Haldane's Rule by Sexual Transformation in Caenorhabditis

Corresponding author: Scott Everet Baird, Wright State University, 3640 Colonel Glenn Hwy., Dayton, OH 45435-0001. E-mail:scott.baird@wright.edu

Communicating editor: B. MEYER

	ABSTRACT

TOP ABSTRACT LITERATURE CITED

Haldane's rule in C. briggsae x C. remanei broods was caused by sexual transformation; XX and XO hybrids were female. C. briggsae and C. remanei variants that partially suppress hybrid sexual transformation were identified. Effects of variant strains were cumulative. Hence, aberrant sex determination is a reproductive isolation mechanism in Caenorhabditis.

SPECIATION occurs when two populations become reproductively isolated (MAYR 1963 ). Postzygotic isolation is thought to arise when geographically separate populations become fixed for mutations that, while individually neutral or advantageous, are dysgenic in combination (BATESON 1909 ; DOBZHANSKY 1937 ; MULLER 1940 , MULLER 1942 ). This model does not address the genetic and molecular mechanisms of dysgenesis nor is it predictive of the number of genes involved in reproductive isolation. These gaps have been filled through analyses of recurrent patterns in speciation and through studies of reproductive isolation genes.

One recurrent pattern of speciation is Haldane's rule: "When in the F₁ offspring of two different animal races one sex is absent, rare, or sterile, that sex is the heterozygous sex" (HALDANE 1922 ). This rule is obeyed in mammals, flies, fish, birds, butterflies, and amphibians (LAURIE 1997 ). This broad adherence to Haldane's rule implies that speciation in diverse taxa proceeds through similar mechanisms. Hence, Haldane's rule has received considerable attention in speciation theory (e.g., CHARLESWORTH et al. 1987 ; WU and DAVIS 1993 ; ORR 1997 ; SINGH and KULATHINAL 2000 ; TURELLI and ORR 2000 ).

In nematodes, Haldane's rule is observed in the cross of Caenorhabditis briggsae AF16 males to C. remanei EM464 females (BAIRD et al. 1992 ; Table 1, Fig 1). Most AF16::EM464 hybrids arrested during embryogenesis but those that did reach adulthood were female. Vulvae were present in most F₁ adults and many had multiple pseudovulvae. Vulvae typically were protruding and otherwise abnormal. In no F₁ hybrids was any evidence of male tail development observed. In the reciprocal cross, all hybrids arrested during embryogenesis (BAIRD et al. 1992 ).

View larger version (132K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Sexual transformation of C. briggsae AF16::C. remanei EM464 hybrids. (A) A C. briggsae hermaphrodite that is anatomically identical to C. remanei females. (B) A C. briggsae male. (C) An enlarged view of the tail of a C. briggsae male. Indicated are the nine bilateral pairs of male-specific caudal papillae (cp, cp1 indicated) and the copulatory bursa (bu). Not apparent at this focal plane are the male-specific spicules and sensory hook. (D) An XO hybrid exhibiting an aberrant vulva (vu) at midbody, a posterior pseudovulva (pv), and a tapered female tail. (E) An XX hybrid exhibiting an aberrant vulva (vu) at midbody and a tapered female tail. (F) Midbody of an adult hybrid showing an enlarged undifferentiated gonad (gon). (G) Midbody of an adult hybrid showing the posterior arm of a reflexed hermaphrodite gonad (gon) that contained sperm (sp) within the spermatheca. Worms were mounted on thin pads of 2% agarose for microscopic observations using differential interference contrast optics (SULSTON and HORVITZ 1977 ). Micrographic images were digitally captured using a Spot camera and software (Diagnostic Instruments, Sterling Heights, MI).

Gonads of adult C. briggsae::C. remanei hybrids were abnormal and often were not useful for gender identification (Fig 1F and Fig G). They frequently were enlarged in size and in cell number relative to gonad primordia but exhibited no directed outgrowth or somatic differentiation (Fig 1F). In hybrids in which directed outgrowth was apparent, gonads exhibited the female/hermaphrodite morphology and usually were incompletely developed and/or degenerate (Fig 1G). In some, apparently functional spermathecae containing sperm were observed (Fig 1G). In a previous study, an exceptional hybrid containing a single arrested F₂ zygote was obtained (BAIRD et al. 1992 ).

The absence of males from AF16::EM464 broods resulted from sexual transformation, not male-specific lethality. This was determined using a single-worm PCR assay to detect the C. briggsae homolog of the X-linked unc-18 gene (Cb_unc-18). Detection was expected in diplo-X but not in haplo-X hybrids. Cb_unc-18 was detected in only one-half of the adult female AF16::EM464 hybrids tested (Table 1, Fig 2). In retrospective observations of AF16::EM464 micrographs, no correlation was detected between karyotype and adult anatomy (Fig 1D and Fig E).

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 2. Karyotypes of hybrid adults. Cb_unc-18 was detected in single-worm PCR assays (WILLIAMS et al. 1992 ). Primers were TGCAATTATAGTAAAACTCCGTCG and TGTTCAAGTTCTCGTCAGTGATTCC. Amplification profile was 95° for 5 min followed by 30 cycles of 95° for 30 sec, 56° for 30 sec, 72° for 2 min, followed by 72° for 10 min. From these primers a 506-bp amplification product was expected. (A) AF16::EM464 female hybrids (lanes 1–16). (B) AF16::PB228 female (lanes 3–6) and male (lanes 1 and 2 and 7–10) hybrids. (C) HK104::EM464 female (lanes 6–14) and male (lanes 1–5) hybrids. (D) HK104::PB228 female (7–15) and male (1–6) hybrids. Positive controls (+), single-worm amplifications of C. briggsae. Negative controls (-), single-worm amplifications of C. remanei. Size markers (M), 100-bp ladder; position of 500-bp marker is indicated (>). The expected amplification product was obtained in 93% of all control reactions with C. briggsae AF16 and HK104 (N = 41). Amplification products never were observed in control reactions with C. remanei EM464 (N = 13). Faint amplification products were observed in one of eight control reactions with C. remanei strain PB228. These amplification products were not as robust as those obtained in C. briggsae reactions.

Partial suppression of hybrid sexual transformation was observed in crosses that used the C. briggsae HK104 and C. remanei PB228 strains. Adult females and intersexes were observed among HK104::EM464 and AF16:: PB228 hybrids (Table 1). Intersexes typically had a rudimentary vulva or multiple pseudovulvae and exhibited some degree of male tail specialization (Fig 3); phenotypes were similar to those of partially transformed C. elegans mutants (e.g., HODGKIN 1987 ). Among HK104:: EM464 hybrids, intersexes constituted less than one-half of all adults (Table 1). This departure from a male/intersex frequency of 0.50 was accounted for by the presence of some fully transformed XO females (Table 1, Fig 2). XO females were not present among AF16::PB228 hybrids and an adult intersex frequency of 0.5 was obtained (Table 1, Fig 2).

View larger version (101K): [in this window] [in a new window] [Download PPT slide]   Figure 3. Tail phenotypes of C. briggsae::C. remanei XO hybrids. (A) Lateral view of C. briggsae male. (B) Lateral view of HK104::EM464. (C) Lateral view of AF16::PB228. (D) Lateral view of HK104::PB228. Male-specific characters include the copulatory hook (h), the bursa (bu), the nine bilateral pairs of caudal papillae (cp, not all indicated), and the spicules (sp). Note also the retraction of the tail tip in male/intersexual hybrids.

Effects of C. briggsae HK104 and C. remanei PB228 variants were cumulative; males rather than intersexes were observed among HK104::PB228 adult hybrids (Fig 3). Despite this, some XO hybrids were female. The presence of XO females was unexpected, especially considering the lack of XO females among AF16::PB228 hybrids. Another anomaly was the preponderance of HK104::PB228 males (Table 1). This male bias probably resulted from female-specific lethality as no XX males were observed among adult hybrids (Table 1).

The C. briggsae male to C. remanei female cross is the only example in which Haldane's rule is unambiguously caused by sexual transformation. This mechanism was suggested by HALDANE 1922 on the basis of the apparent transformation of WZ hybrids in lepidopterans (HARRISON 1919 ; GOLDSCHMIDT 1934 ). For Lymantria dispar, this interpretation has been disproved (CLARKE and FORD 1980 , CLARKE and FORD 1982 , CLARKE and FORD 1983 ). Sexual transformation also was proposed for Anas platyrhyncha::Cairina moschata duck hybrids (WHITE 1945 ). However, the affected WZ hybrids did not exhibit any exclusively male characters and may simply have been poorly developed females (CREW and KOLLER 1936 ). Sexual transformation does occur in Mus poschiavinus::M. domesticus mouse hybrids but not in the F₁ generation (EICHER et al. 1982 ). Finally, sexual transformation has been reported for Drosophila repleta::D. neorepleta hybrids (STURTEVANT 1946 ). This cross is not an example of Haldane's rule as it was homogametic hybrids that were transformed and, as in mouse, transformation of D. repleta::D. neorepleta hybrids did not occur or was rare in the F₁ generation. In all other instances that have been investigated, the absence or rarity of the heterogametic sex from the F₁ generation has been the result of gender-biased lethality (LAURIE 1997 ). Dosage compensation, which shares some genetic elements with sex determination, has been ruled out as a cause of sterility and inviability in D. melanogaster::D. simulans hybrids (ORR 1989 ).

In C. elegans, sex determination and dosage compensation are set according to the X-to-autosome ratio (MEYER 1997 , MEYER 2000 ). This ratio is interpreted by a negative regulatory genetic pathway. Numerator elements on the X chromosome and upstream genes are required for both dosage compensation and sex determination. Downstream, this pathway bifurcates, with dosage compensation and sex determination being regulated separately. This mechanism of sex determination has been conserved, at least in part, in C. briggsae and C. remanei. Segregation of sex-linked mutant phenotypes in C. briggsae and C. remanei was consistent with the presumed XX and XO karyotypes of hermaphrodites/females and males, respectively (LAMUNYON and WARD 1997 ; S. E. BAIRD, unpublished results). Moreover, C. briggsae, like C. elegans, is a self-fertile hermaphrodite in which males are rare among self-progeny (DOUGHERTY and NIGON 1949 ). C. briggsae male frequency increases to 50% following matings between hermaphrodites and males, consistent with segregation of nullo-X sperm from XO males (LAMUNYON and WARD 1997 ). Finally, functional conservation of several genes in the sex determination branch of the sex determination/dosage compensation pathway has been demonstrated in C. briggsae and C. remanei (DE BONO and HODGKIN 1996 ; KUWABARA 1996 ; HANSEN and PILGRIM 1998 ; STREIT et al. 1999 ; HAAG and KIMBLE 2000 ; E. S. HAAG, S. WANG and J. KIMBLE, personal communication).

Dysgenic interactions among C. briggsae and C. remanei genes that affect sex determination but not dosage compensation are a likely cause of hybrid sexual transformation. These genes are among the most highly divergent in Caenorhabditis (DE BONO and HODGKIN 1996 ; KUWABARA 1996 ; HANSEN and PILGRIM 1998 ; STREIT et al. 1999 ; HAAG and KIMBLE 2000 ). Genes required for dosage compensation are less likely candidates because their loss-of-function phenotype is gender-specific lethality (MEYER 1997 , MEYER 2000 ). Of particular interest is the rapid coevolution of tra-2 and fem-3 orthologs (E. S. HAAG, S. WANG and J. KIMBLE, personal communication). In C. elegans, physical interaction of TRA-2 and FEM-3 proteins is a crucial step in the sex determination pathway (MEHRA et al. 1999 ). This interaction is conserved in C. briggsae and C. remanei (E. S. HAAG, S. WANG and J. KIMBLE, personal communication) despite the fact that the FEM-3 binding domains of TRA-2 orthologs are hypervariable (MEHRA et al. 1999 ; HAAG and KIMBLE 2000 ). Because of this hypervariability, TRA-2 and FEM-3 interactions are species specific (E. S. HAAG, S. WANG and J. KIMBLE, personal communication). This type of species specificity of sex determination protein interactions is anticipated to be the basis of hybrid sexual transformation in Caenorhabditis.

	ACKNOWLEDGMENTS

I thank W.-C. Yen and A. Deshpande for technical assistance; H. Kagawa for C. briggsae HK104; E. S. Haag, S. Wang, and J. Kimble for communication of unpublished results; and D. Fitch, B. J. Meyer, C. Davidson, J. Puglise, and the reviewers of this manuscript for many helpful comments. C. briggsae AF16 was obtained from the Caenorhabditis Genetics Center, which is supported by the National Institutes of Health National Center for Research Resources. Cb_unc-18 sequence data were obtained from the Washington University Genome Sequencing Center (http://genome.wustl.edu/gsc/projects/c.briggsae). This work was supported by a grant from the Ohio Board of Regents.

Manuscript received February 6, 2002; Accepted for publication April 29, 2002.

	LITERATURE CITED

TOP ABSTRACT LITERATURE CITED

BAIRD, S. E., 1999  Natural and experimental associations of Caenorhabditis remanei with Trachelipus rathkii and other terrestrial isopods. Nematology 1:471-475.

BAIRD, S. E., 2001  Strain-specific variation in the pattern of caudal papillae in Caenorhabditis briggsae (Nematoda; Rhabditidae); implications for species identification. Nematology 3:373-376.

BAIRD, S. E., M. E. SUTHERLIN, and S. W. EMMONS, 1992  Reproductive isolation in Rhabditidae (Nematoda: Secernentea): mechanisms that isolate six species of three genera. Evolution 46:585-594.

BAIRD, S. E., D. H. A. FITCH, and S. W. EMMONS, 1994  Caenorhabditis vulgaris sp. n. (Nematoda: Rhabditidae): a necromenic associate of pill bugs and snails. Nematologica 40:1-11.

BATESON, W., 1909 Heredity and variation in modern lights, pp. 85–101 in Darwin and Modern Science, edited by A. C. SEWARD. Cambridge University Press, Cambridge, MA.

CHARLESWORTH, B., J. A. COYNE, and N. H. BARTON, 1987  The relative rates of evolution of sex chromosomes and autosomes. Am. Nat. 130:113-146.

CLARKE, C. and E. B. FORD, 1980  Intersexuality in Lymantria dispar (L.): a reassessment. Proc. R. Soc. Lond. Ser. B 206:381-394.

CLARKE, C. and E. B. FORD, 1982  Intersexuality in Lymantria dispar (L.): a further reassessment. Proc. R. Soc. Lond. Ser. B 214:285-288.

CLARKE, C. and E. B. FORD, 1983  Intersexuality in Lymantria dispar (L.): a third reassessment. Proc. R. Soc. Lond. Ser. B 218:365-370.

CREW, F. A. E. and P. C. KOLLER, 1936  Genetical and cytological studies of the intergeneric hybrid of Cairina moschata and Anas platyrhyncha platyrhyncha.. Proc. R. Soc. Edinb. 51:210-241.

DE BONO, M. and J. HODGKIN, 1996  Evolution of sex determination in Caenorhabditis: unusually high divergence of tra-1 and its functional consequences. Genetics 144:587-595.[Abstract]

DOBZHANSKY, T., 1937 Genetics and the Origin of Species. Columbia University Press, New York.

DOUGHERTY, E. C. and V. NIGON, 1949  A new species of the free-living nematode genus Rhabditis of interest in comparative physiology and genetics. J. Parasitol. 35:11.

EICHER, E. M., L. L. WASHBURN, J. B. WHITNEY, III, and K. E. MORROW, 1982  Mus poschiavinus Y chromosome in the C57BL/6J murine genome causes sex reversal. Science 217:535-537.[Abstract/Free Full Text]

FODOR, A., D. L. RIDDLE, F. K. NELSON, and J. W. GOLDEN, 1983  Comparison of a new wild-type Caenorhabditis briggsae with laboratory strains of C. briggsae and C. elegans.. Nematologica 29:203-217.

GOLDSCHMIDT, R., 1934  Lymantria. Bibliogr. Genet. 11:1-186.

HAAG, E. S. and J. KIMBLE, 2000  Regulatory elements required for development of Caenorhabditis elegans hermaphrodites are conserved in the tra-2 homologue of C. remanei, a male/female sister species. Genetics 155:105-116.[Abstract/Free Full Text]

HALDANE, J. B. S., 1922  Sex ratio and unisexual sterility in hybrid animals. J. Genet. 12:101-109.

HANSEN, D. and D. PILGRIM, 1998  Molecular evolution of a sex determination protein: FEM-2 (PP2C) in Caenorhabditis.. Genetics 149:1353-1362.[Abstract/Free Full Text]

HARRISON, J. W. H., 1919  Studies in the hybrid Bistoninae. IV. Concerning the sex and related problems. J. Genet. 9:1-36.

HODGKIN, J., 1987  A genetic analysis of the sex-determining gene tra-1, in the nematode Caenorhabditis elegans.. Genes Dev. 1:731-745.[Abstract/Free Full Text]

KUWABARA, P. E., 1996  Interspecies comparison reveals evolution of control regions in the nematode sex-determining gene tra-2.. Genetics 144:597-607.[Abstract]

LAMUNYON, C. W. and S. WARD, 1997  Increased competitiveness of nematode sperm bearing the male X chromosome. Proc. Natl. Acad. Sci. USA 94:185-189.[Abstract/Free Full Text]

LAURIE, C. C., 1997  The weaker sex is heterogametic: 75 years of Haldane's rule. Genetics 147:937-951.[Medline]

MAYR, E., 1963 Animals Species and Evolution. Belknap Press, Cambridge, MA.

MEHRA, A., J. GAUDET, L. HECK, P. E. KUWABARA, and A. M. SPENCE, 1999  Negative regulation of male development in Caenorhabditis elegans by a protein-protein interaction between TRA-2A and FEM-3.. Genes Dev. 13:1453-1463.[Abstract/Free Full Text]

MEYER, B. J., 1997 Sex determination and X chromosome dosage compensation, pp. 209–240 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

MEYER, B. J., 2000  Sex in the worm; counting and compensating X-chromosome dose. Trends Genet. 16:247-253.[Medline]

MULLER, H. J., 1940 Bearing of the Drosophila work on systematics, pp. 185–268 in The New Systematics, edited by J. S. HUXLEY. Clarendon Press, Oxford.

MULLER, H. J., 1942  Isolating mechanisms, evolution, and temperature. Biol. Symp. 6:71-125.

ORR, H. A., 1989  Does postzygotic isolation result from improper dosage compensation. Genetics 122:891-894.[Abstract/Free Full Text]

ORR, H. A., 1997  Haldane's rule. Annu. Rev. Ecol. Syst. 28:195-218.

SINGH, R. S. and J. KULATHINAL, 2000  Sex gene pool evolution and speciation: a new paradigm. Genes Genet. Syst. 75:119-130.[Medline]

STREIT, A., W. LI, B. ROBERTSON, J. SCHEIN, and I. H. KAMAL et al., 1999  Homologs of the Caenorhabditis elegans masculinizing gene her-1 in C. briggsae and the filarial parasite Brugia malayi.. Genetics 152:1573-1584.[Abstract/Free Full Text]

STURTEVANT, A. H., 1946  Intersexes dependent on a maternal effect in hybrids between Drosophila repleta and D. neorepleta.. Proc. Natl. Acad. Sci. USA 32:84-87.[Free Full Text]

SUDHAUS, W. and K. KIONTKE, 1996  Phylogeny of Rhabditis subgenus Caenorhabditis (Rhabditidae, Nematoda). J. Zool. Syst. Evol. Res. 34:217-233.

SULSTON, J. E. and H. R. HORVITZ, 1977  Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.. Dev. Biol. 56:110-156.[Medline]

TURELLI, M. and H. A. ORR, 2000  Dominance, epistasis and the genetics of postzygotic isolation. Genetics 154:1663-1679.[Abstract/Free Full Text]

WHITE, M. J. D., 1945 Animal Cytology and Evolution. Cambridge University Press, London.

WILLIAMS, B. D., B. SCHRANK, C. HUYNH, R. SHOWNKEEN, and R. H. WATERSTON, 1992  A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence tagged sites. Genetics 131:609-624.[Abstract]

WU, C.-I and A. W. DAVIS, 1993  Evolution of postmating reproductive isolation: the composite nature of Haldane's rule and its genetic bases. Am. Nat. 142:187-212.

This article has been cited by other articles:

				L. R. Garcia, B. LeBoeuf, and P. Koo Diversity in Mating Behavior of Hermaphroditic and Male-Female Caenorhabditis Nematodes Genetics, April 1, 2007; 175(4): 1761 - 1771. [Abstract] [Full Text] [PDF]

				A. D. Cutter, S. E. Baird, and D. Charlesworth High Nucleotide Polymorphism and Rapid Decay of Linkage Disequilibrium in Wild Populations of Caenorhabditis remanei Genetics, October 1, 2006; 174(2): 901 - 913. [Abstract] [Full Text] [PDF]

				A. D. Cutter, M.-A. Felix, A. Barriere, and D. Charlesworth Patterns of Nucleotide Polymorphism Distinguish Temperate and Tropical Wild Isolates of Caenorhabditis briggsae Genetics, August 1, 2006; 173(4): 2021 - 2031. [Abstract] [Full Text] [PDF]

				H. A. Orr and S. Irving Segregation Distortion in Hybrids Between the Bogota and USA Subspecies of Drosophila pseudoobscura Genetics, February 1, 2005; 169(2): 671 - 682. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Baird, S. E. Search for Related Content PubMed PubMed Citation Articles by Baird, S. E.