. Borisov, L. H. Madsen, V. E. Tsyganov, Y. Umehara, V. A. Voroshilova, A. O. Batagov, N. Sandal, A. Mortensen, L. Schauser, N. Ellis, et al. The Sym35 Gene Required for Root Nodule Development in Pea Is an Ortholog of Nin from Lotus japonicus Plant Physiology, March 1, 2003; 131(3): 1009 - 1017. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pedrosa, N. Sandal, J. Stougaard, D. Schweizer, and A. Bachmair Chromosomal Map of the Model Legume Lotus japonicus Genetics, August 1, 2002; 161(4): 1661 - 1672. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sandal, N.
- Articles by Stougaard, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sandal, N.
- Articles by Stougaard, J.





) and L. japonicus Gifu (
) along the different linkage groups (IVI). Position is given in centimorgans. The expected level of marker occurrence (75%) is indicated.




