Genetics, Vol. 161, 1453-1464, August 2002, Copyright © 2002

Loss of Ypk1 Function Causes Rapamycin Sensitivity, Inhibition of Translation Initiation and Synthetic Lethality in 14-3-3-Deficient Yeast

Daniel Gelperin1,a, Lynn Hortonb, Anne DeChanta, Jack Hensoldb,c, and Sandra K. Lemmona
a Department of Molecular Biology and Microbiology, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106
b Department of Medicine, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106
c Department of Medicine, Cleveland Veterans Affairs Medical Center, Cleveland, Ohio 44106

Corresponding author: Sandra K. Lemmon, Case Western Reserve University, 10900 Euclid Ave., Cleveland, OH 44106-4960., skl{at}po.cwru.edu (E-mail)

Communicating editor: B. J. ANDREWS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

14-3-3 proteins bind to phosphorylated proteins and regulate a variety of cellular activities as effectors of serine/threonine phosphorylation. To define processes requiring 14-3-3 function in yeast, mutants with increased sensitivity to reduced 14-3-3 protein levels were identified by synthetic lethal screening. One mutation was found to be allelic to YPK1, which encodes a Ser/Thr protein kinase. Loss of Ypk function causes hypersensitivity to rapamycin, similar to 14-3-3 mutations and other mutations affecting the TOR signaling pathway in yeast. Similar to treatment with rapamycin, loss of Ypk function disrupted translation, at least in part by causing depletion of eIF4G, a central adaptor protein required for cap-dependent mRNA translation initiation. In addition, Ypk1 as well as eIF4G protein levels were rapidly depleted upon nitrogen starvation, but not during glucose starvation, even though both conditions inhibit translation initiation. These results suggest that Ypk regulates translation initiation in response to nutrient signals, either through the TOR pathway or in a functionally related pathway parallel to TOR.


THE 14-3-3 proteins are a highly conserved family of abundant ~30-kD proteins found in all eukaryotes (FU et al. 2000 Down). They bind to target proteins upon phosphorylation within a 14-3-3 binding motif and serve as effectors of Ser/Thr phosphorylation (MUSLIN et al. 1996 Down; YAFFE et al. 1997 Down; FU et al. 2000 Down; YAFFE and ELIA 2001 Down). 14-3-3 proteins are best known for their roles in signal transduction pathways, including those regulating cell cycle and checkpoint control, cell survival, and growth (see YAFFE and CANTLEY 1999 Down; BALDIN 2000 Down; FU et al. 2000 Down and references therein). However, 14-3-3's have been implicated in a wide variety of other processes, such as regulation of ADP ribosylation of small GTPases (FU et al. 1993 Down), nitrate reductase (MOORHEAD et al. 1996 Down), neurotransmitter biosynthesis (ICHIMURA et al. 1987 Down), the cytoskeleton (LIAO and OMARY 1996 Down), secretion (MORGAN and BURGOYNE 1992 Down; SKOULAKIS and DAVIS 1996 Down; ROTH et al. 1999 Down), and mitochondrial protein import (ALAM et al. 1994 Down).

Saccharomyces cerevisiae has two 14-3-3 isoforms, encoded by BMH1 and BMH2 (GELPERIN et al. 1995 Down; VAN HEUSDEN et al. 1995 Down). The proteins are 92% identical, although Bmh1p is the predominant form, accounting for >=75% of 14-3-3 in a yeast cell (GARRELS et al. 1994 Down; GELPERIN et al. 1995 Down). Deletion of either BMH1 or BMH2 alone does not affect cell growth, but the double deletion is lethal in most strain backgrounds (GELPERIN et al. 1995 Down; VAN HEUSDEN et al. 1995 Down; ROBERTS et al. 1997 Down).

In budding yeast, 14-3-3's have been implicated in a number of processes as well (see VAN HEMERT et al. 2001 Down for review), although the direct target(s) of 14-3-3 proteins in many of these pathways is still not known. One of the known specific roles of yeast 14-3-3's is as downstream effectors in the rapamycin-sensitive target of rapamycin (TOR) pathway (BERTRAM et al. 1998 Down; BECK and HALL 1999 Down). TOR is a Ser/Thr kinase that plays a central role in the integration of nutrient status inputs with growth control in yeast, as well as mammalian cells (SCHMELZLE and HALL 2000 Down; GINGRAS et al. 2001 Down; RAUGHT et al. 2001 Down). Treatment of yeast cells with rapamycin leads to a growth arrest resembling that in starved cells or cells entering stationary phase (BARBET et al. 1996 Down). Associated with this is a rapid inhibition of protein synthesis (BARBET et al. 1996 Down), one of the most energy-consuming processes in the cell (WARNER 1999 Down), and a concomitant inhibition of tRNA and ribosomal biogenesis (ZARAGOZA et al. 1998 Down; CARDENAS et al. 1999 Down; HARDWICK et al. 1999 Down; POWERS and WALTER 1999 Down). In addition, rapamycin induces autophagy (NODA and OHSUMI 1998 Down; KAMADA et al. 2000 Down) and transcription of starvation and stress response genes (BARBET et al. 1996 Down; BECK and HALL 1999 Down; CARDENAS et al. 1999 Down; HARDWICK et al. 1999 Down), and it affects the turnover of nutrient permeases (SCHMIDT et al. 1998 Down; BECK et al. 1999 Down). TOR is encoded by two genes in yeast, TOR1 and TOR2 (KUNZ et al. 1993 Down; HELLIWELL et al. 1994 Down). Loss of TOR function resembles the phenotype of cells treated with rapamycin, although TOR2 also has a second rapamycin-independent essential function (KUNZ et al. 1993 Down; HELLIWELL et al. 1994 Down; ZHENG et al. 1995 Down; BARBET et al. 1996 Down; SCHMIDT et al. 1996 Down). The 14-3-3's function downstream of TOR by binding and retaining the stress-responsive transcription factors Msn2p and Msn4p in the cytoplasm (BECK and HALL 1999 Down). Upon rapamycin treatment Msn2 and -4p dissociate from 14-3-3's and are released into the nucleus (BECK and HALL 1999 Down).

To uncover pathways and factors regulated by 14-3-3 proteins in yeast we sought mutations in genes that cause sensitivity to reduced 14-3-3 levels by the synthetic lethal screening technique. This screen identified a hypomorphic allele of YPK1, which encodes a Ser/Thr protein kinase. Here we show that loss of Ypk function leads to hypersensitivity to rapamycin and inhibition of translation initiation. Further analysis suggests that Ypk1p may play a role upstream of TOR or in a functionally overlapping pathway parallel to TOR.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains used and genetic methods:
Strains used in this study are listed in Table 1. Genetic methods were performed essentially as in GUTHRIE and FINK 1991 Down. Yeast extract peptone dextrose (YEPD) and synthetic selective dropout media were prepared as described in NELSON and LEMMON 1993 Down. YEPD + 3% formamide medium and other sensitivity media were prepared as described in HAMPSEY 1997 Down. Rapamycin was dissolved in ethanol and added to YEPD medium at indicated concentrations. Yeast transformations were performed by the method of GIETZ et al. 1992 Down.


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains used in this study

Plasmid construction:
Plasmids were propagated in Escherichia coli DH5{alpha} and are listed in Table 2. Construction of plasmids for this study was as follows: pDG45 (BMH2, CEN, TRP1) was created by cloning a 4.2-kb KpnI-ClaI fragment containing BMH2 from a genomic library plasmid into pRS314 (SIKORSKI and HIETER 1989 Down). pDG46 (BMH2, CEN, ADE2, URA3) was created in two steps. First, a 2238-bp ADE2 fragment from pASZ11 (STOTZ and LINDER 1990 Down) was cloned into the SmaI site of pRS316 (SIKORSKI and HIETER 1989 Down). Second, a 4.2-kb KpnI-ClaI fragment containing BMH2 was ligated into the KpnI and ClaI sites. pDG53 (LEU2, YPK1) was generated by cloning a 3.7-kb BglII-XhoI YPK1 fragment into the BamHI-XhoI sites of the LEU2 integrating vector, pRS305 (SIKORSKI and HIETER 1989 Down). pDG54 (YPK1, 2µ, URA3) contains the 3.7-kb BglII-XhoI YPK1 fragment cloned into the BamHI-XhoI sites of pRS426 (CHRISTIANSON et al. 1992 Down). pDG56 (CEN, ADE3, TRP1, BMH1) was created by cloning a 5.5-kb BamHI-SalI fragment containing ADE3 into pJW42 (described in GELPERIN et al. 1995 Down). pDG58 (BMH2, CEN, URA3) was created by cloning a 3721-bp SacI-XbaI fragment containing BMH2 into pRS316. pDG59 (BMH1, 2µ, URA3) contains a 3.2-kb EcoRI-KpnI fragment of BMH1 cloned into pRS426. pDG60 (BMH1, CEN, URA3) was created by cloning a 3205-bp EcoRI-KpnI fragment containing BMH1 into pRS316. The plasmid for expression of Ypk1p tagged at the C terminus with a triple HA epitope (pAD1) was made by cotransformation of pDG54 (YPK1, 2µ, URA3) and a PCR product encoding the triple HA tag followed by the His3Mx6 gene and flanked by 52 bp upstream and 55 bp downstream of the stop codon of YPK1. The PCR product was made with primers 5'-GCAACCTTTACTACAGCTAGGTAGCTCAATGGTGCAAGGTAGAAGCATTAGACGGATCCCCGGGTTAATTAA-3' and 5'-CGAAATATAAATCCTAGAACTTAAATTGCGCCATTGGTACAGTTGCTTCATCTTGGAATTCGAGCTCGTTTAAAC using pFA6a-3HA-His3Mx6 (LONGTINE et al. 1998 Down) as a template.


 
View this table:
In this window
In a new window

 
Table 2. Plasmids used in this study

Synthetic lethal screens:
Two synthetic lethal screens were carried out. The first was performed with bmh1-{Delta} using the ade2 ade3/ade2 ADE3 red/white colony sectoring method (BENDER and PRINGLE 1991 Down). A bmh1-{Delta} ade2 ade3 strain, which forms white colonies, was transformed with a centromeric BMH1, ADE3, TRP1 plasmid (pDG56) to generate SL2631. Complementation of ade3 leads to red colony formation due to the residual ade2 mutation. However, this strain is able to lose the BMH1 plasmid to yield red colonies with white sectors (sector+). Colonies arising from mutants that have an increased requirement for BMH1 will lose the plasmid at a reduced rate and appear sector- (mostly or completely red). SL2631 was mutagenized by exposure to UV to 10–30% viability. After 3 days of incubation at 30° in the dark, ~60,000 colonies were visually screened for a sector- phenotype. Twenty-one sector- candidates were identified after restreaking. Candidates were transformed with a CEN, URA3, BMH1 plasmid (pDG58) and 17 candidates unable to become sector+ were discarded. To identify recessive mutations, candidates were mated to SL2647 and tested for sectoring. All candidate heterozygous diploids tested sector+. The resulting diploids were sporulated and dissected. One candidate did not have 2:2 segregation of sector- to sector+ and was discarded. To sort the remaining three candidates into complementation groups, mutants were crossed to each other and the diploids were scored for sectoring. Each candidate was also crossed to a bmh1-{Delta} bmh2-{Delta} tester strain (SL2830) to identify mutations unable to complement a bmh2-{Delta} mutation. One candidate was unable to complement the bmh1-{Delta} bmh2-{Delta} tester strain and was presumed to be due a mutation in BMH2. This candidate was not studied further. The other two candidates were designated bms1-1 and bms2-1 for bmh-sensitive. These mutants were then backcrossed three times to the parental strain before further characterization. bms2-1 had a relatively weak sector- phenotype and has not been further characterized.

A second synthetic lethal screen with bmh2-{Delta} was performed using the ade2/ADE2 sectoring method to follow plasmid loss essentially as described in WHITE and JOHNSON 1997 Down. A bmh2-{Delta} ade2 strain was transformed with pDG46 carrying BMH2 on an ADE2, URA3 plasmid to yield SL2136. This strain grew as white colonies with red sectors (sector+) and nonsectoring mutant candidates appeared white (sector-). SL2136 was mutagenized with methane sulfonic acid ethyl ester (EMS; GUTHRIE and FINK 1991 Down) to 25–30% viability and grown on YEPD plates at 30° at a density of 200–300 colonies per plate. Approximately 96,000 colonies were visually screened for a sector- phenotype. Eighteen sector- colonies that retained their sector- phenotype upon restreaking were identified. Candidates were then transformed with a TRP1, BMH2, CEN plasmid (pDG45) and the empty vector (pRS314) to ensure that they were able to become sector+ when an independent BMH2 plasmid was supplied. Nine candidates either remained sector- in the presence of pDG45 or became sector+ in the presence of the empty TRP1 vector and were eliminated. The nine remaining mutant candidates were mated to an ade2 bmh2-{Delta} strain of the opposite mating type (SL2067) and the diploids were tested for sectoring. Recessive mutants with a sector+ phenotype after crossing were subjected to tetrad analysis. Six candidates failed to segregate as single locus mutations, one candidate was judged to be too sick to pursue further, and one was unable to sporulate as a heterozygous diploid and was discarded. The remaining candidate, bms3-1 (ypk1-2, see below), was analyzed further. This candidate was backcrossed three times to the parental strain SL2136 before use in further studies.

Cloning bmh synthetic mutations:
Cloning of the wild-type gene for bms1-1, which causes temperature-sensitive growth, is described elsewhere (GELPERIN et al. 2001 Down). The bms3-1 mutant grew at all temperatures, but was found to grow poorly on 3% formamide when it was tested for increased sensitivity to a number of different ions and inhibitors (see HAMPSEY 1997 Down for conditions tested). Therefore, to clone the wild-type BMS3 gene, the bms3-1 strain, SL2331, was transformed with a YEp13-based genomic library (MATSUURA and ANRAKU 1993 Down) and transformants were selected directly onto C-LEU + 3% formamide plates. One library plasmid was able to rescue both the formamide sensitivity and the sector- phenotype of SL2331. Both ends of the genomic library insert were sequenced using primers flanking the insert cloning site. The minimal complementing region was identified by subcloning and retesting sectoring and formamide sensitivity in SL2331. The complementing open reading frame was found to be YPK1.

YPK1 gene deletion and confirmation that bms3-1 is allelic to YPK1:
YPK1 was deleted in SL1528 using pL272 (CHEN et al. 1993 Down) digested with Pvu2 to generate a ypk1-{Delta}::TRP1 deletion fragment. Correct integration was confirmed by Southern blotting and haploid segregants containing the ypk1-{Delta}:TRP1 allele were generated by tetrad analysis.

To confirm that the bms3-1 mutation is allelic to YPK1, pDG53 (YIp-YPK1) was linearized within YPK1 with NsiI and transformed into SL2331 [bmh2-{Delta}::HIS3 bms3-1 + pDG56 (BMH2)]. Proper integration was confirmed by Southern blot. Resulting integrants were mated to a bmh2-{Delta} BMS3 strain (SL2136) and sporulated for tetrad analysis. Spore segregants were scored for colony sectoring and for growth on YEPD + 3% formamide. No sector- or formamide-sensitive spores were found in 24 tetrads (combined data of two independent integrants), demonstrating that the mutation responsible for increased dependence on BMH2 was in YPK1.

Fractionation of ribosomes:
All procedures were performed at 4° except where indicated. Yeast cells from 50 ml of midlog-phase culture were pelleted, resuspended in 5 ml ice-cold 100 µg/ml cycloheximide (Calbiochem, La Jolla, CA) for 1 min, and repelleted. Lysates were made by glass bead lysis for 4 min, with intermittent cooling on ice, in 1.0 ml polysome buffer [PB; 100 mM KCl, 2 mM magnesium acetate, 20 mM HEPES (pH 7.4), 14.4 mM ß-mercaptoethanol, 100 µg/ml cycloheximide]. The cell lysate was centrifuged at 5000 rpm for 8 min in a microcentrifuge and the supernatant was removed. Five to 10 A254 units were loaded onto a 16.2-ml 10–50% sucrose gradient containing 100 mM KCl, 5 mM MgCl2, 20 mM HEPES (pH 7.4), and 2 mM dithiothreitol and centrifuged in a Beckman SW28.1 rotor at 27,000 rpm for 4.5 hr. Gradients were collected with continuous monitoring at 254 nm using an ISCO UA-5 absorbance detector and 1640 gradient collector.

Immunoblots:
To examine eIF4G stability in the ypk-ts (YPT40) and the control ypk2-{Delta} (YES1) strains, cells were grown to midlog phase in YEPD at 25° and a zero time sample was harvested. Then cells were washed and inoculated into fresh YEPD prewarmed to 37° at 0.25 x 107 cells/ml. At each time point before and after the shift to 37°, 1 x 108 cells were harvested and washed in dH2O and the final cell pellet was frozen in a microcentrifuge tube at -80°. Samples were thawed and resuspended in 0.4 ml PB supplemented with 1 mM phenylmethylsulfonyl fluoride and a protease inhibitor cocktail prepared as described previously (STEPP et al. 1995 Down). Glass beads (0.4 g) were added and samples were vortexed on high for 5 x 1 min with icing in between. Extracts were centrifuged at 2700 x g for 8 min at 4° and the supernatant was recovered. Samples (0.1 A254 units) were separated on SDS polyacrylamide gels and proteins were transferred to nitrocellulose. Blots were stained with amido black to confirm equal protein loading, blocked in 5% milk in 1x Tris-buffered saline plus 0.1% Tween-20, and immunoblotted for indicated proteins.

For experiments examining the effect of starvation on Ypk1p, eIF4G, and eIF4E, a wild-type strain, SL1462, was transformed with pAD1 (YPK1-HA, 2µ) and grown to midlog phase in complete synthetic medium lacking histidine plus 2% glucose (C-HIS). A zero time cell sample was harvested. Remaining cells were washed in dH2O and resuspended at 0.25 x 107 cells/ml in normal growth medium (C-HIS, not shown), synthetic yeast nitrogen base medium minus ammonium sulfate and amino acids plus 2% glucose (nitrogen starvation medium), or C-HIS minus glucose (glucose starvation). At each time point 1 x 108 cells were harvested and washed one time with dH2O and pellets were frozen. For extraction, pellets were resuspended in 0.5 ml of a lysis buffer containing 50 mM Tris (pH 8.0), 1.5 mM MgCl2, 150 mM NaCl, protease inhibitors (see above), and phosphatase inhibitors (50 mM NaF, 1 mM NaVO4). Cells were lysed by addition of glass beads to 40% of the cell volume and by vortexing as described above. Lysates were spun at 4000 x g at 4° for 10 min. Extract samples (0.5 A254 units) were separated on SDS gels and prepared for immunoblotting as described above.

Primary antibodies used for immunoblots were: rabbit anti-eIF4G (1:2000) and rabbit anti-eIF4E (1:2000; gifts of Alan Sachs); mouse anti-Rpl3 monoclonal antibody (1:5000; gift of J. Warner); rabbit anti-Apm3p (1:5000; PANEK et al. 1997 Down); and rat anti-HA monoclonal antibody 3F10 (1:5000; Roche Molecular Biochemicals). Rabbit primary antibodies were detected with goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP; Zymed, South San Francisco, CA); anti-Rpl3p antibody was detected with a goat anti-mouse antibody conjugated to HRP (Kirkegaard & Perry); and the anti-HA rat monoclonal was detected with HRP-conjugated rabbit anti-rat IgG (Zymed). Immunoblots were developed using enhanced chemiluminescence (Amersham). For quantification, films from exposures in the linear range were scanned and analyzed using NIH Image.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Identification of 14-3-3 synthetic lethal mutants and cloning of the genes:
To identify pathways regulated by 14-3-3 proteins, we screened for mutants that are hypersensitive to reduced levels of 14-3-3 using a synthetic lethal approach. Starting strains were deleted for only one of the two 14-3-3 genes, and thus we screened for mutants that have impaired function in the absence of one 14-3-3 gene, even though the other one is present. Four complementation groups were identified that had an increased requirement for the presence of BMH1 and/or BMH2 (see MATERIALS AND METHODS for details). One mutation from the screen for bmh1-{Delta} synthetic lethal mutants failed to complement a bmh2-{Delta} mutation, implying that the mutation was in BMH2. A bmh2 mutation was expected from this screen, since bmh1-{Delta} bmh2-{Delta} cells are lethal in most genetic backgrounds (GELPERIN et al. 1995 Down; VAN HEUSDEN et al. 1995 Down).

Another mutation, bms1-1, causes temperature-sensitive growth on its own, with a restrictive temperature of 34°–35° (not shown). This mutation is not completely lethal in the presence of bmh1-{Delta} or bmh2-{Delta}, but the combined mutations lead to synergistic growth defects at the bms1-1 semipermissive temperatures of 30° and 32°, with the effect of bmh1-{Delta} being more severe than that of bmh2-{Delta} (not shown). We cloned BMS1 by complementation of its temperature-sensitive phenotype and showed that the gene corresponds to YPL217c, a previously uncharacterized open reading frame (reported in GELPERIN et al. 2001 Down). YPL217c/BMS1 is an essential gene that encodes a novel GTP-binding protein of the nucleolus that is required for an early step in 40S ribosomal subunit biogenesis (GELPERIN et al. 2001 Down; WEGIERSKI et al. 2001 Down). The mutant in the third complementation group, bms2-1, had a weaker sector- phenotype, was not sensitive to any media conditions tested, and will be characterized at a later date.

The fourth mutant, bms3-1, was obtained from the screen for mutations causing increased sensitivity to loss of BMH2. This mutant was not completely lethal in the presence of bmh2-{Delta}, but it exhibited a greatly reduced rate of BMH2 plasmid sectoring (Fig 1A). In a BMH2 strain, bms3-1 had a slight slow growth phenotype at all temperatures tested and was found to be highly sensitive to 3% formamide (data not shown). Formamide sensitivity was used to clone the BMS3 gene, and it was found to be identical to YPK1, which encodes a serine/threonine protein kinase most related to mammalian serum and glucocorticoid inducible kinase (SGK) and Akt/PKB (CHEN et al. 1993 Down; CASAMAYOR et al. 1999 Down). Integrative transformation and segregation analysis confirmed that bms3-1 is allelic to YPK1 (see MATERIALS AND METHODS); therefore, we hereafter refer to bms3-1 as ypk1-2.



View larger version (67K):
In this window
In a new window
Download PPT slide
 
Figure 1. Synthetic growth defect of ypk1 combined with 14-3-3 deletions. (A) Clockwise from top are SL2331 [ypk1-2 bmh2-{Delta} ade2 + pDG46 (pBMH2 ADE2)]; SL2136 [bmh2-{Delta} ade2 + pDG46 (pBMH2 ADE2)]; and SL2334 (SL2331 without plasmid). Cells were streaked onto YEPD and grown at 30° for 3 days to show the sectoring phenotypes. (B) A bmh1-{Delta}/BMH1 ypk1-{Delta}/YPK1 strain (SL1388 x SL2545) was sporulated and tetrads were dissected. Numbers of viable and inviable spores of each genotype from 24 tetrads are indicated.

A null mutation of YPK1 was generated in our genetic background, and the growth and formamide sensitivity phenotypes of the haploid mutants were identical to those of ypk1-2. Consistent with this, a cross of a ypk1-{Delta} mutant to a bmh2-{Delta} strain yielded slow-growing viable double-mutant spore progeny (not shown), similar to the leaky phenotype of ypk1-2 (bms3-1) in the sectoring assay (Fig 1). A second Ypk-related kinase is encoded by YPK2 (also referred to as YKR2; KUBO et al. 1989 Down; CHEN et al. 1993 Down). Similar to previous studies (CHEN et al. 1993 Down; CASAMAYOR et al. 1999 Down), we found that ypk2-{Delta} mutants grow well, but the double ypk1-{Delta} ypk2-{Delta} mutants are inviable (not shown). We also found that ypk1-2 ypk2-{Delta} double mutants are inviable. Thus, no differences between the ypk1-2 and ypk1-{Delta} alleles were observed, suggesting that ypk1-2 may be a complete loss-of-function allele.

Since ypk1-2 was synthetically sick with bmh2-{Delta} we tested whether ypk1 mutants are also synthetically sick or lethal with bmh1-{Delta}. SL1388 (bmh1-{Delta}) was crossed to SL2545 (ypk1-{Delta}) and subjected to tetrad analysis. We observed moderate levels of spore death in ypk1-{Delta}::TRP1 BMH1 spores (16 viable Trp+ spores from 21 expected) but complete lethality of ypk1-{Delta} bmh1-{Delta} spores (0 recovered from 24 expected) in 24 tetrads dissected (Fig 1B). Therefore, ypk1-{Delta} strains are sensitive to loss of either 14-3-3 gene and are more compromised in the absence of BMH1. This is likely due to the higher expression of Bmh1p relative to that of Bmh2p, which results in lower levels of 14-3-3 proteins in bmh1-{Delta} mutants than in bmh2-{Delta} mutants (GARRELS et al. 1994 Down; GELPERIN et al. 1995 Down).

As ypk1-2 and bms1-1 mutants are sensitive to reduction of 14-3-3 levels we asked if overexpression of 14-3-3 would suppress ypk1-2 or bms1-1 growth defects. Overexpression of either BMH1 or BMH2 did not affect the growth phenotypes of ypk1-{Delta} or bms1-1 strains at various temperatures from 25° to 37° (not shown).

ypk1 mutants are hypersensitive to rapamycin:
14-3-3 proteins have been demonstrated to play a role in rapamycin-sensitive TOR pathway signaling in yeast (BERTRAM et al. 1998 Down; BECK and HALL 1999 Down; CHAN et al. 2000 Down). Deletions of BMH1 or BMH2 cause hypersensitivity to rapamycin, while overexpression of BMH1 or BMH2 causes rapamycin resistance (BERTRAM et al. 1998 Down; CHAN et al. 2000 Down). Therefore, we examined whether ypk1 or bms1-1 mutants had altered sensitivity to rapamycin. We found that ypk1-2 and ypk1-{Delta} mutants were hypersensitive to rapamycin, while bms1-1 mutants were similar to wild-type strains (Fig 2). bmh1-{Delta} and bmh2-{Delta} strains had moderate sensitivity to rapamycin, as previously reported (BERTRAM et al. 1998 Down; CHAN et al. 2000 Down), but this was less severe than that seen for ypk1 mutants (Fig 2). This suggested that Ypk1p may be involved in the rapamycin-sensitive TOR signaling pathway.



View larger version (88K):
In this window
In a new window
Download PPT slide
 
Figure 2. ypk1 but not bms1 mutants are sensitive to rapamycin. Equal numbers of log-phase cells and a fivefold dilution of wild-type (SL1463), bmh1-{Delta} (SL1386), bmh2-{Delta} (SL1320), bms1-1 (SL3246), ypk1-2 (SL3365), and ypk1-{Delta} (SL2545) cultures were spotted onto YEPD containing 0, 10, or 50 nM rapamycin and grown at 25° for 2 days.

To explore the relationships among Ypk, 14-3-3 proteins, and the TOR pathway in more detail we first examined whether YPK1 overexpression could bypass rapamycin sensitivity of bmh mutants or wild-type cells and whether BMH overexpression could rescue ypk1-{Delta}. Overexpression of BMH1 or BMH2 could not suppress the rapamycin sensitivity of a ypk1-{Delta} strain, while the wild-type YPK1 complemented the phenotype as expected (see Fig 3, 10 nM rapamycin). Increased dosage of the 14-3-3's was able to suppress the growth inhibition of a wild-type strain grown at higher concentrations of rapamycin (50 nM, not shown, or 100 nM rapamycin, Fig 3), consistent with previous studies (BERTRAM et al. 1998 Down), but YPK1, 2µ could not bypass this rapamycin sensitivity (Fig 3). We also found that YPK1 expressed from a 2µ plasmid could not rescue bmh1-{Delta} or bmh2-{Delta} rapamycin sensitivity (not shown).



View larger version (73K):
In this window
In a new window
Download PPT slide
 
Figure 3. Overexpression of BMH1 or BMH2 does not suppress the rapamycin sensitivity of ypk1-{Delta} and YPK1 overexpression does not confer rapamycin resistance to wild-type cells. SL1462 (wt) or SL4235 (ypk1-{Delta}) were transformed with the indicated plasmids, streaked onto YEPD or YEPD containing various concentrations of rapamycin, and grown for 3 (YEPD) or 4 (rapamycin plates) days at 30°. Plasmids are: pRS426 (2µ, empty vector), pYPK1 (pDG54/YPK1, 2µ), pBMH1 (pDG59/BMH1, 2µ), and pBMH2 (pJW18/BMH2, 2µ). Note that overexpression of BMH genes, but not YPK1, also suppressed the wild-type strain at 50 nM rapamycin.

Yeast PKH1 and PKH2 are a partially redundant essential gene pair encoding protein kinases related to mammalian PDK1, which is known to activate the Ypk-related kinases PKB/Akt and SGK as well as a number of other kinases (BELHAM et al. 1999 Down; CASAMAYOR et al. 1999 Down; INAGAKI et al. 1999 Down; VANHAESEBROECK and ALESSI 2000 Down). Recent studies have linked Pkh1p and Ypk1p to common signaling pathways (SUN et al. 2000 Down; DEHART et al. 2002 Down; SCHMELZLE et al. 2002 Down) and Pkh1p can directly phosphorylate and activate Ypk1p in vitro (CASAMAYOR et al. 1999 Down). These studies suggest that Pkh functions upstream of Ypk, although other work indicates that Ypk is not the only target of Pkh (INAGAKI et al. 1999 Down). Therefore we examined whether an isogenic pair of pkh1-{Delta} and pkh2-{Delta} mutants are hypersensitive to rapamycin. We found that growth of the pkh1-{Delta} strain, but not pkh2-{Delta}, is inhibited at 20 nM rapamycin (Fig 4), suggesting Pkh1p also functions with Ypk in the pathway affected by rapamycin.



View larger version (116K):
In this window
In a new window
Download PPT slide
 
Figure 4. ypk1-ts ypk2-{Delta} and pkh1-{Delta} but not ypk2-{Delta} or pkh2-{Delta} cells are hypersensitive to rapamycin. Strains ypk1-1ts ypk2-{Delta} (YPT40) and ypk2-{Delta} (YES1), tor1-{Delta} (MH480) and TOR1 (MH281), and pkh1-{Delta} (AC301) and pkh2-{Delta} (AC303) are isogenic pairs. Strains were streaked onto YEPD or YEPD with indicated concentrations of rapamycin and grown for 4 days at 25°.

We also found that a strain carrying a deletion of the second YPK gene, ypk2-{Delta}, is not hypersensitive to rapamycin, as compared to an isogenic ypk-ts strain containing both a ypk1-1ts allele and the ypk2 deletion grown at a permissive growth temperature (Fig 4). These and the pkh results could indicate that the functions of the two Ypk or two Pkh proteins are not completely overlapping. More likely, Pkh1p and Ypk1p provide sufficient activity to confer rapamycin resistance even in the absence of their related counterparts, Pkh2p and Ypk2p, respectively. Consistent with this, the rapamycin sensitivity of the ypk-ts mutant is dependent upon its ypk2-{Delta} mutation (not shown).

Further tests showed that the overexpression of TOR2 or a rapamycin-resistant allele of TOR2 (TOR2-1r) could suppress the rapamycin sensitivity of ypk1-{Delta} (Fig 5) or a ypk-ts mutant (not shown). This indicates that the ypk mutant strains are sensitive to rapamycin because of inhibition of TOR and not because of a nonspecific effect of rapamycin unrelated to TOR. However, TOR overexpression could not suppress the inviability of the ypk-ts strain at its nonpermissive growth temperature (not shown), suggesting that Ypk has essential functions independent of TOR.



View larger version (108K):
In this window
In a new window
Download PPT slide
 
Figure 5. Overexpression of YPK1 does not suppress rapamycin hypersensitivity of tor1-{Delta}. tor1-{Delta} (MH480) or ypk1-{Delta} (SL4235) strains were transformed with the indicated plasmids, streaked onto YEPD or YEPD with different concentrations of rapamycin, and grown for 3 days at 30°. Plasmids are pRS426 (2µ, empty vector), pYPK1 (pDG54/YPK1, 2µ), pBMH1 (pDG59/BMH1, 2µ), pBMH2 (pJW18/BMH2, 2µ), pTOR2 (pJK3-3/TOR2, 2µ), and pTOR2-1r (pJK12/pTOR2-1 rapamycin-resistant allele, 2µ).

We next tested whether YPK1 overexpression could suppress the rapamycin sensitivity of a tor1-{Delta} strain. The tor1-{Delta} strain (note that tor2-{Delta} is inviable) was hypersensitive to rapamycin at concentrations as low as 10 nM rapamycin (Fig 4 and Fig 5). Overexpression of BMH genes could partially suppress the rapamycin sensitivity of tor1-{Delta} (Fig 5), consistent with previous studies and the known role of Bmh proteins downstream of TOR (BERTRAM et al. 1998 Down; BECK and HALL 1999 Down). In contrast to 14-3-3, neither YPK1 overexpression (Fig 5) nor PKH1 overexpression (not shown) could suppress the tor1-{Delta} rapamycin hypersensitivity phenotype, suggesting that they are not downstream of TOR. Supporting this, we found no difference in the kinase activity of Ypk1p isolated from cells treated with and without rapamycin (data not shown).

Ypkp-deficient cells are defective in initiation of translation:
One of the major roles of the TOR signaling pathway is to regulate translation in response to nutrients (SCHMELZLE and HALL 2000 Down; GINGRAS et al. 2001 Down). Rapamycin treatment, starvation, or inactivation of both TOR genes lead to arrest of translation initiation (BARBET et al. 1996 Down; DI COMO and ARNDT 1996 Down). Therefore, we examined whether Ypk-deficient cells exhibit a translation initiation defect. Polysome analysis revealed a shift in the polyribosome peaks to those with only one to three ribosomes per mRNA in ypk1-{Delta} cells, compared with wild-type cells in which there was a significant pool of polyribosomes with >=4–5 per translation complex (Fig 6A). This phenotype was more dramatic in the ypk-ts strain (ypk1-1ts ypk2-{Delta}; Fig 6B). At 24° the polysome profile was normal. Upon shift of ypk-ts to 37° for 4 hr there was a nearly complete loss of polysomes and a dramatic increase in the 80 S monosome peak, while the isogenic ypk2-{Delta} control strain yielded normal polyribosome profiles after shift to 37° (Fig 6B).



View larger version (17K):
In this window
In a new window
Download PPT slide
 
Figure 6. Ypk-deficient yeast is defective in translation initiation. (A) Polysome profiles from congenic wt (SL1462) and ypk1-{Delta} (SL4235) strains grown at 30° in YEPD are shown. (B) Polysome profiles from isogenic ypk2-{Delta} (YES1) and ypk-ts (ypk1-1ts ypk2-{Delta}, YPT40) strains grown at 25° or shifted to 37° for 4 hr are shown.

A key regulator of 5' cap-dependent mRNA translation initiation is eIF4G, which is a major component of the cap-binding complex and serves as an anchor for assembly of other initiation factors, including eIF4E and poly(A)-binding protein, onto mRNA (DEVER 1999 Down; SACHS and VARANI 2000 Down). Recent studies have shown that eIF4G protein is rapidly degraded upon treatment with rapamycin or during shift to diauxic growth, while eIF4E and eIF4A remain stable (BERSET et al. 1998 Down; POWERS and WALTER 1999 Down; KURUVILLA et al. 2001 Down). This suggests eIF4G stability is regulated by TOR and perhaps other nutrient signaling pathways. We therefore tested whether loss of Ypk function affects the stability of eIF4G (Fig 7). By 2 hr after shift of the ypk-ts strain to 37° there was nearly a 10-fold decrease in eIF4G protein levels and by 4 hr the translation initiation factor had completely disappeared. In contrast, eIF4E showed only a slight gradual decline, such that by the 4-hr time point ~50% of initial eIF4E levels remained, possibly due to destabilization in the absence of its eIF4G scaffold protein. In the isogenic ypk2-{Delta} strain containing a normal YPK1 gene, eIF4G and eIF4E were stable after shift to 37°. The rapid disappearance of eIF4G in the ypk-ts strain was not due to a general effect on translation or protein stability, as levels of Apm3p, a component of the AP-3 adaptor complex, or a ribosomal protein, Rpl3p, remained constant after shift to the nonpermissive temperature (Fig 7 and not shown). These results indicate that loss of Ypk function leads to translation initiation arrest, at least in part due to depletion of eIF4G.



View larger version (55K):
In this window
In a new window
Download PPT slide
 
Figure 7. eIF4G is depleted in ypk-ts cells at 37°. Isogenic ypk2-{Delta} (YES1) and ypk-ts (ypk1-1ts ypk2-{Delta}, YPT40) strains were grown at 25° and shifted to 37°. Equal numbers of cells were removed at 0, 1, 2, and 4 hr after the shift and processed for immunoblotting with antibodies to eIF4G, eIF4E, and Apm3p as described in MATERIALS AND METHODS. Similar to Apm3p, the ribosomal protein, Rpl3p, was also stable throughout the time course (not shown).

Although eIF4G declines upon rapamycin treatment or nutrient deprivation associated with diauxic growth (BERSET et al. 1998 Down), it is not depleted by glucose starvation, which rapidly inhibits translation initiation (MARTINEZ-PASTOR and ESTRUCH 1996 Down; ASHE et al. 2000 Down). We therefore tested whether Ypk1p was affected by nutritional starvation. We found that nitrogen starvation caused a rapid depletion of Ypk1, while in the absence of glucose, Ypk1 levels were stable (Fig 8). eIF4G protein levels paralleled the Ypk1 results, with depletion during nitrogen starvation, but not during glucose starvation. eIF4E and the cytosolic control protein, Apm3p, were generally stable under both conditions. Since both nitrogen starvation and glucose deprivation inhibit protein synthesis, the selective loss of Ypk1 and eIF4G are not merely the result of inhibition of translation, but rather specific responses to the nitrogen status of the cell. This suggests that Ypk may be a component of a nutrient-sensing pathway that regulates translation through eIF4G.



View larger version (60K):
In this window
In a new window
Download PPT slide
 
Figure 8. Ypk1p is depleted upon shift to nitrogen starvation conditions, but not during glucose starvation. A log-phase culture of SL1462 transformed with pAD1 (pYPK1-HA) was grown at 30° in C-HIS and then shifted to nitrogen starvation medium or glucose starvation medium. Cells were harvested at times indicated and extracts were prepared for immunoblot analysis as described in MATERIALS AND METHODS. Blots were probed with antibodies to HA to detect Ypk1-HA, anti-eIF4G, anti-eIF4E, and anti-Apm3p. All proteins were stable if maintained on normal C-HIS medium (not shown).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

To identify processes and pathways that are affected by 14-3-3, we performed synthetic lethal screens on the two 14-3-3 genes in S. cerevisiae, BMH1 and BMH2. We anticipated we might identify mutants specific for either Bmh1p or Bmh2p or mutants that would be hypersensitive to 14-3-3 dosage. Since Bmh1p is expressed at levels three- to fourfold higher than those of Bmh2p (GARRELS et al. 1994 Down; GELPERIN et al. 1995 Down), we expected to find higher sensitivity to loss of BMH1 than to loss of BMH2. This was found to be the case for two mutations examined further in this study. Classes of mutations that could be identified by this approach were hypothesized to affect proteins that require an interaction with 14-3-3 for proper regulation or function or kinases that phosphorylate target proteins to allow 14-3-3 binding. A third class includes proteins involved in a redundant or parallel pathway to one disrupted by reduction of 14-3-3. Finally, we expected to identify mutations in the other 14-3-3 gene, as complete loss of 14-3-3 protein is usually lethal (GELPERIN et al. 1995 Down; VAN HEUSDEN et al. 1995 Down; ROBERTS et al. 1997 Down). As expected, we identified a mutation in a BMH gene, bmh2. In addition, the screens identified mutations in BMS1, BMS2, and YPK1/BMS3 as being sensitive to reduced levels of 14-3-3.

Since 14-3-3 mutants are rapamycin hypersensitive and have been shown to be downstream effectors of TOR signaling, we tested our bms mutants for sensitivity to this drug. We found that ypk1-2/bms3-1 causes rapamycin hypersensitivity. One of the major effects of rapamycin, by its effect on TOR, is to inhibit translation initiation. This led us to discover that ypk1-{Delta} also causes a translation initiation defect, and these phenotypes were even more pronounced in a ypk-ts strain at its nonpermissive temperature. In contrast, bms1-1 was not rapamycin sensitive, even though we have previously shown that bms1-1 also causes a translation defect by its effect on an early step in 40S ribosomal subunit biogenesis (GELPERIN et al. 2001 Down; also see WEGIERSKI et al. 2001 Down). Furthermore, although ypk1-2 was hypersensitive to rapamycin, it was not hypersensitive to other translational inhibitors, such as paromomycin or neomycin, which did affect bms1-1 (not shown). Thus the rapamycin hypersensitivity of the ypk mutants appears to be a specific phenotype and is not merely due to the combined effects of rapamycin and ypk mutations on translation or to a general drug sensitivity.

Ypk1/2p have highest homology within their catalytic domain to mammalian SGK and Akt/PKB protein kinases (55 and 52%, respectively) and can be functionally replaced by SGK and partially by Akt/PKB (CASAMAYOR et al. 1999 Down). In mammalian cells the 3-phosphoinositide-dependent kinase PDK1 phosphorylates and activates both SGK and Akt/PKB, among other kinases, in response to growth factors and survival factors (BELHAM et al. 1999 Down; VANHAESEBROECK and ALESSI 2000 Down). In yeast a functional homolog of PDK1, Pkh1p, activates Ypk1p in vitro (CASAMAYOR et al. 1999 Down), and both Ypk1p and Pkh1p appear to be downstream effectors of a lipid signaling pathway involving sphingolipids (SUN et al. 2000 Down). Akt/PKB has multiple downstream targets, possibly including mammalian mTOR/FRAP (SCOTT et al. 1998 Down; KANDEL and HAY 1999 Down; NAVE et al. 1999 Down; SEKULIC et al. 2000 Down), although the importance of the Akt-dependent phosphorylation of TOR is somewhat controversial (see GINGRAS et al. 2001 Down and references therein). Nevertheless, the rapamycin sensitivity of ypk and pkh1 strains we have observed further suggests that Pkh1p and Ypkp function in a pathway analogous to PDK1 and Akt/PKB.

Interestingly, Akt/PKB is responsible for phosphorylating 14-3-3 target proteins on residues that allow 14-3-3 to bind (ZHA et al. 1996 Down; DATTA et al. 1997 Down; BRUNET et al. 1999 Down). CASAMAYOR et al. 1999 Down have done preliminary characterization of the sequence that is recognized and phosphorylated by Ypk1p and found it to be RXRXX[S/T][aromatic]. This is reminiscent of a 14-3-3-binding motif if it is followed by a proline at the +2 position after the phosphoserine or phosphothreonine (YAFFE et al. 1997 Down). Thus, Ypk1p, like Akt/PkB, may phosphorylate and regulate the binding of 14-3-3 to an as yet unidentified target or targets, which could explain the synthetic phenotypes observed when ypk1 was combined with bmh deficiency.

Alternatively, the genetic interaction we observed between ypk1 and 14-3-3 mutations could relate to the fact that both gene products have functions that intersect with components regulated by TOR. Both YPK and 14-3-3 mutants are hypersensitive to rapamycin. 14-3-3 is a downstream component of the TOR pathway and acts to sequester the Msn2/4p stress-responsive transcription factors in the cytosol in response to TOR activation (BECK and HALL 1999 Down). Loss of Ypk function causes a dramatic decrease in initiation of translation and a concomitant depletion of eIF4G, similar to that observed after treatment of cells with rapamycin (BARBET et al. 1996 Down; BERSET et al. 1998 Down; POWERS and WALTER 1999 Down; KURUVILLA et al. 2001 Down). Interestingly, we found that Ypk1 protein levels are regulated by nitrogen availability, but they are not affected by glucose depletion, similar to the pattern seen for eIF4G. This suggests that Ypk is a component of a nutrient-sensing pathway that may regulate translation initiation by affecting eIF4G levels in the cell. The fact that Ypk and TOR affect a common downstream target (eIF4G) further supports a role for Ypk in a pathway that intersects with TOR signaling.

A key question that remains is whether Ypk directly affects the TOR pathway itself, or whether it is a component of a functionally related pathway that operates parallel to TOR. We found that overexpression of YPK1 was unable to suppress the rapamycin sensitivity of a wild-type strain or of a tor1-{Delta} strain. PKH overexpression gave similar results (not shown). Moreover, we found no effect of rapamycin on the levels or activity of Ypk1 (not shown). These data seem to indicate that Ypk and Pkh do not function downstream of TOR.

Other evidence points to a model in which Ypk and Pkh function in a pathway parallel to TOR. Overexpression of 14-3-3 proteins could not suppress the rapamycin sensitivity of ypk mutants to any extent, as compared to their ability, as downstream effectors of TOR, to confer rapamycin resistance to tor1-{Delta} and wild-type strains (BERTRAM et al. 1998 Down; BECK and HALL 1999 Down). Moreover, overexpression of TOR could not suppress the growth defect or the eIF4G-induced depletion in the ypk-ts strain at 37° (not shown). In preliminary studies, we find identical results for a pkh-ts strain, which is also rapamycin hypersensitive at permissive growth temperatures and causes depletion of eIF4G at the nonpermissive temperature (not shown). Together, these results suggest that Ypk's regulation of translation initiation may not be directly through TOR. If Ypk is on a parallel pathway, independent inputs from both Ypk and TOR might be required for activation of a common downstream target, as has been suggested for the phosphoregulation of S6 kinase, 4E-BP1, and eIF4G by the related mammalian signaling pathways involving PI3 kinase, Akt(PKB), and mTOR (see GINGRAS et al. 2001 Down and references therein).

Recent studies indicate that Ypk and Pkh have other cellular functions. The sphingolipid signaling pathway that activates Ypk has recently been shown to be required for endocytosis and normal actin organization, and both Ypk function and Pkh function have been implicated in this pathway as well (INAGAKI et al. 1999 Down; FRIANT et al. 2000 Down, FRIANT et al. 2001 Down; ZANOLARI et al. 2000 Down; DEHART et al. 2002 Down). Furthermore, both kinases appear to be upstream activators of the PKC signaling pathway (INAGAKI et al. 1999 Down; SCHMELZLE et al. 2002 Down). However, pkc1-ts mutants are suppressed by sorbitol addition, but neither the endocytic nor the eIF4G depletion phenotypes of ypk-ts are suppressed by sorbitol (not shown; DEHART et al. 2002 Down). Also, pkc1-ts mutants are not rapamycin sensitive (not shown) and have normal endocytosis at the nonpermissive temperature (FRIANT et al. 2000 Down). This suggests that Pkh and Ypk are likely to receive inputs from multiple signals and regulate multiple downstream targets, similar to PDK1 and Akt/PKB and other kinase signaling pathways in yeast and animals. Future work will be aimed at identifying the upstream activators and downstream effectors of the Ypk pathway leading to regulation of translation initiation, as well as whether any targets of Ypk phosphorylation are subject to regulation by 14-3-3 binding.


*  FOOTNOTES

1 Present address: Department of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06520-8103. Back


*  ACKNOWLEDGMENTS

We thank Dario Alessi, Michael Hall, David Levin, Kunihiro Matsumoto, Jeremy Thorner, John Warner, and Alan Sachs for kindly providing strains, plasmids, and antibodies. We thank Kenneth Henry, William Merrick, and Anton Komar for helpful discussions. D.G. had support from National Institutes of Health (NIH) training grant HD07104 and L.H. was the recipient of a National Research Service Award postdoctoral fellowship (DK09915). This work was funded by grants from the American Cancer Society (RPG-9403104) and the NIH (GM-55796) to S.K.L. and NIH grant DK43414 to J.H.

Manuscript received October 5, 2001; Accepted for publication May 23, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALAM, R., N. HACHIYA, M. SAKAGUCHI, S. KAWABATA, and S. IWANAGA et al., 1994  cDNA cloning and characterization of mitochondrial import stimulation factor (MSF) purified from rat liver cytosol. J. Biochem. 116:416-425.[Abstract/Free Full Text]

ASHE, M. P., S. K. DE LONG, and A. B. SACHS, 2000  Glucose depletion rapidly inhibits translation initiation in yeast. Mol. Biol. Cell 11:833-848.[Abstract/Free Full Text]

BALDIN, V., 2000  14-3-3 proteins and growth control. Prog. Cell Cycle Res. 4:49-60.[Medline]

BARBET, N. C., U. SCHNEIDER, S. B. HELLIWELL, I. STANSFIELD, and M. F. TUITE et al., 1996  TOR controls translation initiation and early G1 progression in yeast. Mol. Biol. Cell 7:25-42.[Abstract]

BECK, T. and M. N. HALL, 1999  The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402:689-692.[Medline]

BECK, T., A. SCHMIDT, and M. N. HALL, 1999  Starvation induces vacuolar targeting and degradation of the tryptophan permease in yeast. J. Cell Biol. 146:1227-1238.[Abstract/Free Full Text]

BELHAM, C., S. WU, and J. AVRUCH, 1999  Intracellular signalling: PDK1—a kinase at the hub of things. Curr. Biol. 9:R93-R96.[Medline]

BENDER, A. and J. R. PRINGLE, 1991  Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:1295-1305.[Abstract/Free Full Text]

BERSET, C., H. TRACHSEL, and M. ALTMANN, 1998  The TOR (target of rapamycin) signal transduction pathway regulates the stability of translation initiation factor eIF4G in the yeast Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:4264-4269.[Abstract/Free Full Text]

BERTRAM, P. G., C. ZENG, J. THORSON, A. S. SHAW, and X. F. ZHENG, 1998  The 14-3-3 proteins positively regulate rapamycin-sensitive signaling. Curr. Biol. 8:1259-1267.[Medline]

BRUNET, A., A. BONNI, M. J. ZIGMOND, M. Z. LIN, and P. JUO et al., 1999  Akt promotes cell survival by phosphorylating and inhibiting a forkhead transcription factor. Cell 96:857-868.[Medline]

CARDENAS, M. E., N. S. CUTLER, M. C. LORENZ, C. J. DI COMO, and J. HEITMAN, 1999  The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev. 13:3271-3279.[Abstract/Free Full Text]

CASAMAYOR, A., P. D. TORRANCE, T. KOBAYASHI, J. THORNER, and D. R. ALESSI, 1999  Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast. Curr. Biol. 9:186-197.[Medline]

CHAN, T. F., J. CARVALHO, L. RILES, and X. F. ZHENG, 2000  A chemical genomics approach toward understanding the global functions of the target of rapamycin protein (TOR). Proc. Natl. Acad. Sci. USA 97:13227-13232.[Abstract/Free Full Text]

CHEN, P., K. S. LEE, and D. E. LEVIN, 1993  A pair of putative protein kinase genes (YPK1 and YPK2) is required for cell growth in Saccharomyces cerevisiae.. Mol. Gen. Genet. 236:443-447.[Medline]

CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992  Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122.[Medline]

DATTA, S. R., H. DUDEK, X. TAO, S. MASTERS, and H. FU et al., 1997  Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231-241.[Medline]

DEHART, A. K., J. D. SCHNELL, D. A. ALLEN, and L. HICKE, 2002  The conserved Pkh-Ypk kinase cascade is required for endocytosis in yeast. J. Cell Biol. 156:241-248.[Abstract/Free Full Text]

DEVER, T. E., 1999  Translation initiation: adept at adapting. Trends Biochem. Sci. 24:398-403.[Medline]

DI COMO, C. J. and K. T. ARNDT, 1996  Nutrients, via the Tor proteins, stimulate the association of Tap42 with type 2A phosphatases. Genes Dev. 10:1904-1916.[Abstract/Free Full Text]

FRIANT, S., B. ZANOLARI, and H. RIEZMAN, 2000  Increased protein kinase or decreased PP2A activity bypasses sphingoid base requirement in endocytosis. EMBO J. 19:2834-2844.[Medline]

FRIANT, S., R. LOMBARDI, T. SCHMELZLE, M. N. HALL, and H. RIEZMAN, 2001  Sphingoid base signaling via Pkh kinases is required for endocytosis in yeast. EMBO J. 20:6783-6792.[Medline]

FU, H., J. COBURN, and R. J. COLLIER, 1993  The eukaryotic host factor that activates exoenzyme S of Pseudomonas aeruginosa is a member of the 14-3-3 protein family. Proc. Natl. Acad. Sci. USA 90:2320-2324.[Abstract/Free Full Text]

FU, H., R. R. SUBRAMANIAN, and S. C. MASTERS, 2000  14-3-3 proteins: structure, function, and regulation. Annu. Rev. Pharmacol. Toxicol. 40:617-647.[Medline]

GARRELS, J. I., B. FUTCHER, R. KOBAYASHI, G. I. LATTER, and B. SCHWENDER et al., 1994  Protein identifications for a Saccharomyces cerevisiae protein database. Electrophoresis 15:1466-1486.[Medline]

GELPERIN, D., J. WEIGLE, K. NELSON, P. ROSEBOOM, and K. IRIE et al., 1995  14-3-3 proteins: potential roles in vesicular transport and Ras signaling in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 92:11539-11543.[Abstract/Free Full Text]

GELPERIN, D., L. HORTON, J. BECKMAN, J. HENSOLD, and S. K. LEMMON, 2001  Bms1p, a novel GTP-binding protein, and the related Tsr1p are required for distinct steps of 40S ribosome biogenesis. RNA 7:1268-1283.[Abstract]

GIETZ, D., A. ST. JEAN, R. WOODS, and R. SCHIESTL, 1992  Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425.[Free Full Text]

GINGRAS, A. C., B. RAUGHT, and N. SONENBERG, 2001  Regulation of translation initiation by FRAP/mTOR. Genes Dev. 15:807-826.[Free Full Text]

GUTHRIE, C., and G. R. FINK (Editors), 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.

HAMPSEY, M., 1997  A review of phenotypes of Saccharomyces cerevisiae.. Yeast 13:1099-1133.[Medline]

HARDWICK, J., F. KURUVILLA, J. TONG, A. SHAMJI, and S. SCHREIBER, 1999  Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc. Natl. Acad. Sci. USA 96:14866-14870.[Abstract/Free Full Text]

HELLIWELL, S. B., P. WAGNER, J. KUNZ, M. DEUTER-REINHARD, and R. HENRIQUEZ et al., 1994  TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast. Mol. Biol. Cell 5:105-118.[Abstract]

ICHIMURA, T., T. ISOBE, T. OKUYAMA, Y. YAMAUCHI, and H. FUJISAWA, 1987  Brain 14-3-3 protein is an activator protein that activates tryptophan 5-monooxygenase and tyrosine 3-monooxygenase in the presence of Ca2+, calmodulin-dependent protein kinase II. FEBS Lett. 219:79-82.[Medline]

INAGAKI, M., T. SCHMELZLE, K. YAMAGUCHI, K. IRIE, and M. N. HALL et al., 1999  PDK1 homologs activate the Pkc1-mitogen-activated protein kinase pathway in yeast. Mol. Cell. Biol. 19:8344-8352.[Abstract/Free Full Text]

KAMADA, Y., T. FUNAKOSHI, T. SHINTANI, K. NAGANO, and M. OHSUMI et al., 2000  Tor-mediated induction of autophagy via an Apg1 protein kinase complex. J. Cell Biol. 150:1507-1513.[Abstract/Free Full Text]

KANDEL, E. S. and N. HAY, 1999  The regulation and activities of the multifunctional serine/threonine kinase Akt/PKB. Exp. Cell Res. 253:210-229.[Medline]

KUBO, K., S. OHNO, S. MATSUMOTO, I. YAHARA, and K. SUZUKI, 1989  A novel yeast gene coding for a putative protein kinase. Gene 76:177-180.[Medline]

KUNZ, J., R. HENRIQUEZ, U. SCHNEIDER, M. DEUTER-REINHARD, and N. R. MOVVA et al., 1993  Target of rapamycin in yeast, TOR2, is an essential phosphatidylinositol kinase homolog required for G1 progression. Cell 73:585-596.[Medline]

KURUVILLA, F. G., A. F. SHAMJI, and S. L. SCHREIBER, 2001  Carbon- and nitrogen-quality signaling to translation are mediated by distinct GATA-type transcription factors. Proc. Natl. Acad. Sci. USA 98:7283-7288.[Abstract/Free Full Text]

LIAO, J. and M. B. OMARY, 1996  14-3-3 proteins associate with phosphorylated simple epithelial keratins during cell cycle progression and act as a solubility cofactor. J. Cell Biol. 133:345-357.[Abstract/Free Full Text]

LONGTINE, M. S., A. MCKENZIE, III, D. J. DEMARINI, N. G. SHAH, and A. WACH et al., 1998  Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.. Yeast 14:953-961.[Medline]

MARTINEZ-PASTOR, M. T. and F. ESTRUCH, 1996  Sudden depletion of carbon source blocks translation, but not transcription, in the yeast Saccharomyces cerevisiae. FEBS Lett. 390:319-322.[Medline]

MATSUURA, A. and Y. ANRAKU, 1993  Characterization of the MKS1 gene, a new negative regulator of the Ras-cyclic AMP pathway in Saccharomyces cerevisiae.. Mol. Gen. Genet. 238:6-16.[Medline]

MOORHEAD, G., P. DOUGLAS, N. MORRICE, M. SCARABEL, and A. AITKEN et al., 1996  Phosphorylated nitrate reductase from spinach leaves is inhibited by 14-3-3 proteins and activated by fusicoccin. Curr. Biol. 6:1104-1113.[Medline]

MORGAN, A. and R. D. BURGOYNE, 1992  Exo1 and Exo2 proteins stimulate calcium-dependent exocytosis in permeabilized adrenal chromaffin cells. Nature 355:833-836.[Medline]

MUSLIN, A. J., J. W. TANNER, P. M. ALLEN, and A. S. SHAW, 1996  Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84:889-897.[Medline]

NAVE, B. T., M. OUWENS, D. J. WITHERS, D. R. ALESSI, and P. R. SHEPHERD, 1999  Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem. J. 344:427-431.

NELSON, K. K. and S. K. LEMMON, 1993  Suppressors of clathrin deficiency: overexpression of ubiquitin rescues lethal strains of clathrin-deficient Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:521-532.[Abstract/Free Full Text]

NODA, T. and Y. OHSUMI, 1998  Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J. Biol. Chem. 273:3963-3966.[Abstract/Free Full Text]

PANEK, H. R., J. D. STEPP, H. M. ENGLE, K. M. MARKS, and P. TAN et al., 1997  Suppressors of YCK-encoded yeast casein kinase 1 define four subunits of a novel clathrin AP-like complex. EMBO J. 16:4194-4204.[Medline]

POWERS, T. and P. WALTER, 1999  Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae.. Mol. Biol. Cell 10:987-1000.[Abstract/Free Full Text]

RAUGHT, B., A. C. GINGRAS, and N. SONENBERG, 2001  The target of rapamycin (TOR) proteins. Proc. Natl. Acad. Sci. USA 98:7037-7044.[Abstract/Free Full Text]

ROBERTS, R., H. MOSCH, and G. FINK, 1997  14-3-3 proteins are essential for RAS/MAPK cascade signaling during pseudohyphal development in S. cerevisiae.. Cell 89:1055-1065.[Medline]

ROTH, D., J. BIRKENFELD, and H. BETZ, 1999  Dominant-negative alleles of 14-3-3 proteins cause defects in actin organization and vesicle targeting in the yeast Saccharomyces cerevisiae.. FEBS Lett. 460:411-416.[Medline]

SACHS, A. B. and G. VARANI, 2000  Eukaryotic translation initiation: there are (at least) two sides to every story. Nat. Struct. Biol. 7:356-361.[Medline]

SCHMELZLE, T. and M. N. HALL, 2000  TOR, a central controller of cell growth. Cell 103:253-262.[Medline]

SCHMELZLE, T., S. B. HELLIWELL, and M. N. HALL, 2002  Yeast protein kinases and the RHO1 exchange factor TUS1 are novel components of the cell integrity pathway in yeast. Mol. Cell. Biol. 22:1329-1339.[Abstract/Free Full Text]

SCHMIDT, A., J. KUNZ, and M. N. HALL, 1996  TOR2 is required for organization of the actin cytoskeleton in yeast. Proc. Natl. Acad. Sci. USA 93:13780-13785.[Abstract/Free Full Text]

SCHMIDT, A., T. BECK, A. KOLLER, J. KUNZ, and M. N. HALL, 1998  The TOR nutrient signalling pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease. EMBO J. 17:6924-6931.[Medline]

SCOTT, P. H., G. J. BRUNN, A. D. KOHN, R. A. ROTH, and J. C. LAWRENCE, JR., 1998  Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling pathway. Proc. Natl. Acad. Sci. USA 95:7772-7777.[Abstract/Free Full Text]

SEKULIC, A., C. C. HUDSON, J. L. HOMME, P. YIN, and D. M. OTTERNESS et al., 2000  A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 60:3504-3513.[Abstract/Free Full Text]

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27.[Abstract/Free Full Text]

SKOULAKIS, E. and R. DAVIS, 1996  Olfactory learning deficits mutant for leonardo, a Drosophila gene encoding a 14-3-3 protein. Neuron 17:931-944.[Medline]

STEPP, J. D., A. PELLICENA-PALLE, S. HAMILTON, T. KIRCHHAUSEN, and S. K. LEMMON, 1995  A late Golgi sorting function for Saccharomyces cerevisiae Apm1p, but not for Apm2p, a second yeast clathrin AP medium chain-related protein. Mol. Biol. Cell 6:41-58.[Abstract]

STOTZ, A. and P. LINDER, 1990  The ADE2 gene from Saccharomyces cerevisiae: sequence and new vectors. Gene 95:91-98.[Medline]

SUN, Y., R. TANIGUCHI, D. TANOUE, T. YAMAJI, and H. TAKEMATSU et al., 2000  Sli2 (Ypk1), a homologue of mammalian protein kinase SGK, is a downstream kinase in the sphingolipid-mediated signaling pathway of yeast. Mol. Cell. Biol. 20:4411-4419.[Abstract/Free Full Text]

VANHAESEBROECK, B. and D. R. ALESSI, 2000  The PI3K–PDK1 connection: more than just a road to PKB. Biochem. J. 346:561-576.

VAN HEMERT, M. J., G. P. VAN HEUSDEN, and H. Y. STEENSMA, 2001  Yeast 14-3-3 proteins. Yeast 18:889-895.[Medline]

VAN HEUSDEN, G. P., D. J. GRIFFITHS, J. C. FORD, A. W. T. F. CHIN, and P. A. SCHRADER et al., 1995  The 14-3-3 proteins encoded by the BMH1 and BMH2 genes are essential in the yeast Saccharomyces cerevisiae and can be replaced by a plant homologue. Eur. J. Biochem. 229:45-53.[Medline]

WARNER, J. R., 1999  The economics of ribosome biosynthesis in yeast. Trends Biochem. Sci. 24:437-440.[Medline]

WEGIERSKI, T., E. BILLY, R. NASR, and W. FILIPOWICZ, 2001  Bms1p, a G-domain containing protein, associates with Rcl1p and is required for 18S rRNA biogenesis in yeast. RNA 7:1254-1267.[Abstract]

WHITE, W. H. and D. I. JOHNSON, 1997  Characterization of synthetic-lethal mutants reveals a role for the Saccharomyces cerevisiae guanine-nucleotide exchange factor Cdc24p in vacuole function and Na+ tolerance. Genetics 147:43-55.[Abstract]

YAFFE, M. B. and L. C. CANTLEY, 1999  Signal transduction. Grabbing phosphoproteins. Nature 402:30-31.[Medline]

YAFFE, M. B. and A. E. ELIA, 2001  Phosphoserine/threonine-binding domains. Curr. Opin. Cell Biol. 13:131-138.[Medline]

YAFFE, M. B., K. RITTINGER, S. VOLINIA, P. R. CARON, and A. AITKEN et al., 1997  The structural basis for 14-3-3:phosphopeptide binding specificity. Cell 91:961-971.[Medline]

ZANOLARI, B., S. FRIANT, K. FUNATO, C. SUTTERLIN, and B. J. STEVENSON et al., 2000  Sphingoid base synthesis requirement for endocytosis in Saccharomyces cerevisiae.. EMBO J. 19:2824-2833.[Medline]

ZARAGOZA, D., A. GHAVIDEL, J. HEITMAN, and M. C. SCHULTZ, 1998  Rapamycin induces the G0 program of transcriptional repression in yeast by interfering with the TOR signaling pathway. Mol. Cell. Biol. 18:4463-4470.[Abstract/Free Full Text]

ZHA, J., H. HARADA, E. YANG, J. JOCKEL, and S. J. KORSMEYER, 1996  Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell 87:619-628.[Medline]

ZHENG, X.-F., D. FLORENTINO, J. CHEN, G. CRABTREE, and S. SCHREIBER, 1995  TOR kinase domains are required for two distinct functions, only one of which is inhibited by rapamycin. Cell 82:121-130.[Medline]




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
X. L. Guan, C. M. Souza, H. Pichler, G. Dewhurst, O. Schaad, K. Kajiwara, H. Wakabayashi, T. Ivanova, G. A. Castillon, M. Piccolis, et al.
Functional Interactions between Sphingolipids and Sterols in Biological Membranes Regulating Cell Physiology
Mol. Biol. Cell, April 1, 2009; 20(7): 2083 - 2095.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
R. C. Dickson
Thematic Review Series: Sphingolipids. New insights into sphingolipid metabolism and function in budding yeast
J. Lipid Res., May 1, 2008; 49(5): 909 - 921.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. D. Meier, O. Deloche, K. Kajiwara, K. Funato, and H. Riezman
Sphingoid Base Is Required for Translation Initiation during Heat Stress in Saccharomyces cerevisiae
Mol. Biol. Cell, March 1, 2006; 17(3): 1164 - 1175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Kamada, Y. Fujioka, N. N. Suzuki, F. Inagaki, S. Wullschleger, R. Loewith, M. N. Hall, and Y. Ohsumi
Tor2 Directly Phosphorylates the AGC Kinase Ypk2 To Regulate Actin Polarization
Mol. Cell. Biol., August 15, 2005; 25(16): 7239 - 7248.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
L. K. Palmer, J. L. Shoemaker, B. A. Baptiste, D. Wolfe, and R. L. Keil
Inhibition of Translation Initiation by Volatile Anesthetics Involves Nutrient-sensitive GCN-independent and -dependent Processes in Yeast
Mol. Biol. Cell, August 1, 2005; 16(8): 3727 - 3739.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
F. M. Roelants, P. D. Torrance, and J. Thorner
Differential roles of PDK1- and PDK2-phosphorylation sites in the yeast AGC kinases Ypk1, Pkc1 and Sch9
Microbiology, October 1, 2004; 150(10): 3289 - 3304.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
A. Santhanam, A. Hartley, K. Duvel, J. R. Broach, and S. Garrett
PP2A Phosphatase Activity Is Required for Stress and Tor Kinase Regulation of Yeast Stress Response Factor Msn2p
Eukaryot. Cell, October 1, 2004; 3(5): 1261 - 1271.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
G. E. Palmer, K. J. Johnson, S. Ghosh, and J. Sturtevant
Mutant alleles of the essential 14-3-3 gene in Candida albicans distinguish between growth and filamentation
Microbiology, June 1, 2004; 150(6): 1911 - 1924.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhang, R. L. Lester, and R. C. Dickson
Pil1p and Lsp1p Negatively Regulate the 3-Phosphoinositide-dependent Protein Kinase-like Kinase Pkh1p and Downstream Signaling Pathways Pkc1p and Ypk1p
J. Biol. Chem., May 21, 2004; 279(21): 22030 - 22038.
[Abstract] [Full Text] [PDF]