- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Karathanasis, E.
- Articles by Wilson, T. E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Karathanasis, E.
- Articles by Wilson, T. E.
Enhancement of Saccharomyces cerevisiae End-Joining Efficiency by Cell Growth Stage but Not by Impairment of Recombination
Elissa Karathanasisa and Thomas E. Wilsonaa Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan 48109-0602
Corresponding author: Thomas E. Wilson, University of Michigan Medical School, 1301 Catherine Rd., M4214 Med Sci I, Box 0602, Ann Arbor, MI 48109-0602., wilsonte{at}umich.edu (E-mail)
Communicating editor: L. S. SYMINGTON
| ABSTRACT |
|---|
Cells can repair DNA double-strand breaks by both homologous and nonhomologous mechanisms. To explore the basis of pathway utilization, we developed both plasmid and chromosomal yeast repair assays in which breaks are created with restriction endonucleases so that nonhomologous end-joining (NHEJ) competes with the single-strand annealing (SSA) recombination pathway, which we show acts with high efficiency via terminal direct repeats of only 28 bp and with reduced but measurable efficiency at 10 bp. The chromosomal assay utilizes a novel approach termed suicide deletion in which the endonuclease cleaves its own gene from the chromosome, thereby ending the futile cleavage cycle that otherwise prevents detection of simple-religation events. Eliminating SSA as a possibility in either assay, either by removal of the direct repeat or by mutation of RAD52, increased the relative but not the absolute efficiency of NHEJ. In contrast, the apparent efficiency of NHEJ was specifically increased in the G1 stage of the haploid cell cycle, as well as by the glucose depletion-signaled transition to stationary phase. The combined results argue against a model in which pathway utilization is determined by a passive competition. Instead, they demonstrate an active regulation designed to optimize the likelihood of genome restoration based on cell state.
MUTAGENESIS is the process by which chemical lesions in DNA are transformed into heritable changes in base sequence. Cellular DNA repair processes ordinarily function to restore DNA to its predamaged state, but, somewhat paradoxically, mutagenesis also requires chemical resolution of the DNA lesion and thus the participation of DNA repair. A major issue is thus how the appropriateness of DNA repair is maintained to optimize the likelihood of genome restoration. Double-stranded chromosome breaks, if misrepaired, can lead to a variety of mutations, including rearrangements, small deletions and insertions, and chromosome loss. They represent an ideal case to explore the phenomenon of differential mutagenesis based on DNA repair pathway utilization, because all eukaryotic (and perhaps many prokaryotic; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Because of these fundamental differences in their enzymology it is likely that at some step each DSB repair (DSBR) pathway becomes irreversibly committed after early steps that are common to both pathways, suggesting a need for regulation. For example, the Mre11-Rad50-Xrs2 complex (corresponding to the Mre11-Rad50-Nbs1 complex in human cells) has an end-tethering function and clear, although variable, defects in both pathways (![]()
![]()
![]()
![]()
(typically diploid cells) repress their NHEJ pathway (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In an effort to further understand the manner in which eukaryotic cells optimize DSBR, we have begun to systematically examine pathway utilization and its effect on chromosomal rearrangement in the yeast Saccharomyces cerevisiae. Here we describe the development of two related assays that allow for the quantitative assessment of pathway utilization in a competitive fashion, one of which is amenable to genetic screening. We find no evidence of a simple competition between the pathways that would be revealed by an increase in utilization of one pathway when the other is blocked. In contrast, our results suggest that NHEJ is activated most specifically in the G1 and especially G0/postdiauxic stages of the haploid cell cycle. These results are considered in the context of recent similar studies in other model systems, as well as the technical difficulties of measuring DSBR in stationary-phase cells.
| MATERIALS AND METHODS |
|---|
Yeast strains:
Strain genotypes are listed in Table 1. Strains used for radiosensitivity analysis were described previously (![]()
![]()
![]()
![]()
::kanMX4 and rad52
::kanMX4 alleles in the suicide deletion strains were introduced by mating and sporulation with strains from the Saccharomyces Genome Deletion Project array (![]()
|
Yeast growth:
Synthetic defined medium was as described (![]()
Exponentially dividing glucose cultures were obtained by diluting an overnight culture 25-fold into fresh media in the morning, followed by still further dilution in the evening and by overnight growth to achieve a culture the next morning with an OD600 <2.0. Experiments in which the culture density was varied were performed in one of two ways. First, 50 ml exponentially dividing cultures were grown in 250-ml flasks and followed over several days, with aliquots taken as needed. Second, 25 ml serial dilutions of an exponentially dividing culture were made in 50-ml conical tubes such that the desired range of densities was obtained over the course of the following day. Similar results were obtained with either protocol.
Glucose determination:
Glucose remaining in the medium was determined using an assay kit from Sigma-Aldrich (#510-A) according to the manufacturer's instructions and using the starting medium as the reference sample.
Thermotolerance:
Cells were washed into water and heated to 55° in a water bath for 5 min followed by cooling on ice for 5 min. Cells were then diluted and plated to YPAD. Viability was determined by comparing colony counts to those obtained in parallel from samples treated identically but held at room temperature instead of 55°. Heat treatment for Table 5 was similar except that it was performed in the growth medium and was followed by a 2-hr recovery period at 30° prior to plating.
|
|
|
|
Synchronization:
Synchronization was achieved by adding either 5 µg/ml
-factor (Sigma-Aldrich) or 10 µg/ml nocodazole (Sigma-Aldrich) to an exponentially dividing culture. After 2 hr of further shaking, the fraction of budded cells was
10 and
95%, respectively. Release from synchronization was achieved by pelleting the cells in a centrifuge, washing once, and resuspending in fresh medium.
Competitive plasmid assay:
Plasmid pES16 (![]()
![]()
- pK1827 (no repeat), ATGGATCGAGGATCGCTAGGTCGTGGTACCTTGTCAAGAATCTCTGACGCTGGACGATCT;
- pDR04 (4-bp repeat), ATGGATCGAGGATCGCTAGGTCGTGGTACCGTGTCAAGAATCTCTGACGCTGGACGATCT;
- pDR10 (10-bp repeat), ATGGATCGAGGATCGCTAGGTCGTGGTACCTAGGTCGTGATCTCTGACGCTGGACGATCT;
- pDR19 (19-bp repeat), ATGGATCGAGGATCGCTAGGTCGTGGTACCGAGGATCGCTAGGTCGTGGCTGGACGATCT;
- pDR29 (29-bp repeat), CAAGTATGGATCGAGGATCGCTAGGTCGTGGTACCAAGTATGGATCGAGGATCGCTAGGTCGTCT.
For routine transformations, cell growth, plasmid digestion, purification, and transformation were performed with DNA amounts in the linear range as previously described (![]()
Verification of the plasmid repair mechanism was achieved by colony PCR using primers OW563 (5'-GGCAGGAGAATTTTCAGCATC) and OW750 (5'-GTGATTGACTCTTGCTGAC), which yielded a 326-bp product for NHEJ and a 292-bp product for SSA. NHEJ PCR products were additionally subjected to cleavage with KpnI, with 185- and 141-bp products resulting if a KpnI site was recreated during repair.
Ionizing radiation:
Strains were grown as needed and then washed into water to 5 x 106 cells/ml. Following irradiation to the indicated doses by timed exposure to a 60Co source, 10-fold serial dilutions were made and appropriate amounts plated to YPAD. Colonies were counted and survival scored relative to a parallel unirradiated control of the same strain.
Suicide deletion assay:
To construct the suicide deletion allele directly in the yeast chromosome, the nuclear-modified coding sequence of the mitochondrial I-SceI mega-endonuclease (![]()
![]()
- ade2::SD0-::URA3 (no repeat, NHEJ = ade2, SSA not possible), ATGGATACGCGTGTATTACCCTGTTATCCCTAGCGTCAGATCCTCT;
- ade2::SD0+::URA3 (28-bp repeat, NHEJ = ade2, SSA = ADE2) ATGGATACGCGTCCTAGCGTACTCAAACGTGTATTACCCTGTTATCCCTAGCGTACTCAAACGTGTATTACCCTACAGATCCTCT;
- ade2::SD2-::URA3 (no repeat, NHEJ = ADE2, SSA not possible), ATGGATAAACGCGTGTATTACCCTGTTATCCCTAGCGTCAGATCCTCT;
- ade2::SD2+::URA3 (28-bp repeat, NHEJ = ADE2, SSA = ade2), ATGGATAAACGCGTCCTAGCGTACTCAAACGTGTATTACCCTGTTATCCCTAGCGTACTCAAACGTGTATTACCCTACAGATCCTCT.
Verification of suicide deletion NHEJ events was achieved by demonstrating the reconstruction of a new I-SceI site in one of three ways. First, primers OW620 (5'-GCTACCAAATGACATTCTCTG) and OW603 (5'-CCTTAAGTTGAACGGAGTCC) were used to generate a PCR fragment whose size of 1.3 kb indicated in 23 of 24 cases that suicide deletion had occurred. The fragments were further subjected to cleavage with I-SceI (New England Biolabs, Beverly, MA), which generated 574- and 699-bp products if a site had been recreated. Second, pTW334 was introduced by transformation and the transformants replica plated to galactose medium, where either poor survival (no repeat alleles) or conversion from white to red (repeat alleles) indicated that an I-SceI site had been cleaved. Third, pTW334 was first transformed into an isogenic strain of opposite mating type and introduced by mating, with scoring of the diploids as above.
For quantification, strains bearing the suicide deletion or ADE2 alleles were grown as required in synthetic defined medium lacking uracil and containing 40 µg/ml adenine (with uracil added for ADE2 control strains). Routine assays were performed after cultures had achieved postdiauxic growth, typically between 24 and 48 hr. Ten-fold serial dilutions of the cells were made in water, and appropriate volumes plated to synthetic defined medium. Percentage survival on galactose plates is expressed relative to parallel platings to glucose.
| RESULTS |
|---|
The competitive plasmid assay: efficient SSA via short terminal repeats:
To quantitatively examine the outcome of competition between NHEJ and homologous recombination, it is necessary to monitor repair in a population of cells where each has suffered a DSB that can be repaired in a stable fashion by either pathway. Moreover, the repair pathway used by a given cell should be readily discernible so that large numbers can be assayed. As a first approximation of this, we transformed cells with derivatives of the plasmid pES16 (![]()
, ADE2/white Ura+ colonies must represent repair by NHEJ. The high efficiency of recombination further ensures that ade2/red Ura+ colonies obtained with repeat-bearing plasmids are nearly all SSA events. A greatly reduced frequency of red colony formation is observed in the absence of the direct repeat, but this primarily represents imprecise NHEJ. These predictions were verified by PCR analysis of red and white colonies (Table 2) and by previous results (![]()
![]()
To explore the effects of terminal direct repeat length on SSA efficiency, a series of plasmids with different repeat lengths was transformed into yku70 mutant yeast, which ensured that transformants could not arise by an unanticipated NHEJ event between the shorter internal microhomologies. Somewhat surprisingly, we found that SSA was readily detectable above background at very short repeat lengths of as little as 10 bp, although a 4-bp repeat was not different from the control plasmid (Fig 1C). Transformation efficiency was nearly maximal at a repeat length of 29 bp. This efficiency in fact exceeded that of supercoiled plasmid, in this case by >100-fold, presumably due to differences in the extent of plasmid uptake.
Lack of competition between NHEJ and SSA: plasmid assay:
The logic we sought to test in these experiments was that a mutation or substrate alteration that decreased the efficiency of one repair pathway should also lead to an increase in the absolute efficiency of the remaining pathway. This logic assumes that repair is truly competitive, i.e., that engagement by one pathway makes a DSB unavailable to the other. Such an assessment is possible because transformation efficiencies are normalized to parallel transformations with uncut DNA and thus compared on an absolute reference scale.
First, the behavior of a subset of the repeat-bearing plasmids was tested in wild-type haploid cells (Fig 2). These NHEJ-proficient cells again failed to show a significant increase in ade2/red colony recovery with the 4-bp repeat that indicates that the yeast NHEJ apparatus is inefficient in its use of internal microhomologies, at least when simultaneously presented with a compatible 4-bp overhang. As above, the 29-bp repeat supported a 100-fold increase in ade2/red SSA events, which initially appeared to be coincident with a modest decrease in ADE2/white NHEJ events when both were counted from the same uracil-selective plates (Fig 2A). When the ADE2/white events were counted from NHEJ-selective plates lacking both uracil and adenine, however, there was no difference in their recovery comparing plasmids with and without repeats (Fig 2B). This phenomenon was reproducible and may partially reflect the fact that fewer ADE2/white colonies could be counted from plates that also allowed growth of the ade2/red SSA events. A larger effect is likely caused by uptake and repair of more than one plasmid per cell. Since SSA via the 29-bp repeat is
10-fold more efficient than NHEJ, some NHEJ-repaired plasmids may simply be lost when selection for them is not maintained. In any case, it is clear that the total repair rate was substantially decreased when the terminal repeat was absent.
|
A similar phenomenon was observed when SSA was prevented by mutation of RAD52. This mutation decreased SSA by 16-fold, but led to no correspondent increase in NHEJ (Fig 2C). Conversely, mutation of either YKU70 or DNL4, presumably early and late contributors to NHEJ, led to the expected large decrease in NHEJ efficiency but no apparent increase in SSA, although even if all NHEJ events had become SSA events the increase may not have been detectable within the error of the assay. Similar overall results were seen when the ends were digested with Asp 718, a 5' isoschizomer of KpnI, or when the recombination event was gene conversion with a chromosomal ade2 point mutant allele (not shown). In summary, manipulating the DNA ends and repair genes had predictable detrimental consequences on the NHEJ and SSA efficiencies, but in no case did we observe a compensatory increase in the remaining pathway.
Increased NHEJ efficiency in haploid G1: plasmid assay:
A different model of pathway utilization was suggested by the observation that NHEJ of all plasmids was decreased >20-fold in diploid as compared to haploid cells, independent of repeat length (Fig 2A). This observation has been documented by several other groups and shown to be a result of downregulation of NHEJ via repression of NEJ1 as a consequence of the MATa/MAT
mating type (![]()
![]()
![]()
![]()
![]()
![]()
-factor, released into fresh medium, and then transformed at various times over the ensuing one and a half divisions with the plasmid containing the 29-bp repeat (Fig 3). As the population began to divide, the frequency of NHEJ events did in fact drop nearly 10-fold, only to rise and then fall again with the second round of budding. SSA remained highly efficient throughout the cell cycle, however, and so this synchronization experiment did not produce the anticipated finding that NHEJ would largely replace recombination during G1. In fact, the NHEJ efficiency in all cell cycle stages was surprisingly lower than that observed in previous experiments, even in G1. The explanation for this seemingly paradoxical finding must come from some difference in the experimental technique and is addressed below.
|
Increased NHEJ efficiency in postdiauxic/stationary phase: radiosensitivity:
Other than treatment with
-factor, the primary technical difference between Fig 2 and Fig 3 was that, for synchronization, cells were grown at higher dilution to a more active exponential growth. Experiments with ionizing radiation suggested that this seemingly small difference might account for the altered NHEJ frequency (Fig 4). First, rad52 mutant cells, in which radiation-induced DSBs either are repaired by DNL4-dependent NHEJ or are lethal (![]()
![]()
75 to
55% across experiments such as that in Fig 4A, consistent with the genetically programmed diauxic shift to respiratory metabolism that occurs upon depletion of glucose, after which cells continue to divide more slowly for several days (![]()
-factor or nocodazole, respectively. Neither treatment increased the radioresistance significantly or induced a DNL4-dependent hypersensitivity (Fig 4C), demonstrating that more than just the fraction of G1 cells must change with culture density. Indeed, after several days cells more gradually undergo a second genetically programmed switch to a highly stress-resistant cell state known as stationary phase, or G0 (![]()
|
Increased NHEJ efficiency in postdiauxic/stationary phase: plasmid assay:
We next tested the effect of culture density on transformation efficiency with the 29-bp repeat plasmid. Plotting the results of a single experiment revealed that the recovery of NHEJ events went from very low levels at low density to almost as high as SSA at an OD600 of 9, a nearly 50-fold increase (Fig 5A). Paradoxically, the recovery of SSA colonies did not change significantly. This might again be due to multiple plasmid uptake allowing for more than one chance for repair by SSA. Still other difficulties are that high culture density causes a refractoriness to transformation and an increased variability and also might have disproportionate effects on uncut as compared to linear DNA transformation. To minimize the impact of these issues, we plotted a larger data set collected over six independent experiments as the percentage of colonies that had repaired the plasmid by NHEJ (Fig 5B). In every experiment there was a large increase in the fractional recovery of NHEJ at high densities, in some cases as high as 40%. The most prominent upward inflection in the curve did not occur until more than one OD600 unit higher than the disappearance of the glucose, which, because cultures were dividing slowly at this point, represents a lag of many hours. However, the precise timing is difficult to establish with certainty due to the inherent variability in the measurement, and in some experiments the increase in NHEJ appeared to initiate soon after the diauxic shift. Conversely, high levels of thermotolerance were not observed at the OD600 values achieved in Fig 5B, i.e., those at which the yeast were still transformable, but did eventually reach as high as 70% at an OD600 of 14. Thus, an apparent increase in NHEJ efficiency occurred gradually during the period of postdiauxic growth leading into, but before, the stationary-phase transition.
|
Effect of carbon source on NHEJ efficiency: plasmid assay:
Because the increase in NHEJ was temporally related to the diauxic shift, we next directly tested the effect of carbon source on NHEJ efficiency. Wild-type cells were pregrown to exponential phase in YPAD and then washed into fresh YPA medium containing dextrose, acetate, glycerol, or ethanol as the carbon source. The fraction of colonies that had been repaired by NHEJ was determined after 5 and 24 hr further growth. At 5 hr all cultures had adapted to the new carbon source and begun dividing again. At 24 hr all were still dividing and none were stationary (which would have prevented transformation); the glucose culture was early postdiauxic (OD600 = 7.3). Each nonfermentable carbon source caused a clear increase in the fractional contribution of NHEJ in a time-dependent fashion as compared with glucose, with glycerol being the most effective (Fig 6). The transition to respiratory metabolism thus accelerated the development of increased NHEJ recovery.
|
The suicide deletion competitive chromosomal assay:
We sought to verify our results with another, more physiological, assay in which a discrete break is created in a chromosome by expressing a mega-endonuclease that cleaves a single natural or engineered site. A limitation of this approach is that NHEJ, unlike most engineered recombination events, almost always leads to the restoration of the original cleavage site by simple religation. The restored site is recleaved and therefore unstable in the face of continued endonuclease expression. Only rare imprecise joints that are no longer recognized by the endonuclease are recovered (![]()
![]()
![]()
|
Fig 7B shows the appearance of strains bearing the four basic suicide deletion alleles when plated to nonselective galactose medium. In addition to the observed toggling of colony colors conferred by frameshifting base pairs (compare the top and the bottom) and the dependence of the SSA events on the direct repeats (compare the left and the right), colonies whose color predicted that they resulted from NHEJ were readily recovered. Closer inspection revealed that many of these colonies were sectored. Consistent with this, the construct predicted to give ADE2 NHEJ events yielded a heterogeneous population of colony sizes when plated to galactose medium lacking adenine (not shown). We interpret this to indicate that a significant subset of NHEJ-repaired chromosomes are recleaved in the first few cell divisions, with secondary cell loss or repair by SSA, although the extent of this recleavage is clearly self-limited.
Extensive testing was performed to validate these predictions in wild-type strains. True suicide deletion events should lose the URA3 gene, and indeed <1% of both the predicted SSA and NHEJ events remained Ura+ (not shown). Also, all colonies were stable to repeated restreaking on galactose medium, with all now giving similar colony size and appearance regardless of their size on the primary plate. All events were therefore genetically stable, and the factors that gave rise to the initial NHEJ colony size heterogeneity did not persist. Direct examination of the ADE2 alleles in recovered colonies was performed by various means (summarized in Table 3). PCR using primers that flanked the cut sites (see Fig 7A) gave products in 23 of 24 NHEJ events whose size indicated that suicide deletion had in fact occurred and that could be recleaved in vitro by I-SceI. Reintroduction of a functioning I-SceI expression cassette into an independent set of 98 ADE2 NHEJ isolates, either by transformation with an expression plasmid or by mating to a strain bearing this plasmid, led to their conversion to ade2 98% of the time, which could occur only if the I-SceI site had in fact been recreated in an initial simple-religation NHEJ event. In all, there was again no difference between large and small NHEJ colonies or between strains containing or lacking the direct repeat.
Lack of competition between NHEJ and SSA: suicide deletion assay:
Table 4 shows the results of quantitative plating experiments comparing different suicide deletion alleles. Considering wild-type strains first, it was observed that 30% of cells survived by SSA when the direct repeat was provided. Most of the remaining 70% did not survive, which is most likely attributable to an imperfect efficiency of the SSA event. NHEJ accounted for the survival of
3%, however. The suicide deletion alleles mirrored the plasmid results in that the presence of the direct repeat had no effect on the NHEJ efficiency. Considering mutant strains, it was observed that the recovery of colonies predicted to arise by NHEJ was >84-fold decreased by a yku70 mutation. Similarly, SSA was 37-fold decreased by a rad52 mutation. This provides still further verification that the repair events were being executed by the predicted pathways. Although the predicted NHEJ events from the yku70 strain did not recreate an intact I-SceI site as uniformly as the wild-type strain, 90% nonetheless did, supporting previous plasmid results that some precise end rejoining is possible even in the absence of yku70, albeit with greatly reduced efficiency (Table 3; ![]()
Increased NHEJ efficiency in postdiauxic/stationary phase: suicide deletion assay:
Finally, we attempted to use the suicide deletion system to verify NHEJ enhancement in stationary-phase yeast. A difficulty is that growth on galactose is used to induce the DSB, which means that cells must either lose glucose repression or exit stationary phase prior to inducing the chromosome break. Some effect might nonetheless persist if the changes responsible for NHEJ enhancement are slow compared to the time required for activation of the GAL1-I-SceI-fusion gene. Cultures of wild-type yeast were plated to galactose from three growth conditions: exponential phase in YPAD, 2-day postdiauxic cultures, and 5-day stationary-phase cultures. In the last case, cultures were heated to 55° prior to plating to kill any cells that had not achieved stationary phase. It was not meaningful to normalize to glucose in this experiment because the inherent galactose plating efficiency, independent of any need for DSBR, is different for these source cultures. Results were therefore expressed as the percentage of colonies on galactose that had repaired the break by NHEJ. As seen in Table 5, the contribution of NHEJ was again lowest in exponential phase, rising in postdiauxic and stationary-phase cultures by three- and sixfold, respectively.
| DISCUSSION |
|---|
Repeat length and NHEJ fraction in the plasmid assay:
We have adapted our existing plasmid repair assay to examine the outcome of competition between simple-religation NHEJ and the SSA pathway of recombination. It was observed that a terminal repeat of 29 bp supported efficient SSA and a high rate of transformation that substantially exceeded that seen in the absence of a repeat. It is thus clear that most linear plasmids are not repaired when only NHEJ is possible. Coincidentally, ![]()
![]()
The suicide deletion assay for NHEJ:
![]()
The competitive end-binding model of DSBR pathway utilization:
Using the above systems, as well as ionizing radiation sensitivity, we have tested specific hypotheses regarding the basis for DSBR pathway utilization. Recent findings that Rad52 possesses DNA-end-binding activity suggest that it is the relative engagement of DNA ends by Rad52 or Ku proteins that represents the critical committed step (![]()
![]()
In the plasmid assay, it is impossible to say with certainty that the yku70 mutation did not increase SSA because of the relatively low contribution of NHEJ and the large standard error in the assay. In the suicide deletion assay, however, the mutation of YKU70 and RAD52 not only did not enhance the remaining pathway, but in fact led to an unexpectedly mild but reproducible reduction. The yku70 effect was surprising because this mutant shows increased rates of 5' resection (![]()
![]()
![]()
![]()
![]()
The cell-state-regulated model of pathway utilization:
Both recombination and NHEJ have assets and limitations. Although recombination is potentially highly accurate, the correct homologous donor must be readily available to prevent homeologous repair. In contrast, NHEJ uses less information in the repair of DSBs, being limited to that present in overhanging ends, and so has a higher potential to create small insertions and deletions. NHEJ is always feasible, however, since the only required substrate is the DSB itself. Given these considerations, it is predictable that cells should regulate the usage of each pathway so that they are active when they are most likely to promote accurate repair. Factors that favor recombination include a small nonrepetitive genome and the late S, G2, and M stages of the cell cycle when the sister chromatid is physically associated with the broken chromosome. In contrast, NHEJ may in fact become less prone to error in nuclei of G1 or nondividing cells with large and repetitive genomes where a homolog is not readily available. These predictions are borne out by the results presented here, as well as by others. It was necessary to go to great lengths to observe high fractional contributions of NHEJ in yeast, whereas higher eukaryotic cells are known to preferentially use NHEJ in repair of radiation-induced and other DSBs, at least in G1 (![]()
![]()
(i.e., haploid) cells, as opposed to MATa/MAT
(i.e., diploid cells; ![]()
![]()
![]()
Most strikingly, the apparent efficiency of NHEJ was consistently induced severalfold when cells left the exponential phase of fermentative growth and made the transition to respiratory metabolism and stationary phase. This finding requires careful scrutiny as it initially seems at odds with studies that have seen as much as 30% NHEJ of DSBs created by transient galactose-induced HO expression in dividing cells, where only a threefold further increase seems possible (![]()
![]()
![]()
If the observed increase in NHEJ event recovery were to reflect a true increase in NHEJ efficiency it should be biologically meaningful. By one logic, the need for induction of NHEJ should be the same for both G0 and G1 cells since each have only one copy of the chromosomes. On the other hand, there are clear differences in the population dynamics of dividing and nondividing cultures. In dividing cultures, not only are cells less likely to suffer damage in the absence of a homologous donor, given that a minority of cells are in G1/early S, but also loss of G1 cells that suffer infrequent DSBs would have only a small impact on the population growth. In contrast, G0 cells are at much greater risk of suffering damage irreparable by homologous recombination simply because they must persist in this state for a potentially prolonged period of nutritional deprivation. An increased likelihood of breakage may further be a consequence of the same environmental factors that led to nutritional deprivation in the first place. Moreover, since all cells in the environment will also be stationary, the population need for an appropriate G0 repair response is greater. It is thus conceivable that an adaptive pressure existed to promote evolution of more efficient NHEJ in stationary phase independently of mating-type regulation. In this view, increased NHEJ would simply be part of the stress responses induced by nutritional deprivation (![]()
![]()
In total, we believe that current evidence accumulated from several different experimental approaches here and elsewhere suggests an activation of NHEJ based on nutritional status that is consistent with the biology of the stationary phase, although the technical difficulties of examining DSBR efficiency in stationary phase make this conclusion preliminary. Clarification of this issue will require further elucidation of the nature of the regulatory proteins affecting NHEJ and their targets. One critical question will be to examine whether Nej1 is responsible for the G0 effect as it is for the mating-type effect, which would predict that NEJ1 should be responsive to nutritional status. Preliminary data from a comprehensive genetic screen executed using the suicide deletion approach argues against this, however, because mutants have been identified that fail stationary-phase induction of NHEJ and impair NHEJ additively with nej1, further lending support to the notion that mating type and growth status represent separable regulatory inputs to NHEJ (T. E. WILSON, unpublished results).
| ACKNOWLEDGMENTS |
|---|
We thank Shakuntala Fathepure for technical assistance in the early phases of this work. This work was supported in part by the Pew Scholars Program in the Biomedical Sciences of the Pew Charitable Trusts and Public Health Service grant CA-90911 (T.E.W.).
Manuscript received February 21, 2002; Accepted for publication April 18, 2002.
| LITERATURE CITED |
|---|
ARAVIND, L. and E. V. KOONIN, 2001 Prokaryotic homologs of the eukaryotic DNA-end-binding protein Ku, novel domains in the Ku protein and prediction of a prokaryotic double-strand break repair system. Genome Res. 11:1365-1374.
ASTROM, S. U., S. M. OKAMURA, and J. RINE, 1999 Yeast cell-type regulation of DNA repair. Nature 397:310.[Medline]
BRACHMANN, C. B., A. DAVIES, G. J. COST, E. CAPUTO, and J. LI et al., 1998 Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132.[Medline]
CLIKEMAN, J. A., G. J. KHALSA, S. L. BARTON, and J. A. NICKOLOFF, 2001 Homologous recombinational repair of double-strand breaks in yeast is enhanced by MAT heterozygosity through yKU-dependent and -independent mechanisms. Genetics 157:579-589.
DE JAGER, M., J. VAN NOORT, D. C. VAN GENT, C. DEKKER, and R. KANAAR et al., 2001 Human Rad50/Mre11 is a flexible complex that can tether DNA ends. Mol. Cell 8:1129-1135.[Medline]
DOHERTY, A. J., S. P. JACKSON, and G. R. WELLER, 2001 Identification of bacterial homologues of the Ku DNA repair proteins. FEBS Lett. 500:186-188.[Medline]
FAIRHEAD, C., B. LLORENTE, F. DENIS, M. SOLER, and B. DUJON, 1996 New vectors for combinatorial deletions in yeast chromosomes and for gap-repair cloning using split-marker recombination. Yeast 12:1439-1457.[Medline]
FERREIRA, M. G. and J. P. COOPER, 2001 The fission yeast Taz1 protein protects chromosomes from Ku-dependent end-to-end fusions. Mol. Cell 7:55-63.[Medline]
FRANK-VAILLANT, M. and S. MARCAND, 2001 NHEJ regulation by mating type is exercised through a novel protein, Lif2p, essential to the ligase IV pathway. Genes Dev. 15:3005-3012.
FUKUSHIMA, T., M. TAKATA, C. MORRISON, R. ARAKI, and A. FUJIMORI et al., 2001 Genetic analysis of the DNA-dependent protein kinase reveals an inhibitory role of Ku in late S-G2 phase DNA double-strand break repair. J. Biol. Chem. 276:44413-44418.
HEGDE, V. and H. KLEIN, 2000 Requirement for the SRS2 DNA helicase gene in non-homologous end joining in yeast. Nucleic Acids Res. 28:2779-2783.
HERRMANN, G., T. LINDAHL, and P. SCHAR, 1998 Saccharomyces cerevisiae LIF1: a function involved in DNA double-strand break repair related to mammalian XRCC4. EMBO J. 17:4188-4198.[Medline]
IVANOV, E. L., N. SUGAWARA, J. FISHMAN-LOBELL, and J. E. HABER, 1996 Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae.. Genetics 142:693-704.[Abstract]
JACKSON, S. P., 2001 Detecting, signalling and repairing DNA double-strand breaks. Biochem. Soc. Trans. 29:655-661.[Medline]
JOHNSTON, M. and R. W. DAVIS, 1984 Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae.. Mol. Cell. Biol. 4:1440-1448.
JONES, J. M., M. GELLERT, and W. YANG, 2001 A Ku bridge over broken DNA. Structure 9:881-884.[Medline]
KEGEL, A., J. O. SJOSTRAND, and S. U. ASTROM, 2001 Nej1p, a cell type-specific regulator of nonhomologous end joining in yeast. Curr. Biol. 11:1611-1617.[Medline]
KRAUS, E., W. Y. LEUNG, and J. E. HABER, 2001 Break-induced replication: a review and an example in budding yeast. Proc. Natl. Acad. Sci. USA 98:8255-8262.
LEE, S. E., R. A. MITCHELL, A. CHENG, and E. A. HENDRICKSON, 1997 Evidence for DNA-PK-dependent and -independent DNA double-strand break repair pathways in mammalian cells as a function of the cell cycle. Mol. Cell. Biol. 17:1425-1433.
LEE, S. E., J. K. MOORE, A. HOLMES, K. UMEZU, and R. D. KOLODNER et al., 1998 Saccharomyces Ku70, Mre11/Rad50 and RPA proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94:399-409.[Medline]
LEE, S. E., F. PACQUES, J. SYLVAN, and J. E. HABER, 1999 Role of yeast SIR genes and mating type in directing DNA double-strand breaks to homologous and non-homologous repair paths. Curr. Biol. 9:767-770.[Medline]
MOORE, J. K. and J. E. HABER, 1996 Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:2164-2173.
OOI, S. L., D. D. SHOEMAKER, and J. D. BOEKE, 2001 A DNA microarray-based genetic screen for nonhomologous end-joining mutants in Saccharomyces cerevisiae.. Science 294:2552-2556.
PAQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.. Microbiol. Mol. Biol. Rev. 63:349-404.
PETRINI, J. H., 1999 The mammalian Mre11-Rad50-Nbs1 protein complex: integration of functions in the cellular DNA-damage response. Am. J. Hum. Genet. 64:1264-1269.[Medline]
PIERCE, A. J., P. HU, M. HAN, N. ELLIS, and M. JASIN, 2001 Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15:3237-3242.
PLESSIS, A., A. PERRIN, J. E. HABER, and B. DUJON, 1992 Site-specific recombination determined by I-SceI, a mitochondrial group I intron-encoded endonuclease expressed in the yeast nucleus. Genetics 130:451-460.[Abstract]
RICHARDSON, C. and M. JASIN, 2000 Coupled homologous and nonhomologous repair of a double-strand break preserves genomic integrity in mammalian cells. Mol. Cell. Biol. 20:9068-9075.
SHINOHARA, A., M. SHINOHARA, T. OHTA, S. MATSUDA, and T. OGAWA, 1998 Rad52 forms ring structures and co-operates with RPA in single-strand DNA annealing. Genes Cells 3:145-156.[Abstract]
STASIAK, A. Z., E. LARQUET, A. STASIAK, S. MULLER, and A. ENGEL et al., 2000 The human Rad52 protein exists as a heptameric ring. Curr. Biol. 10:337-340.[Medline]
SUGAWARA, N. and J. E. HABER, 1992 Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation. Mol. Cell. Biol. 12:563-575.
SUGAWARA, N., G. IRA, and J. E. HABER, 2000 DNA length dependence of the single-strand annealing pathway and the role of Saccharomyces cerevisiae RAD59 in double-strand break repair. Mol. Cell. Biol. 20:5300-5309.
TAKATA, M., M. S. SASAKI, E. SONODA, C. MORRISON, and M. HASHIMOTO et al., 1998 Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J. 17:5497-5508.[Medline]
VALENCIA, M., M. BENTELE, M. B. VAZE, G. HERRMANN, and E. KRAUS et al., 2001 NEJ1 controls non-homologous end joining in Saccharomyces cerevisiae.. Nature 414:666-669.[Medline]
VANCE, J. R. and T. E. WILSON, 2001 Repair of DNA strand breaks by the overlapping functions of lesion-specific and non-lesion-specific DNA 3' phosphatases. Mol. Cell. Biol. 21:7191-7198.
VAN DYCK, E., A. Z. STASIAK, A. STASIAK, and S. C. WEST, 1999 Binding of double-strand breaks in DNA by human Rad52 protein. Nature 398:728-731.[Medline]
WERNER-WASHBURNE, M., E. BRAUN, G. C. JOHNSTON, and R. A. SINGER, 1993 Stationary phase in the yeast Saccharomyces cerevisiae.. Microbiol. Rev. 57:383-401.
WILSON, T. E., U. GRAWUNDER, and M. R. LIEBER, 1997 Yeast DNA ligase IV mediates non-homologous DNA end joining. Nature 388:495-498.[Medline]
WILSON, T. E. and M. R. LIEBER, 1999 Efficient processing of DNA ends during yeast nonhomologous end joining. Evidence for a DNA polymerase beta (Pol 4)-dependent(pathway. J. Biol. Chem. 274):23599-23609.
WINZELER, E. A., D. D. SHOEMAKER, A. ASTROMOFF, H. LIANG, and K. ANDERSON et al., 1999 Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285:901-906.
This article has been cited by other articles:
![]() |
M. S. Dillingham and S. C. Kowalczykowski RecBCD Enzyme and the Repair of Double-Stranded DNA Breaks Microbiol. Mol. Biol. Rev., December 1, 2008; 72(4): 642 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wu, L. M. Topper, and T. E. Wilson Recruitment and Dissociation of Nonhomologous End Joining Proteins at a DNA Double-Strand Break in Saccharomyces cerevisiae Genetics, March 1, 2008; 178(3): 1237 - 1249. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Wei and Y. S. Rong A Genetic Screen For DNA Double-Strand Break Repair Mutations in Drosophila Genetics, September 1, 2007; 177(1): 63 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Palancade, X. Liu, M. Garcia-Rubio, A. Aguilera, X. Zhao, and V. Doye Nucleoporins Prevent DNA Damage Accumulation by Modulating Ulp1-dependent Sumoylation Processes Mol. Biol. Cell, August 1, 2007; 18(8): 2912 - 2923. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Decottignies Microhomology-Mediated End Joining in Fission Yeast Is Repressed by Pku70 and Relies on Genes Involved in Homologous Recombination Genetics, July 1, 2007; 176(3): 1403 - 1415. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Clejan, J. Boerckel, and S. Ahmed Developmental Modulation of Nonhomologous End Joining in Caenorhabditis elegans Genetics, July 1, 2006; 173(3): 1301 - 1317. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pardo, E. Ma, and S. Marcand Mismatch Tolerance by DNA Polymerase Pol4 in the Course of Nonhomologous End Joining in Saccharomyces cerevisiae Genetics, April 1, 2006; 172(4): 2689 - 2694. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kegel, P. Martinez, S. D. Carter, and S. U. Astrom Genome wide distribution of illegitimate recombination events in Kluyveromyces lactis Nucleic Acids Res., March 20, 2006; 34(5): 1633 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Preston, C. C. Flores, and W. R. Engels Differential Usage of Alternative Pathways of Double-Strand Break Repair in Drosophila Genetics, February 1, 2006; 172(2): 1055 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Therizols, C. Fairhead, G. G. Cabal, A. Genovesio, J.-C. Olivo-Marin, B. Dujon, and E. Fabre Telomere tethering at the nuclear periphery is essential for efficient DNA double strand break repair in subtelomeric region J. Cell Biol., January 16, 2006; 172(2): 189 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Palmbos, J. M. Daley, and T. E. Wilson Mutations of the Yku80 C Terminus and Xrs2 FHA Domain Specifically Block Yeast Nonhomologous End Joining Mol. Cell. Biol., December 15, 2005; 25(24): 10782 - 10790. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Decottignies Capture of Extranuclear DNA at Fission Yeast Double-Strand Breaks Genetics, December 1, 2005; 171(4): 1535 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gonzalez-Barrera, A. Sanchez, J. F. Ruiz, R. Juarez, A. J. Picher, G. Terrados, P. Andrade, and L. Blanco Characterization of SpPol4, a unique X-family DNA polymerase in Schizosaccharomyces pombe Nucleic Acids Res., August 24, 2005; 33(15): 4762 - 4774. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Daley, R. L. V. Laan, A. Suresh, and T. E. Wilson DNA Joint Dependence of Pol X Family Polymerase Action in Nonhomologous End Joining J. Biol. Chem., August 12, 2005; 280(32): 29030 - 29037. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Daley and T. E. Wilson Rejoining of DNA Double-Strand Breaks as a Function of Overhang Length Mol. Cell. Biol., February 1, 2005; 25(3): 896 - 906. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. So, N. Adachi, M. R. Lieber, and H. Koyama Genetic Interactions between BLM and DNA Ligase IV in Human Cells J. Biol. Chem., December 31, 2004; 279(53): 55433 - 55442. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Della, P. L. Palmbos, H.-M. Tseng, L. M. Tonkin, J. M. Daley, L. M. Topper, R. S. Pitcher, A. E. Tomkinson, T. E. Wilson, and A. J. Doherty Mycobacterial Ku and Ligase Proteins Constitute a Two-Component NHEJ Repair Machine Science, October 22, 2004; 306(5696): 683 - 685. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Ferreira and J. P. Cooper Two modes of DNA double-strand break repair are reciprocally regulated through the fission yeast cell cycle Genes & Dev., September 15, 2004; 18(18): 2249 - 2254. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yu, K. Marshall, M. Yamaguchi, J. E. Haber, and C. F. Weil Microhomology-Dependent End Joining and Repair of Transposon-Induced DNA Hairpins by Host Factors in Saccharomyces cerevisiae Mol. Cell. Biol., February 1, 2004; 24(3): 1351 - 1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Rong and K. G. Golic The Homologous Chromosome Is an Effective Template for the Repair of Mitotic DNA Double-Strand Breaks in Drosophila Genetics, December 1, 2003; 165(4): 1831 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yu and A. Gabriel Ku-Dependent and Ku-Independent End-Joining Pathways Lead to Chromosomal Rearrangements During Double-Strand Break Repair in Saccharomyces cerevisiae Genetics, March 1, 2003; 163(3): 843 - 856. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kiechle, P. Manivasakam, F. Eckardt-Schupp, R. H. Schiestl, and A. A. Friedl Promoter-trapping in Saccharomyces cerevisiae by radiation-assisted fragment insertion Nucleic Acids Res., December 15, 2002; 30(24): e136 - e136. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Wilson A Genomics-Based Screen for Yeast Mutants With an Altered Recombination/End-Joining Repair Ratio Genetics, October 1, 2002; 162(2): 677 - 688. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Karathanasis, E.
- Articles by Wilson, T. E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Karathanasis, E.
- Articles by Wilson, T. E.















