- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Casacuberta, E.
- Articles by Pardue, M.-L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Casacuberta, E.
- Articles by Pardue, M.-L.
Coevolution of the Telomeric Retrotransposons Across Drosophila Species
Elena Casacubertaa and Mary-Lou Pardueaa Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
Corresponding author: Mary-Lou Pardue, 68-670, Massachusetts Institute of Technology, Cambridge, MA 02139., mlpardue{at}mit.edu (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
As in other eukaryotes, telomeres in Drosophila melanogaster are composed of long arrays of repeated DNA sequences. Remarkably, in D. melanogaster these repeats are produced, not by telomerase, but by successive transpositions of two telomere-specific retrotransposons, HeT-A and TART. These are the only transposable elements known to be completely dedicated to a role in chromosomes, a finding that provides an opportunity for investigating questions about the evolution of telomeres, telomerase, and the transposable elements themselves. Recent studies of D. yakuba revealed the presence of HeT-A elements with precisely the same unusual characteristics as HeT-Amel although they had only 55% nucleotide sequence identity. We now report that the second element, TART, is also a telomere component in D. yakuba; thus, these two elements have been evolving together since before the separation of the melanogaster and yakuba species complexes. Like HeT-Ayak, TARTyak is undergoing concerted sequence evolution, yet they retain the unusual features TARTmel shares with HeT-Amel. There are at least two subfamilies of TARTyak with significantly different sequence and expression. Surprisingly, one subfamily of TARTyak has >95% sequence identity with a subfamily of TARTmel and shows similar transcription patterns. As in D. melanogaster, other retrotransposons are excluded from the D. yakuba terminal arrays studied to date.
STUDIES of insect telomeres have provided the first exceptions to the general mechanism of telomere formation (reviewed in ![]()
![]()
![]()
![]()
![]()
|
Both telomerase and the Drosophila retrotransposons extend telomeres by copying RNA sequences, and it is possible that Chironomus telomere extension is also a variation of this basic theme. Understanding how these different telomere types are related would help us to understand how telomeres evolved. In addition, comparison of variant telomeres in different species could identify features that are universally important for telomere structure and function. The information needed will come only from the study of several branches of the phylogenetic tree, with the distance between the branches carefully chosen to maximize our understanding.
Identifying alternative Drosophila telomere types is not easy, even in species closely related to D. melanogaster, because of the rapid change of telomere sequences within each species. This difficulty was seen in using cross-hybridization to find and characterize HeT-A in D. yakuba (![]()
![]()
The rapid sequence divergence for HeT-A was not unexpected. The element encodes a Gag protein, and retroelement Gag protein sequences diverge more rapidly than the Pol sequences (![]()
![]()
Sequence differences between HeT-Amel and HeT-Ayak are distributed fairly evenly over the element with 65% nucleotide identity in the coding region and 50% identity in the 3' UTR. Despite these extensive sequence changes throughout the element, the features that characterize HeT-Amel are conserved in HeT-Ayak (![]()
The conservation of these distinctive features argues that the features are important for HeT-A to function as telomeres. Thus, the rapid sequence divergence of these HeT-A elements suggests that the 515 million years separating D. melanogaster from D. yakuba may give meaningful information about the evolution of other aspects of telomere biology. If so, this will be very useful because much of the telomerase-mediated telomere biology has been stable over long evolutionary periods.
One of the unusual characteristics of the D. melanogaster telomere is its complexity when compared to the homogeneous simple repeats generated by telomerase. Drosophila telomeres contain mixed arrays of the two non-LTR retrotransposons. Despite their invariant association in D. melanogaster telomeres, HeT-A and TART are now thought to belong to different lineages of non-LTR retrotransposons and to have acquired their telomeric roles as the result of convergent evolution (![]()
Non-LTR retrotransposons are reverse transcribed onto the chromosome, primed by a 3' hydroxyl of the target DNA (![]()
One way to approach these questions is to study the phylogenetic distribution and conserved features of the telomeric elements. Therefore, we have extended our study of D. yakuba telomeres to examine sequences that associate with HeT-Ayak at chromosome ends. We find that TART is a telomeric element in D. yakuba and, other than HeT-A, is the only element found in its telomere arrays. As with HeT-Ayak, at least one subfamily of TARTyak displays significant sequence difference from the D. melanogaster lineage; nevertheless, the entire family conserves the unusual structural and localization characteristics of TART in D. melanogaster.
| MATERIALS AND METHODS |
|---|
Fly stocks:
We analyzed four stocks of D. yakuba: Y-1, a stock of unknown provenance used in our earlier studies (![]()
Southern blot hybridization:
For each sample, 20 µg of genomic DNA was digested with restriction enzymes, fractionated in a 0.7% agarose gel, and transferred to Hybond-N membrane (Amersham Pharmacia Biotech). Moderate-stringency hybridization was overnight at 60° in 4x SET (1x SET: 0.15 M NaCl, 0.03 M Tris pH 7.4, 2 mM EDTA), 5x Denhardt's solution, 0.5% SDS, and 50 µg/ml salmon sperm DNA. Washes were at 60°, 2 x 20 min in 2x SSC, 0.5% SDS, and 2 x 20 min in 1x SSC, 0.5% SDS. Low-stringency hybridization was overnight at 55° in the same hybridization solution followed by 4 x 20-min washes at 55° with 2x SSC, 0.5% SDS. After the initial exposure of low-stringency hybridization, the filters were washed 2 x 20 min at 55° with 1x SSC and reexposed. The filters were then washed 2 x 20 min at 65° with 0.5x SSC and exposed for a final time. DNA probes were labeled with [32P]dATP by random primer labeling (![]()
Library screening:
A D. yakuba genomic library in Lambda Fix II (Stratagene, La Jolla, CA) was obtained from Michael Griswold (North Carolina State University). The library was screened as described in the instruction manual for Lambda Fix II, using the moderate-stringency conditions described above.
Cloning and sequencing of library clones:
Inserts were mapped at high resolution by restriction digestion and hybridization with D. yakuba cloned HeT-A and TART sequences. All TART elements were sequenced completely and all junctions between elements were sequenced through. HeT-A elements were sequenced from both ends and the sizes of the regions between those ends were determined to ensure that only a single element was present at each site; however, not all of the central regions of HeT-A elements have been sequenced. Sequences are deposited in GenBank as
AF468023,
AF468024,
AF468025,
AF468026.
Northern hybridization:
RNA extraction was as described by ![]()
Probes:
Rt1 is nucleotide (nt) 16653804 of GenBank no.
AF468023. Rt2 is nt 41735991 of GenBank no.
AF468026. FIBE is nt 11804 of GenBank no.
AF468023.
Sequence analyses:
Sequences were analyzed by Blast searches of FlyBase and GenBank. Identity percentages were calculated using the LAlign program available at the Genestream Network (IGH, Montpellier, France). Phylogenetic analyses were performed with CLUSTALW (![]()
![]()
![]()
In situ hybridization:
D. yakuba polytene chromosomes were hybridized as in ![]()
PCR: Primer sequences:
The Y chromosome-specific FIBE-reverse transcriptase junction was amplified with the primers F1BP (5' GGAACCTAAAGAACGCCGTT 3') and YRT1 (5' GTGTCGCTTTCGTAGGTAGG 3'). These sequences were taken from GenBank sequence AF468023. The positive control sequence found in both sexes was amplified with primers POL2D (5' GTCACCGAAACTAGACTAGA 3') and POL2R (5' GACCCTTGATCTTCACATTC 3'). These sequences were taken from GenBank sequence AF468026. Amplification was with Taq polymerase and reaction buffer (Roche Diagnostics) for 35 cycles. The program for F1BP and YRT1 primers was 95° for 30 sec, 58° for 30 sec, and 72° for 90 sec. The program for primers POL2D and POL2R was 95° for 30 sec, 50° for 30 sec, and 72° for 120 sec. For both primers the final extension was increased to 7 min.
| RESULTS |
|---|
D. yakuba has non-LTR retrotransposons related to TARTmel:
Reverse transcriptase coding sequences are the least rapidly evolving sequences in retroelements (![]()
The cloned D. yakuba TART sequences were used to probe a library of
phage carrying D. yakuba DNA. Eight clones were recovered. Duplicate clones were identified by restriction mapping and discarded, leaving three cloned sequences. Each of these clones was composed of a mixed array of TARTyak and HeT-Ayak elements (Fig 2). Two of these three clones have HeT-A and TART elements in arrays like those found in D. melanogaster telomeres. The third clone closely resembles a class of nontelomeric repeats found in the heterochromatic D. melanogaster Y chromosome that was originally identified because its members contained fragments of HeT-A (![]()
|
The D. yakuba TART sequences are not found in euchromatic regions:
HeT-Amel and TARTmel are remarkable because they never transpose into euchromatic gene-rich regions where most non-LTR retrotransposons can be found. An earlier study of HeT-Ayak (![]()
The probes forTARTyak reverse transcriptase bind to the most terminal band on chromosome arms, as expected for a telomere sequence (Fig 3). Both probes also bind to regions of the heterochromatic chromocenter, as do HeT-Ayak probes. This contrasts with the situation in D. melanogaster; neither HeT-Amel nor TARTmel hybridizes with the chromocenter in D. melanogaster. The chromocenter is fused and partially underreplicated centromeric heterochromatin. Although HeT-A- and TART-related sequences are in pericentric regions (![]()
![]()
![]()
![]()
|
D. yakuba telomeres contain mixed head-to-tail arrays of HeT-A and TART:
The two larger cloned sequences consist of mixtures of HeT-Ayak and TARTyak elements with no other sequences interspersed (see Fig 2A). As in D. melanogaster telomeres, all elements are oriented in the same direction. Such polar arrays are presumably generated by successive target-primed transpositions onto the end of the chromosome. The elements in these clones are truncated by varying amounts at their 5' ends; similar 5' truncations are seen in D. melanogaster telomere arrays and are common for non-LTR elements generally. This truncation is thought to be due to failure to complete reverse transcription. For HeT-A and TART, truncation could also result from end erosion of the chromosome before the addition of the next retrotransposon.
Neither of these two clones contains any additional sequence interrupting the HeT-A and TART arrays. As in the telomere arrays of D. melanogaster, HeT-Ayak and TARTyak elements associate only with each other.
TARTyak elements form subfamilies that differ in sequence and in degree of similarity to TARTmel subfamilies:
The cloned sequences contain four TARTyak elements (Fig 2). The three elements in telomere arrays are partial, truncated at the 5' end by attachment of another element or at the 3' end by the cloning vector. All junctions of the telomeric TARTyak elements are with HeT-Ayak. The Y chromosome TARTyak1 (see last section of RESULTS) is truncated on both ends.
The TARTyak elements can easily be divided into two subfamilies, 1 and 2, on the basis of the sequence of the 3' UTR. These sequences are so different that it is not possible to do a meaningful alignment of the 3' UTRs to compare the subfamilies. Precisely the same situation is seen with the TART elements in D. melanogaster, where three subfamilies, A, B, and C, have been identified on the basis of significant differences in the sequence of their 3' UTRs. Although these differences are too great to allow alignment of 3' UTR sequences of the TARTmel subfamilies, dot matrix comparisons reveal some sequence similarity in the 3'-most kilobase of the element in all of the D. melanogaster subfamilies (data not shown). No region of similarity is seen in dot matrix comparisons of the TARTyak subfamilies.
Because of so little evidence of sequence conservation of the 3' UTR among elements within either species, it was a surprise to find that the 3' UTR of TARTyak subfamily 2 (TARTyak2) is highly similar to that of the C subfamily of TARTmel. The two 3' UTRs have 95% nucleotide identity over 2040 bp (Fig 4). The comparison is limited on the 5' end because the only available TARTmelC sequence is truncated. On the 3' end the TARTmel sequence extends for 1381 bp beyond the end of TARTyak2a. It does not appear that the TARTyak2 is truncated because it has the typical 3' oligo(A) stretch. The lack of a TARTyak counterpart of the 3'-most terminal region of TARTmel is puzzling because the terminal region is the one showing some similarity between the TARTmel subfamilies.
|
As expected from the D. melanogaster data, the TARTyak subfamilies have much more sequence similarity in the coding regions than in the 3' UTRs. Nevertheless, analyses of both DNA and protein sequences show the same pattern of subfamily divergence that we see in the 3' UTR sequence (Fig 5). To analyze the relationships of the TARTyak subfamilies, coding sequences from all available TARTyak and TARTmel subfamilies were compared. TARTmelC was not included because the only available sequence is a portion of its 3' UTR. Two mechanisms that can facilitate concerted evolution are recombination and gene conversion. These mechanisms might be expected in telomeres because the TARTyak subfamilies are mixed in these arrays, and both they and their neighboring HeT-A elements have sufficient sequence similarity to encourage both recombination and gene conversion events involving TART elements. We looked for interchange between the TARTyak subfamilies by analyzing three regions of the coding sequence independently. We divided the open reading frame (ORF) 2 region into the endonuclease domain and the reverse transcriptase domain. We used only the 3' end of ORF 1 because all of the cloned elements were truncated at the 5' end.
|
The coding regions were compared as both nucleotide and amino acid sequences using neighbor-joining and UPGMA algorithms. Only the neighbor-joining trees of nucleotide sequence analyses are shown (Fig 5), but all analyses yield the same conclusions: All three regions of TARTyak2 elements are more similar to the corresponding TARTmel regions than to those of TARTyak1 even though the three regions of the ORFs diverge at different rates, as is found for other retroelements (![]()
Although there is evidence that recombination and/or gene conversion can occur during the repair of short, recently healed D. melanogaster telomeres (![]()
![]()
The relative abundance of the two D. yakuba subfamilies can be evaluated by Southern blot analysis. When the hybridization is performed at medium stringency, bands corresponding to both subfamilies cross-hybridize (Fig 6) but the relative strength of the signal depends on the subfamily member used as a probe (compare bands marked with an asterisk in Fig 6). Higher-stringency washes eliminate most of the cross-hybridization (not shown). These analyses show that the TARTyak1 subfamily is more abundant in D. yakuba than the TARTyak2 family.
|
The two subfamilies of TARTyak differ somewhat in expression and possibly in translation:
The D. yakuba TART elements produce both sense and antisense transcripts, as do the TART elements in D. melanogaster. TARTmel elements yield many more antisense transcripts than sense-strand transcripts (![]()
|
Non-LTR retrotransposons should require only sense-strand RNA because this strand serves as both mRNA and the transposition template. As expected, HeT-A yields only sense transcripts. In contrast, TART and a few elements in other organisms make both sense and antisense transcripts. The function of the TART antisense RNA is unknown, but TART shows structural similarity (![]()
![]()
A second characteristic of TARTmel sequence that is conserved in TARTyak2, but not TARTyak1, is the sequence joining the gag coding region (ORF 1) to the pol coding region (ORF 2). Retroelements tend to translate ORF 2 as part of a polyprotein linked to the product of ORF 1 either by a frameshift or by readthrough of a leaky stop codon (![]()
![]()
![]()
![]()
|
Fragments of TART and HeT-A are scrambled in Y-associated repeats in D. yakuba resembling the Y chromosome HeT-TART-related mosaic repeats of D. melanogaster:
The third D. yakuba clone differs markedly from the other two in sequence arrangement: It has a partial TARTyak1 element in one orientation and a partial HeT-Ayak element in the opposite orientation (Fig 2B). Furthermore, each of these elements is truncated near its 3' end where it attaches to the other element. Neither tail-to-tail attachments nor 3' truncations are found in telomeric regions. Tail-to-tail attachments should not be found in telomeres because telomere extension is by target-primed reverse transcription onto the chromosome end and priming from the chromosome end dictates uniform polarity. Truncation at the 3' end is not expected because this transposition mechanism requires the extreme 3' end sequences of the element (![]()
In addition to the 3' truncations, both elements in this third clone are truncated at the 5' end by attachment of unrelated sequences. The 5' end of the TARTyak element is associated with a novel 1.8-kb sequence (FIBE) with no protein-coding regions or similarity to known transposable elements. The 5' end of the HeT-Ayak element is associated with
5 kb of a second novel sequence (FIBT) that makes up the rest of the clone. We have sequenced the 1.8-kb FIBE sequence. It has no ORFs but has significant similarity to a scaffold sequence of unknown function in the euchromatin of chromosome 3 of D. melanogaster. Sequences of several fragments from both ends and the center of the 5-kb FIBT fragment adjacent to the HeT-A element all show high similarity to the same scaffold sequence located in the euchromatin of chromosome 2 of D. melanogaster. The region of the D. melanogaster scaffold with similarity to the FIBT sequence has no ORFs. The atypical features of this third clone suggested that it is derived from a class of nontelomeric sequence mosaics that we initially identified in D. melanogaster. In that study (![]()
![]()
![]()
![]()
The abundance of the repeat sequence in DNA from males and females was measured by hybridizing Southern blots with a probe for the FIBE sequence because this sequence is less repeated in the genome than are HeT-A and TART and thus easier to measure on the Southern blot. The probe hybridized with DNA from both sexes but there was a significant excess of hybridizing sequence in DNA from males (Fig 9A), as expected for a sequence repeated on the Y chromosome but also present elsewhere in the genome.
|
If FIBE and TART are associated only in the mosaic fragment on the Y chromosome, the junction between these two sequences should be found only in DNA from males. As predicted, analytical PCR experiments with male DNA amplified a fragment spanning the FIBE-TART junction, whereas a control fragment was amplified equally from DNA of both sexes (Fig 9B). The junction PCR primers were chosen to amplify a 1.6-kb fragment extending from one primer in FIBE to a second primer in the TART sequence (Fig 9B and Fig C). Even in overloaded gel lanes, this 1.6-kb fragment was not found in PCR products of female DNA. As a control to test the ability of the female DNA to serve as a template for PCR we used primers from within a telomeric TART that should be present in DNA from the two sexes.
In situ hybridization to polytene chromosomes cannot be used to map sequences on the Y chromosome because the Y does not polytenize and is therefore undetectable in these nuclei. However, in situ hybridization can find other sites occupied by the fragments that make up the mosaic. Southern hybridization had shown that some of the FIBE sequence was present in females. On polytene chromosomes, the FIBE probe hybridized to only one site, a large band in a euchromatic region of one chromosome. There was no hybridization to any telomeric site (data not shown). Thus, FIBE is not associated with HeT-A or TART in any of the sites detected in polytene chromosomes; the association is found only on the Y chromosome. In situ hybridization to a second D. yakuba stock (not shown) shows the same chromosomal site, supporting our conclusion that it is not a mobile element. As discussed above, there is precedent for finding euchromatic sequence in HeT-TART-related mosaics; fragments of the Stellate gene are found in the D. melanogaster 665 repeat family.
| DISCUSSION |
|---|
HeT-A and TART occupy the same niche in the genomes of D. yakuba and D. melanogaster:
The D. melanogaster genome contains a number of families of non-LTR retrotransposons, including HeT-A and TART. These elements have several well-conserved features atypical of non-LTR retrotransposons; these features are presumably related to their exclusive association to telomeres and heterochromatin. Target-primed reverse transcription, by which non-LTR elements insert into new sites, explains the ability of HeT-A and TART to add to chromosome ends where they form arrays in which the 3' ends are oriented toward the centromere. Other non-LTR retrotransposons use the same mechanism to transpose into many sites in euchromatic regions of the chromosomes but are never found in telomeric arrays. HeT-A and TART are the only elements found in telomere arrays and they are never found in euchromatin.
The only D. yakuba telomeric element previously characterized is HeT-A, which shows the same pattern of telomere-specific transposition seen in D. melanogaster. The TART clones characterized here show that HeT-A also shares its telomeric sites with TART in D. yakuba. Neither of these telomeric elements is found in euchromatin in D. yakuba, nor do we detect new retrotransposons that have acquired telomeric specificity.
Long runs of sequence that do not code for proteins needed for transposition are rare in retrotransposons, yet both HeT-A and TART elements have large regions of noncoding DNA. This DNA is undergoing concerted evolution but there are underlying patterns of sequence conservation. The conservation suggests function, although function other than protein coding is not easily deciphered from sequence. An illustrative example of marked change in a noncoding sequence of defined function is seen in the gene for the RNA template used by telomerase to extend telomeres. Telomerase RNAs from different organisms vary greatly in both size and sequence but some sequence conservation preserves the folding pattern of the transcript (![]()
D. yakuba TART elements are undergoing concerted evolution in at least two subfamilies:
One somewhat unexpected finding of this study is that the two subfamilies of TARTyak are evolving separately. A surprising finding is the high similarity between the sequence of TARTyak2 and TARTmelC.
Such high sequence conservation, especially in a noncoding region, raises the possibility of horizontal transmission. Transmission of a TARTmelC element from D. melanogaster could explain the high similarity between TARTyak2 and TARTmelC. It is known that transposable elements can transpose horizontally between species (![]()
![]()
![]()
![]()
![]()
![]()
1950 (![]()
Although we cannot rule out horizontal transmission of TARTyak2, there is a well-documented case of maintenance of two lineages of a non-LTR retrotransposon through a long evolution (![]()
Fragments of HeT-A and TART sequences are present in Y chromosome mosaic repeats:
One of the intriguing problems of eukaryotic chromosome structure is the evolution of heterochromatic sex chromosomes. Drosophila has contributed insight into this because in one species, D. miranda, an ancestral autosome has become attached to the Y chromosome. This neo-Y chromosome arm is becoming heterochromatic while its former homolog (now called X2) is acquiring the ability to dosage compensate its genes, as does the ancestral X chromosome. The neo-Y chromosome now contains much complex repeated DNA, including transposable elements found elsewhere in the genome (![]()
![]()
The HeT-TART-related mosaic repeats in D. melanogaster identified a new class of sequences in Y chromosomes. The F1B clone described here shows that this class of sequences is also present in D. yakuba. Neither the mosaic repeats in D. melanogaster nor those in D. yakuba appear to have been formed by target-primed reverse transcription. An understanding of the origin of these repeats would give insight into the formation of Y chromosomes and other heterochromatic regions.
In conclusion:
Comparison of the mechanisms used by telomerase and the reverse transcriptases of non-LTR retrotransposons suggests that little, if any, modification would be necessary to enable retrotransposons to extend telomeres (![]()
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AF468023,
AF468024,
AF468025, and
AF468026. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Michael Griswold for the generous gift of the D. yakuba clone library and Michael Ashburner for one of the D. yakuba stocks. Members of the Pardue laboratory, Ky Lowenhaupt, and Josep Casacuberta have provided much useful discussion and helpful comments on the manuscript. This work has been supported by grant GM50315 from the National Institutes of Health.
Manuscript received January 17, 2002; Accepted for publication March 13, 2002.
| LITERATURE CITED |
|---|
AGUDO, M., A. LOSADA, J. P. ABAD, S. PIMPINELLI, and P. RIPOLL et al., 1999 Centromeres from telomeres?: the centromeric region of the Y chromosome of Drosophila melanogaster contains a tandem array of telomeric HeT-A- and TART-related sequences. Nucleic Acids Res. 27:3318-3324.
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BOUHIDEL, K., C. TERZIAN, and H. PINON, 1994 The full-length of the I factor, a LINE element of Drosophila melanogaster, is a potential bicistronic RNA messenger. Nucleic Acids Res. 22:2370-2374.
BROWN, E. A., H. ZHANG, L. PING, and S. M. LEMON, 1992 Secondary structure of the 5' nontranslated regions of hepatitis C virus and pestivirus genomic RNAs. Nucleic Acids Res. 20:5041-5045.
CHEN, J.-L., M. A. BLASCO, and C. W. GREIDER, 2000 Secondary structure of vertebrate telomerase RNA. Cell 100:503-514.[Medline]
CLARK, J. B. and M. KIDWELL, 1997 A phylogenetic perspective on P transposable element evolution in Drosophila. Proc. Natl. Acad. Sci. USA 94:11428-11433.
DANILEVSKAYA, O. N., A. LOVSKY, E. V. KURENOVA, and M. L. PARDUE, 1993 The Y chromosome of Drosophila melanogaster contains a distinctive subclass of HeT-A-related repeats. Genetics 134:531-543.[Abstract]
DANILEVSKAYA, O. N., C. TAN, J. WONG, M. ALIBHAI, and M. L. PARDUE, 1998a Unusual features of the Drosophila melanogaster telomere transposable element HeT-A are conserved in Drosophila yakuba telomere elements. Proc. Natl. Acad. Sci. USA 95:3770-3775.
DANILEVSKAYA, O. N., K. LOWENHAUPT, and M. L. PARDUE, 1998b Conserved subfamilies of the Drosophila HeT-A telomere-specific retrotransposon. Genetics 148:233-242.
DANILEVSKAYA, O. N., K. L. TRAVERSE, N. C. HOGAN, P. G. DEBARYSHE, and M. L. PARDUE, 1999 The two Drosophila telomeric transposable elements have very different patterns of transcription. Mol. Cell. Biol. 19:873-888.
FEINBERG, A. P. and B. VOGELSTEIN, 1983 A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13.[Medline]
GENTILE, K. L., W. D. BURKE, and T. H. EICKBUSH, 2001 Multiple lineages of R1 retrotransposable elements can coexist in the rDNA loci of Drosophila. Mol. Biol. Evol. 18:235-245.
JACKS, T., 1990 Translational suppression in gene expression in retroviruses and retrotransposons. Curr. Top. Microbiol. Immunol. 157:93-124.[Medline]
JORDAN, I. K., V. LILYA, V. MATYUNINA, and J. F. MCDONALD, 1999 Evidence for the recent horizontal transfer of long terminal repeat transposon. Proc. Natl. Acad. Sci. USA 96:12621-12625.
KAHN, T., M. SAVITSKY, and P. GEORGIEV, 2000 Attachment of HeT-A sequences to chromosome termini in Drosophila melanogaster may occur by different mechanisms. Mol. Cell. Biol. 20:7634-7642.
KAMNERT, I., L. NIELSEN, and J.-E. EDSTROM, 1998 A concertedly evolving region in Chironomus, unique within the telomere. J. Mol. Evol. 46:562-570.[Medline]
KIDWELL, M., 1992 Horizontal transfer. Curr. Biol. 2:868-873.
KUMAR, S., K. TAMURA, I. B. JACKOBSEN, and M. NEI, 2001 MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-1245.
LACHAISE, D. L., M.-L. CARIOU, J. R. DAVID, F. LEMUEUNIER, and L. TSACAS et al., 1988 Historical biogeography of the Drosophila melanogaster species subgroup. Evol. Biol. 22:159-225.
LOWENHAUPT, K., A. RICH, and M. L. PARDUE, 1989 Non-random distribution of long mono- and di-nucleotide repeats in Drosophila chromosomes: correlations with dosage compensation, heterochromatin, and recombination. Mol. Cell. Biol. 9:1173-1182.
LUAN, D. D., M. H. KORMAN, J. L. JAKUBCZAK, and T. H. EICKBUSH, 1993 Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition. Cell 72:595-605.[Medline]
MAIZEL, J. V., JR. and R. P. LENK, 1981 Enhanced graphic matrix analysis of nucleic acid and protein sequences. Proc. Natl. Acad. Sci. USA 78:7665-7669.
MALIK, H. S., W. D. BURKE, and T. H. EICKBUSH, 1999 The age and evolution of non-LTR retrotransposable elements. Mol. Biol. Evol. 16:793-805.[Abstract]
MCCLURE, M. A., M. S. JOHNSON, D-F. FENG, and R. F. DOOLITTLE, 1988 Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proc. Natl. Acad. Sci. USA 85:2469-2473.
MCMILLAN, J. P. and M. F. SINGER, 1993 Translation of the human LINE-1 element, L1Hs. Proc. Natl. Acad. Sci. USA 90:11533-11537.
MIZROKHI, L. J. and A. MAZO, 1990 Evidence for horizontal transmission of the mobile element jockey between distant Drosophila species. Proc. Natl. Acad. Sci. USA 87:9216-9220.
OKAZAKI, S., K. TSUCHIDA, H. MAEKAWA, H. ISHIKAWA, and H. FUJIWARA, 1993 Identification of a pentanucleotide telomeric sequence, (TTAGG)n, in the silkworm Bombyx mori and in other insect species. Mol. Cell. Biol. 13:1424-1432.
PARDUE, M. L., 2000 In situ hybridization to polytene chromosomes, pp. 119129 in Drosophila Protocols, edited by W. SULLIVAN, M. ASHBURNER and S. HAWLEY. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
PARDUE, M. L. and P. G. DEBARYSHE, 1999 Telomeres and telomerase: more than the end of the line. Chromosoma 108:73-82.[Medline]
PARDUE, M. L., O. N. DANILEVSKAYA, K. LOWENHAUPT, F. SLOT, and K. L. TRAVERSE, 1996 Drosophila telomeres: new views on chromosome evolution. Trends Genet. 12:48-52.[Medline]
PEREZ-GONZALEZ, C. E. and T. H. EICKBUSH, 2001 Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.. Genetics 158:1557-1567.
ROSEN, M. and J. EDSTROM, 2000 DNA structures common for Chironomid telomeres terminating with complex repeats. Insect Mol. Biol. 9:341-347.[Medline]
SAHARA, K., F. MAREC, and W. TRAUT, 1999 TTAAGG telomeric repeats in chromosomes of some insects and other arthropods. Chromosome Res. 7:449-460.[Medline]
SCHUMANN, G., I. ZÜNDORF, J. HOFMANN, R. MARSCHALEK, and T. DINGERMANN, 1994 Internally located and oppositely oriented polymerase II promoters direct convergent transcription of a LINE-like retroelement, the Dictyostelium repetitive element, from Dictyostelium discoideum.. Mol. Cell. Biol. 14:3074-3084.
SIRIACO, G. M., G. CENCI, A. HAOUDI, L. CHAMPION, and C. ZHOU et al., 2002 Telomere elongation (Tel), a new mutation in Drosophila melanogaster that produces long telomeres. Genetics 160:235-245.
STEINEMANN, M. and S. STEINEMANN, 2000 Common mechanisms of Y chromosome evolution. Genetica 109:105-111.[Medline]
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994 "ClustalW": improving the sensitivity of progressive multiple sequence alignment through sequence weighting position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.
TRAVERSE, K. L. and M. L. PARDUE, 1989 Studies of HeT-A DNA sequences in the pericentric regions of Drosophila chromosomes. Chromosoma 97:261-271.[Medline]
This article has been cited by other articles:
![]() |
J. Gonzalez, J. M. Macpherson, P. W. Messer, and D. A. Petrov Inferring the Strength of Selection in Drosophila under Complex Demographic Models Mol. Biol. Evol., March 1, 2009; 26(3): 513 - 526. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Villasante, J. P. Abad, R. Planello, M. Mendez-Lago, S. E. Celniker, and B. de Pablos Drosophila telomeric retrotransposons derived from an ancestral element that was recruited to replace telomerase Genome Res., December 1, 2007; 17(12): 1909 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shpiz, D. Kwon, A. Uneva, M. Kim, M. Klenov, Y. Rozovsky, P. Georgiev, M. Savitsky, and A. Kalmykova Characterization of Drosophila Telomeric Retroelement TAHRE: Transcription, Transpositions, and RNAi-based Regulation of Expression Mol. Biol. Evol., November 1, 2007; 24(11): 2535 - 2545. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Casacuberta, F. A. Marin, and M.-L. Pardue Intracellular targeting of telomeric retrotransposon Gag proteins of distantly related Drosophila species PNAS, May 15, 2007; 104(20): 8391 - 8396. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. George, P. G. DeBaryshe, K. L. Traverse, S. E. Celniker, and M.-L. Pardue Genomic organization of the Drosophila telomere retrotransposable elements Genome Res., October 1, 2006; 16(10): 1231 - 1240. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Ko, S. Piao, and H. Akashi Strong Regional Heterogeneity in Base Composition Evolution on the Drosophila X Chromosome Genetics, September 1, 2006; 174(1): 349 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Savitsky, D. Kwon, P. Georgiev, A. Kalmykova, and V. Gvozdev Telomere elongation is under the control of the RNAi-based mechanism in the Drosophila germline Genes & Dev., February 1, 2006; 20(3): 345 - 354. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Melnikova, H. Biessmann, and P. Georgiev The Ku Protein Complex Is Involved in Length Regulation of Drosophila Telomeres Genetics, May 1, 2005; 170(1): 221 - 235. [Abstract] [Full Text] [PDF] |
||||
![]() |
Macroevolution, hierarchy theory, and the C-value enigma Paleobiology, June 1, 2004; 30(2): 179 - 202. |
||||
![]() |
E. Casacuberta and M.-L. Pardue HeT-A elements in Drosophila virilis: Retrotransposon telomeres are conserved across the Drosophila genus PNAS, November 25, 2003; 100(24): 14091 - 14096. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Casacuberta and M.-L. Pardue Transposon telomeres are widely distributed in the Drosophila genus: TART elements in the virilis group PNAS, March 18, 2003; 100(6): 3363 - 3368. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. George and M.-L. Pardue The Promoter of the Heterochromatic Drosophila Telomeric Retrotransposon, HeT-A, Is Active When Moved Into Euchromatic Locations Genetics, February 1, 2003; 163(2): 625 - 635. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Casacuberta, E.
- Articles by Pardue, M.-L.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Casacuberta, E.
- Articles by Pardue, M.-L.


3' on the sense strand of each element. dr indicates the direct repeats in the TARTyak1 3' UTR. Diagrams are approximately to scale. F1B, F1, and E2 are the names of the phage clones.











