Genetics, Vol. 161, 461-468, May 2002, Copyright © 2002

A 160-bp Palindrome Is a Rad50·Rad32-Dependent Mitotic Recombination Hotspot in Schizosaccharomyces pombe

Joseph A. Faraha, Edgar Hartsuikerb, Ken-ichi Mizunoc, Kunihiro Ohtac, and Gerald R. Smitha
a Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109-1024,
b Genome Damage and Stability Centre, University of Sussex, Falmer, Brighton BN1 9RR, United Kingdom
c Genetic Dynamics Research Unit-Laboratory, RIKEN Institute, Hirosawa 2-1, Wako, Saitama 351-01, Japan

Corresponding author: Gerald R. Smith, 1100 Fairview Ave. North, A1-162, P.O. Box 19024, Seattle, WA 98109-1024., gsmith{at}fhcrc.org (E-mail)

Communicating editor: L. S. SYMINGTON


*  ABSTRACT
*TOP
*ABSTRACT
*LITERATURE CITED

Palindromic sequences can form hairpin and cruciform structures that pose a threat to genome integrity. We found that a 160-bp palindrome (an inverted repeat of 80 bp) conferred a mitotic recombination hotspot relative to a control nonpalindromic sequence when inserted into the ade6 gene of Schizosaccharomyces pombe. The hotspot activity of the palindrome, but not the basal level of recombination, was abolished by a rad50 deletion, by a rad50S "separation of function" mutation, or by a rad32-D25A mutation in the nuclease domain of the Rad32 protein, an Mre11 homolog. We propose that upon extrusion of the palindrome the Rad50·Rad32 nuclease complex recognizes and cleaves the secondary structure thus formed and generates a recombinogenic break in the DNA.


DNA sequences that can adopt secondary structures can be unstable when present in the genome (LEACH 1994 Down). Mini-satellites such as CTG repeats that can adopt hairpin-like structures as well as palindromic sequences are unstable in the bacterium Escherichia coli, the yeast Saccharomyces cerevisiae, and humans (GORDENIN et al. 1993 Down; HENDERSON and PETES 1993 Down; RUSKIN and FINK 1993 Down; SARKAR et al. 1998 Down; RICHARD and PAQUES 2000 Down; BZYMEK and LOVETT 2001 Down; EDELMANN et al. 2001 Down). Instability of such structures can be deleterious, as observed in E. coli and humans (LEACH 1994 Down; EDELMANN et al. 2001 Down).

Depending on their size and their location in the genome, palindromic sequences display different degrees of stability and recombination stimulation. This behavior is thought to be dependent on their propensity to extrude and thereby form hairpin loops or cruciform structures. In S. cerevisiae, short palindromes (26 bp) appear not to extrude during vegetative growth and are infrequently repaired in heteroduplex DNA formed during meiotic recombination (NAG et al. 1989 Down). Palindromes of 60–160 bp (hereafter called middle-sized palindromes, or M-pals) are frequently excised from the genome during mitotic growth (GORDENIN et al. 1993 Down; HENDERSON and PETES 1993 Down; RUSKIN and FINK 1993 Down). This reaction depends on the presence of small (4–9 bp) direct repeats in the vicinity of the M-pals and on the replication machinery. A 140-bp M-pal is also a site of a DNA double-strand break (DSB) during meiosis in S. cerevisiae (NAG and KURST 1997 Down). Although longer palindromes (L-pals, or palindromes >600 bp) are mitotic recombination hotspots in S. cerevisiae, M-pals have not been reported to display such an activity (GORDENIN et al. 1993 Down; LOBACHEV et al. 1998 Down, LOBACHEV et al. 2000 Down; NASAR et al. 2000 Down). L-pal-dependent recombination hotspot activity in S. cerevisiae likely stems from the propensity of these sequences to extrude into hairpins or cruciforms and from their subsequent cleavage or processing by the Rad50·Mre11·Xrs2 complex (LOBACHEV et al. 2002 Down). M-pal mitotic instability as well as M-pal-dependent meiotic DSB formation in S. cerevisiae argue that these sequences do extrude during mitotic growth as well as during meiosis. These observations suggest that, in S. cerevisiae, an extruded M-pal either is not detected by the mitotic recombination machinery (including the Rad50· Mre11·Xrs2 complex) or is recognized and processed by a nonrecombinogenic pathway.

Since meiotic recombination displays important differences in Schizosaccharomyces pombe and in S. cerevisiae (FOX and SMITH 1998 Down; YOUNG et al. 2002 Down), we have compared the behavior of an M-pal in S. pombe with that reported in S. cerevisiae. We found, as in S. cerevisiae, that an M-pal conferred a meiotic recombination hotspot and led to meiotic DSB formation (J. A. FARAH, W. W. STEINER and G. R. SMITH, unpublished data). We report here that the M-pal was also a strong mitotic recombination hotspot in S. pombe in contrast to S. cerevisiae. This hotspot was dependent on the Rad50·Rad32 complex, a putative structure-specific nuclease.

Mitotic recombination associated with a 160-bp M-pal was measured both in a chromosome-by-chromosome system in diploid strains and in a plasmid-by-chromosome system in haploid strains. The alleles used are shown in Fig 1. Briefly, the ade6 alleles were constructed by inserting, at the unique BamHI site of the ade6 open reading frame, either one copy (the ade6-3034 control allele) or two copies in opposite orientation (the ade6-3036 M-pal allele) of an 80-bp oligonucleotide derived from the MATa locus of S. cerevisiae. These alleles were either integrated into the chromosomal ade6 locus or present on an S. pombe replicative plasmid. For scoring ade6+ recombinants these alleles were allowed to recombine with the ade6-469 allele present either on the pade6-469 plasmid in haploids (SZANKASI et al. 1988 Down) or on the homologous chromosome in diploids. Mitotic recombination rates were determined according to the method of the median (LEA and COULSON 1949 Down).



View larger version (19K):
In this window
In a new window
Download PPT slide
 
Figure 1. ade6 alleles used in this study. A 2859-bp PvuII-SpeI fragment containing the ade+ gene from pAS1 (SZANKASI et al. 1988 Down) was cloned into the EcoRV-SpeI sites of pKS(+) (Stratagene, La Jolla, CA) to give plasmid pJF63. One or two copies of an 80-bp oligonucleotide were inserted at the unique BamHI site of plasmid pJF63 to give plasmids pJF134 (ade6-3034 control) and pJF136 (ade6-3036 M-pal), respectively. The oligonucleotide corresponds to the mat-a-stk sequence from S. cerevisiae (positions 2044–2119 relative to GenBank sequence of the MATa locus; RAY et al. 1991 Down). The inserted DNA is not drawn to scale. Both alleles are Ade-. Primers oJF57 (5' TGCTTGGAAATGTAACGATGACAG 3') and oJF135 (5' TGAATGCATCGCAGAGTTGCAGGAG 3') were used for PCR analysis. To transfer the ade6-3034 and ade6-3036 alleles to the chromosome, HindIII fragments of 1801 bp (from pJF134) or 1881 bp (from pJF136) were purified and used to transform strain GP2638 to Ade6- (red on limiting adenine EMM2 plates; FOX et al. 1997 Down). To place the ade6-3034 and ade6-3036 alleles on an S. pombe replicative plasmid, SpeI-KpnI fragments of 3067 bp (ade6-3036 from plasmid pJF136) or 2987 bp (ade6-3034 from plasmid pJF134) were cloned into the BamHI-KpnI sites of vector pFY20 (noncompatible ends were blunted with the Klenow enzyme; LI et al. 1997 Down) to give plasmids pJF138 and pJF141, respectively. The ade6-469 allele is a C-to-T transition that creates a stop codon 1445 bp downstream from the BamHI M-pal insertion site (SZANKASI et al. 1988 Down).

We first determined mitotic recombination rates at ade6 in diploid rad+ strains. The ade6+ recombination rate in a strain containing the M-pal was 56-fold higher than that observed in a control strain: 280 recombination events per 106 cell divisions compared to 5 recombination events per 106 cell divisions for strains GP3486 (ade6-3036/ade6-469) and GP3484 (ade6-3034/ade6-469), respectively (Table 1 and Table 2). Similarly, the ade6+ recombination rate in a haploid strain containing the M-pal on the chromosome was ~54-fold higher than that observed in a control strain: 700 x 10-6 compared to 13 x 10-6 for strains GP3019 (ade6-3036 pade6-469) and GP3017 (ade6-3034 pade6-469), respectively (Table 2). The latter recombination rate was comparable to the rate previously determined with equivalently spaced single-base-pair markers in ade6 (~37 x 10-6; PONTICELLI et al. 1988 Down). A chromosomal ade6 allele with two copies of the 80-bp fragment in a direct repeat orientation was also devoid of hotspot activity in the chromosome-by-plasmid recombination assay in a haploid strain (data not shown). Hence, a 160-bp M-pal in the ade6 gene was a strong mitotic recombination hotspot in S. pombe.


 
View this table:
In this window
In a new window

 
Table 1. S. pombe strains


 
View this table:
In this window
In a new window

 
Table 2. M-pal-dependent recombination hotspot activity and rad gene dependence in diploid and haploid strains

We next tested whether the M-pal-dependent hotspot activity was observed when the M-pal was present on a multicopy plasmid in haploid strains. Plasmids pJF138 (ade6-3036 M-pal) and pJF141 (ade6-3034 control) were introduced into strain GP2947 (with the ade6-469 allele on the chromosome; Table 1). Transformants with the control plasmid (pJF141) showed a recombination rate at ade6 (~7 x 10-6) that was 4- to 19-fold lower than that of transformants with the M-pal-containing plasmid (pJF138; Table 3). M-pal transformant T1 gave a value of 135 x 10-6, while M-pal transformant T2 gave a recombination rate of 26 x 10-6.


 
View this table:
In this window
In a new window

 
Table 3. M-pal on a plasmid is a recombination hotspot

The nature of the difference between these two transformant types is not clear, but the higher-frequency T1 type is more common. Among 12 additional transformants, 11 behaved like T1 and one like T2. Upon extraction and analysis of plasmids from the T1-like and T2-like transformants, no restriction site or sequence differences could be detected between the two (data not shown). Transformants of strain GP2947 with the plasmids extracted from the T1-like and T2-like transformants showed ade6 recombination frequencies similar to those of T1. Hence, the difference in the recombination rates between T1 and T2 is not a heritable property of the plasmid; it may stem from an epigenetic change in the plasmid or a genetic change in the host strain upon the initial transformation. Nevertheless, the plasmid-borne M-pal was a mitotic recombination hotspot when present on an extrachromosomal plasmid.

In summary, the results of Table 2 and Table 3 clearly showed that, in an otherwise wild-type background, an M-pal was a mitotic recombination hotspot in S. pombe whether present on the chromosome or on a plasmid, although the hotspot activity was lower in the latter situation than in the former. These results suggest that the secondary structure adopted by the 160-bp M-pal is responsible for the observed hotspot activity at ade6.

One possibility is that the M-pal forms a hairpin structure that is recognized and cleaved by a nuclease, thus generating a recombinogenic lesion such as a DSB. In E. coli, palindrome-dependent inviability is dependent on the SbcCD complex (LEACH 1994 Down). This complex cleaves hairpin loops in vitro (CONNELLY et al. 1998 Down). A related complex in eukaryotes, Rad50·Mre11·Xrs2 (Nbs1), is involved in DNA-damage repair and meiotic recombination (JOHZUKA and OGAWA 1995 Down; HABER 1998 Down). The human Rad50·Mre11·Nbs1 complex and the yeast Rad50· Mre11 complex are also nucleases that cleave hairpin DNA in vitro (PAULL and GELLERT 1999 Down; TRUJILLO and SUNG 2001 Down). The overall architecture of these complexes involves the association of a structural-maintenance-of-chromosomes-type subunit (SbcC or Rad50) with a phosphoesterase enzyme (SbcD, Mre11, or Rad32, the S. pombe homolog; TAVASSOLI et al. 1995 Down; CONNELLY et al. 1998 Down; HOPFNER et al. 2001 Down).

The sequences of Mre11-related polypeptides from different species share four conserved esterase motifs; these motifs (I–IV) are important for nuclease activity in vitro (FURUSE et al. 1998 Down; USUI et al. 1998 Down; MOREAU et al. 1999 Down). Regardless of the severity of their mitotic phenotypes, all reported esterase-motif mutants accumulate unprocessed DSBs during meiosis (FURUSE et al. 1998 Down; USUI et al. 1998 Down; MOREAU et al. 1999 Down). This latter phenotype is reminiscent of that observed in the rad50S-K81I mutant of S. cerevisiae in which Lys-81 is changed to Ile (ALANI et al. 1990 Down; CAO et al. 1990 Down). Recently, S. pombe strains with the corresponding rad50-K81I (hereafter rad50S) allele were also found to accumulate meiotic DSBs as in S. cerevisiae (YOUNG et al. 2002 Down). The S. cerevisiae rad50S-K81I allele was thought to have minimal defects during vegetative growth (ALANI et al. 1990 Down), but a recent report showed that when recombination is induced on an inverted repeat substrate, the rad50S allele favors break-induced replication over DSB repair (RATTRAY et al. 2001 Down). On the three-dimensional structure of the Pyrococcus furiosus Rad50 ATP-binding domain, the rad50S mutations cluster to a region of the protein that may interact with other proteins (HOPFNER et al. 2000 Down).

An attractive view is that the S. pombe Rad50·Rad32 complex is directly responsible for the cleavage of the hairpin formed by the extrusion of the M-pal. Although a complex between Rad50 and Rad32 has not been reported in S. pombe, we infer such a complex by analogy to the S. cerevisiae and human homologs. We first tested whether the M-pal-dependent mitotic recombination hotspot was dependent on the Rad50 protein in S. pombe and found it to be (Table 2). In the M-pal haploid strain GP3127 (ade6-3036 rad50{Delta} pade6-469) the ade6+ recombination rate (13 x 10-6) was very close to those of the control strains GP3017 (ade6-3034 rad50+ pade6-469; 13 x 10-6) and GP3125 (ade6-3034 rad50{Delta} pade6-469; 16 x 10-6) with the nonpalindromic insertion at ade6. Hence, in the absence of the Rad50 protein, the hotspot activity of the M-pal was eliminated but the basal recombination rate was not greatly affected.

To test whether the M-pal-dependent hotspot was dependent on particular functions of the Rad50·Rad32 complex, we measured ade6+ recombination rates in the presence of the non-null alleles rad50S and rad32-D25A (with an Asp-to-Ala change at the highly conserved position 25 in esterase motif I). The M-pal-dependent hotspot effect, but not the basal recombination level, was abrogated in these two mutant backgrounds. The M-pal haploid strains GP3220 (ade6-3036 rad50S pade6-469) and GP3287 (ade6-3036 rad32-D25A pade6-469) showed ade6+ recombination rates of 19 x 10-6 and 11 x 10-6, respectively, which are not very different from the basal rates measured in the respective control strains GP3219 (ade6-3034 rad50S pade6-469; 10 x 10-6) and GP3285 (ade6-3034 rad32-D25A pade6-469; 15 x 10-6) with no M-pal. Similar results were also observed with diploid strains homozygous for the rad50S allele (Table 2). The M-pal-dependent recombination hotspot was eliminated in strain GP3601 (ade6-3036/ade6-469 rad50S/rad50S) with a recombination rate (11 x 10-6) similar to that of the control strain GP3600 (ade6-3034/ade6-469 rad50S/rad50S; 8 x 10-6).

Taken together, the above results suggest that a nuclease-proficient Rad50·Rad32 complex is necessary for the recombination hotspot activity of the M-pal inserted in the ade6 gene of S. pombe. Although the S. pombe Rad32-D25A polypeptide was not tested directly for nuclease activity in vitro, the S. cerevisiae Mre11-D16A polypeptide (with the same amino-acid change at the homologous position as in Rad32-D25A) shows no in vitro nuclease activity despite wild-type affinity for DNA binding (FURUSE et al. 1998 Down).

If the recombination hotspot is due indeed to nuclease cleavage of the M-pal and DSB formation at that site, one prediction, according to two DSB repair models (RESNICK 1976 Down; SZOSTAK et al. 1983 Down), is that the the M-pal allele should be a recipient of wild-type information when recombining nonreciprocally with the ade6-469 allele. Because the 102 ade6+ recombinants analyzed from strains GP3484 and GP3486 (experiment 1 of Table 4) segregated red colonies upon sporulation (data not shown), we conclude that these recombinants were heterozygous diploids (ade6+/ade6-). Since the majority of these had lost the insertion (see below), it is reasonable to assume that ade6+ recombinants derive from nonreciprocal recombination (gene conversion). We determined the frequency of conversion of the ade6-3036 (M-pal) and the ade6-3034 (control) alleles in rad+ diploid strains (Table 4). In strain GP3486 (ade6-3036/ade6-469), the M-pal allele was converted to wild type with a frequency of ~98%, significantly higher than the conversion of the ade6-3034 control allele in strain GP3484 (ade6-3034/ade6-469, 70%, contingency {chi}2 = 28, P << 0.001). The ade6+ conversion frequency in strain GP3484 (ade6-3034/ade6-469, 70%) was higher than 50%, the expected value if there were no bias for conversion between the two recombining alleles. One explanation for this bias could be due to the nature of the ade6-3034 allele, an insertion, that could be recognized and eliminated more efficiently than a point mutation in heteroduplex DNA by the mismatch repair or the nucleotide-excision repair machinery of the cell. Hence, the M-pal had a tendency to favor its own conversion to wild type as predicted.


 
View this table:
In this window
In a new window

 
Table 4. Inheritance of ade+ information in diploid strains

A second prediction is that in a rad mutant that abolishes the hotspot activity of the M-pal, the conversion frequency of both the M-pal and the control allele should be similar, with no preference for either being converted to wild type. This was indeed the case when conversion frequencies were determined in the diploid strains homozygous for rad50S (Table 4). Strain GP3601 (ade6-3036/ade6-469 rad50S/rad50S) converted the M-pal 67% of the time, a frequency similar to that of the control allele in strain GP3600 (ade6-3034/ade6-469 rad50S/rad50S, 53%, contingency {chi}2 = 3.5, 0.05 < P < 0.1). Hence, in the absence of hotspot activity the M-pal allele was not converted preferentially to wild type. These results strongly suggest that the Rad50·Rad32 complex recognizes and cleaves the extruded M-pal. The DSB ends thus formed are subsequently processed (by trimming the nonhomologous extremities) and recombined with a homologous sequence with concomitant loss (conversion) of the M-pal insertion. In the rad50S mutant, the Rad50S·Rad32 complex cannot cleave the extruded M-pal, thus eliminating both the hotspot activity and the preferential conversion of that allele.

The involvement of the nuclease activity of Mre11 in mitotic DNA repair and recombination has been questioned on the basis of results obtained with certain S. cerevisiae esterase motif mutants. Some of these mutants with an Mre11 polypeptide devoid of detectable nuclease activity in vitro have no defect in the mating-type conversion reaction and are significantly more resistant to ionizing radiation than mre11{Delta} strains (MOREAU et al. 1999 Down). However, we favor a direct role of the nuclease activity of the Rad50·Rad32 complex in the M-pal-dependent hotspot effect. The nuclease of the Rad50·Rad32 complex might be active on DNA substrates with secondary structures such as palindromes or microsatellites that might be rare in the genome but could form accidentally upon replication slippage or illegitimate recombination (MOORE et al. 1999 Down; RICHARD and PAQUES 2000 Down). Perhaps such sequences are processed by the nuclease activity of the Rad50·Rad32 complex in an attempt to overcome their deleterious effects (RICHARD et al. 2000 Down). In our system, where an artificial M-pal was introduced into the cell, this processing would result in the formation of a DSB at the M-pal and the recombination hotspot effect. Hence, one function of the Rad50·Rad32 complex could be to protect the genome from sequences that can form secondary structures known to cause genome instability.

The hotspot observed above could, however, be due to a less direct action of the Rad50·Rad32 complex on the M-pal. For instance, recombinogenic lesions could arise by a Rad50·Rad32-independent mechanism at the same rate on M-pal-containing and nonpalindromic alleles, but the subsequent processing of the lesion could favor recombination only with the M-pal-containing allele, thereby giving a higher recombination rate at ade6. In this case, it is reasonable to assume that the hotspot activity of the M-pal would be dependent on gene products acting at steps subsequent to the initial lesion. We therefore determined whether the hotspot effect of the M-pal depended on the rad51+ gene product (also called rhp51+; Table 2). The Rad51 protein is an S. pombe homolog of the S. cerevisiae Rad51 protein involved in DNA pairing and strand exchange between recombining DNA molecules, a step subsequent to the initial lesion (MURIS et al. 1993 Down; SUNG 1994 Down). The recombination rate in haploid strain GP3259 (ade6-3036 rad51{Delta} pade6-469; 50 x 10-6) was 14-fold lower than that in strain GP3019 (ade6-3036 rad51+ pade6-469; 700 x 10-6; Table 2) but still significantly higher than that in strain GP3216 (ade6-3034 rad51{Delta} pade6-469) with the nonpalindromic substrate, 3 x 10-6, near the limit of reliability. Hence, despite the dramatic decrease in the ade6 recombination rates in the rad51 deletion strains, an M-pal-dependent hotspot activity of at least 17-fold was still present in this genetic background. These results reinforce the notion that the Rad50·Rad32 complex acts directly on the secondary structure of the M-pal, perhaps by generating a lesion that is subsequently processed to a DSB.

In the model in Fig 2, opening of the DNA helix during DNA replication allows extrusion of the M-pal on the less processively synthesized lagging strand (TRINH and SINDEN 1991 Down). Such a structure, which could stall the replication machinery and lead to breakage of the replication fork, could be processed by structure-specific nucleases (LEACH 1994 Down). The Rad50·Rad32 complex may accomplish that task by first binding (step 1) and then cleaving (steps 2 and 3) the secondary structure. A DSB that is repaired by recombination with a sister chromatid with retention of the M-pal ensues, as has been inferred in E. coli (step 4; LEACH et al. 1997 Down). Alternatively, the DSB can be repaired by recombining at high rate with a homologous plasmid or chromosome, thus displaying the hotspot activity described above. In the rad50S background, we propose that the Rad50·Rad32 complex is not properly targeted or bound to the hairpin or is not active on it (block at step 1). Because rad50S cells show near normal vegetative growth in contrast to rad50 deletion strains (HARTSUIKER et al. 2001 Down; E. HARTSUIKER, unpublished observations), the Rad50S·Rad32 complex appears to fulfill most of its other tasks in the cell. Only when special DNA features such as M-pals or special recombination substrates are present in the genome does a rad50S strain display a noticeable phenotype during vegetative growth (this work and RATTRAY et al. 2001 Down). Alternatively, the Rad50 protein might control the nuclease activity of Rad32, and in the rad50S background a partial deficiency in that control might inhibit the activation of the nuclease at the M-pal, thus abrogating the hotspot. In the rad32-D25A background, the Rad50·Rad32 complex may bind to the hairpin but be unable to cleave or process it (block at step 2), thereby leaving this structure intact. Finally, in the rad51 deletion background, the main pathway for DNA pairing and strand exchange is abolished (step 4), but minor Rad51-independent pathways still allow some recombination to occur without affecting the hotspot activity that is dependent on earlier events (steps 2 and 3).



View larger version (19K):
In this window
In a new window
Download PPT slide
 
Figure 2. Model for the M-pal-induced recombination hotspot activity. During S phase the M-pal extrudes on the lagging DNA strand (LEACH 1994 Down). The Rad50· Rad32 complex recognizes (step 1) and binds to the secondary structure thus generated. The hairpin is cleaved (step 2) and processed (step 3) by the endonuclease activity of the Rad32 subunit, generating a DSB that can invade and recombine (step 4) with the replicated sister chromatid (sister chromatid recombination, SCR) or, when available, recombine with a homologous sequence on a plasmid or on a homolog. In the rad50S background, the Rad50S· Rad32 complex is unable to bind to or cut the hairpin (block of step 1 or 2) and hence no DSB is generated. In the rad32-D25A background, the Rad50·Rad32-D25A complex binds to the extruded M-pal, but no cleavage or processing ensues (block of steps 2 and 3). In the rad51 deletion background, the major pathway for strand exchange (step 4, thick arrow) is abrogated, but minor rad51-independent pathways (thin arrow) allow lower efficiency recombination. In blocking steps 1 or 2 lagging strand DNA synthesis is expected to be halted at the secondary structure and could resume either when the hairpin unfolds or when the replication machinery "slips" past it. In the latter case, the M-pal is expected to be deleted from the genome (but see text).

An additional issue is the stability of M-pals in S. pombe. In the budding yeast S. cerevisiae, M-pals are unstable during mitotic growth and are excised from a plasmid or from the chromosome at a high rate (HENDERSON and PETES 1993 Down; RUSKIN and FINK 1993 Down). The excision rate is increased in the presence of temperature-sensitive alleles of POL1 (encoding Pol{alpha}; RUSKIN and FINK 1993 Down) or POL3 (encoding Pol{delta}) at the semirestrictive temperature (GORDENIN et al. 1993 Down), suggesting that M-pal excision is intimately linked to replication on the lagging strand (MORRISON et al. 1990 Down).

To determine M-pal excision in S. pombe, we measured ade6+ reversion rates. Strains GP3017 (ade6-3034) and GP3019 (ade6-3036), with no plasmid present, were plated on Ade+ selective plates. For both strains, the ade6+ reversion rate was <1.3 x 10-8 (95% confidence limit). Hence, the M-pal seemed stable when present in the chromosome, although 4-bp direct repeats flanked the M-pal, and DNA polymerase slippage at these repeats was expected to restore a wild-type ade6+ sequence (RUSKIN and FINK 1993 Down). These 4-bp repeats might not be long enough, however, to allow polymerase slippage.

Although some biological processes are conserved between budding yeast and fission yeast, it is becoming increasingly clear that others are regulated differently despite conservation of the proteins involved (FORSBURG 1999 Down). The behavior of the M-pal may be an example of this difference: although the 160-bp M-pal is a meiotic hotspot and a site of meiotic DSB (J. A. FARAH, W. W. STEINER and G. R. SMITH, unpublished data), as expected from work in S. cerevisiae, a mitotic recombination hotspot at an M-pal has not been reported in the budding yeast.


*  ACKNOWLEDGMENTS

We thank Sue Amundsen, Luther Davis, Harmit Malik, Walt Steiner, and Andrew Taylor for critical reading of the manuscript, and R. Kraehenbuehl and Jürg Kohli for strains. This work was supported by National Institutes of Health grant GM-32194 to G. R. Smith.

Manuscript received October 1, 2001; Accepted for publication February 8, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*LITERATURE CITED

ALANI, E., R. PADMORE, and N. KLECKNER, 1990  Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61:419-436[Medline].

BZYMEK, M. and S. T. LOVETT, 2001  Evidence for two mechanisms of palindrome-stimulated deletions in Escherichia coli: single-strand annealing and replication slipped mispairing. Genetics 158:527-540[Abstract/Free Full Text].

CAO, L., E. ALANI, and N. KLECKNER, 1990  A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae.. Cell 61:1089-1101[Medline].

CONNELLY, J. C., L. A. KIRKHAM, and D. R. F. LEACH, 1998  The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. Proc. Natl. Acad. Sci. USA 95:7969-7974[Abstract/Free Full Text].

CUMMINS, J. E. and J. M. MITCHISON, 1967  Adenine uptake and pool formation in the fission yeast Schizosaccharomyces pombe.. Biochim. Biophys. Acta 136:108-120[Medline].

EDELMANN, L., E. SPITERI, K. KOREN, V. PULIJAAL, and M. G. BIALER et al., 2001  AT-rich palindromes mediate the constitutional t(11;22) translocation. Am. J. Hum. Genet. 68:1-13[Medline].

FORSBURG, S. L., 1999  The best yeast? Trends Genet. 15:340-344[Medline].

FOX, M. E., and G. R. SMITH, 1998 Control of meiotic recombination in Schizosaccharomyces pombe, pp. 345–378 in Progress in Nucleic Acid Research and Molecular Biology, edited by K. MOLDAVE. Academic Press, New York.

FOX, M. E., J. B. VIRGIN, J. METZGER, and G. R. SMITH, 1997  Position- and orientation-independent activity of the Schizosaccharomyces pombe meiotic recombination hot spot M26.. Proc. Natl. Acad. Sci. USA 94:7446-7451[Abstract/Free Full Text].

FURUSE, M., Y. NAGASE, H. TSUBOUCHI, K. MURAKAMI-MUROFUSHI, and T. SHIBATA et al., 1998  Distinct roles of two separable in vitro activities of yeast Mre11 in mitotic and meiotic recombination. EMBO J. 17:6412-6425[Medline].

GORDENIN, D. A., K. S. LOBACHEV, N. P. DEGTYAREVA, A. L. MALKOVA, and E. PERKINS et al., 1993  Inverted DNA repeats: a source of eukaryotic genomic instability. Mol. Cell. Biol. 13:5315-5322[Abstract/Free Full Text].

HABER, J. E., 1998  The many interfaces of Mre11. Cell 95:583-586[Medline].

HARTSUIKER, E., E. VAESSEN, A. M. CARR, and J. KOHLI, 2001  Fission yeast Rad50 stimulates sister chromatid recombination and links cohesion with repair. EMBO J. 20:6660-6671[Medline].

HENDERSON, S. T. and T. D. PETES, 1993  Instability of a plasmid-borne inverted repeat in Saccharomyces cerevisiae.. Genetics 133:57-62.

HOPFNER, K.-P., A. KARCHER, D. S. SHIN, L. CRAIG, and L. M. ARTHUR et al., 2000  Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily. Cell 101:789-800[Medline].

HOPFNER, K.-P., A. KARCHER, L. CRAIG, T. T. WOO, and J. P. CARNEY et al., 2001  Structural biochemistry and interaction architecture of the DNA double-strand break repair Mre11 nuclease and Rad50-ATPase. Cell 105:473-485[Medline].

JOHZUKA, K. and H. OGAWA, 1995  Interaction of Mre11 and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae.. Genetics 139:1521-1532[Abstract].

LEA, D. E. and C. A. COULSON, 1949  The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-285.

LEACH, D. R. F., 1994  Long DNA palindromes, cruciform structures, genetic instability and secondary structure repair. Bioessays 16:893-900[Medline].

LEACH, D. R. F., E. A. OKELY, and D. J. PINDER, 1997  Repair by recombination of DNA containing a palindromic sequence. Mol. Microbiol. 26:597-606[Medline].

LI, Y. F., M. NUMATA, W. P. WAHLS, and G. R. SMITH, 1997  Region-specific meiotic recombination in S. pombe: the rec11 gene. Mol. Microbiol. 5:869-878.

LOBACHEV, K. S., B. M. SHOR, H. T. TRAN, W. TAYLOR, and J. D. KEEN et al., 1998  Factors affecting inverted repeat stimulation of recombination and deletion in Saccharomyces cerevisiae.. Genetics 148:1507-1524[Abstract/Free Full Text].

LOBACHEV, K. S., J. E. STENGER, O. G. KOZYREVA, J. JURKA, and D. A. GORDENIN et al., 2000  Inverted Alu repeats unstable in yeast are excluded from the human genome. EMBO J. 19:3822-3830[Medline].

LOBACHEV, K. S., D. A. GORDENIN, and M. A. RESNICK, 2002  The Mre11 complex is required for repair of hairpin-capped double-strand breaks and prevention of chromosome rearrangements. Cell 108:183-193[Medline].

MOORE, H., P. W. GREENWELL, C. P. LIU, N. ARNHEIM, and T. D. PETES, 1999  Triplet repeats form secondary structures that escape DNA repair in yeast. Proc. Natl. Acad. Sci. USA 96:1504-1509[Abstract/Free Full Text].

MOREAU, S., J. R. FERGUSON, and L. S. SYMINGTON, 1999  The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol. Cell. Biol. 19:556-566[Abstract/Free Full Text].

MORRISON, A., H. ARAKI, A. B. CLARK, R. K. HAMATAKE, and A. SUGINO, 1990  A third essential DNA polymerase in S. cerevisiae.. Cell 62:1143-1151[Medline].

MURIS, D. F., K. VREEKEN, A. M. CARR, B. C. BROUGHTON, and A. R. LEHMAN et al., 1993  Cloning the RAD51 homolog of Schizosaccharomyces pombe.. Nucleic Acids Res. 21:4586-4591[Abstract/Free Full Text].

NAG, D. K. and A. KURST, 1997  A 140-bp-long palindromic sequence induces double-strand breaks during meiosis in the yeast Saccharomyces cerevisiae.. Genetics 146:835-847[Abstract].

NAG, D. K., M. A. WHITE, and T. D. PETES, 1989  Palindromic sequences in heteroduplex DNA inhibit mismatch repair in yeast. Nature 340:318-320[Medline].

NASAR, F., C. JANKOWSKI, and D. K. NAG, 2000  Long palindromic sequences induce double-strand breaks during meiosis in yeast. Mol. Cell. Biol. 20:3449-3458[Abstract/Free Full Text].

PAULL, T. T. and M. GELLERT, 1999  Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13:1276-1288[Abstract/Free Full Text].

PONTICELLI, A. S., E. P. SENA, and G. R. SMITH, 1988  Genetic and physical analysis of the M26 recombination hotspot of Schizosaccharomyces pombe.. Genetics 119:491-497[Abstract/Free Full Text].

RATTRAY, A. J., C. B. MCGILL, B. K. SHAFER, and J. N. STRATHERN, 2001  Fidelity of mitotic double-strand-break repair in Saccharomyces cerevisiae: a role for SAE2/COM1.. Genetics 158:109-122[Abstract/Free Full Text].

RAY, B. L., C. I. WHITE, and J. E. HABER, 1991  Heteroduplex formation and mismatch repair of the "Stuck" mutation during mating-type switching in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:5372-5380[Abstract/Free Full Text].

RESNICK, M. A., 1976  The repair of double-strand breaks in DNA: a model involving recombination. J. Theor. Biol. 59:97-106[Medline].

RICHARD, G.-F. and F. PÂQUES, 2000  Mini- and microsatellite expansions: the recombination connection. EMBO Rep. 1:122-126[Medline].

RICHARD, G.-F., G. M. GOELLNER, C. T. MCMURRAY, and J. E. HABER, 2000  Recombination-induced CAG trinucleotide repeat expansions in yeast involve the MRE11-RAD50-XRS2 complex. EMBO J. 19:2381-2390[Medline].

RUSKIN, B. and G. R. FINK, 1993  Mutations in POL1 increase the mitotic instability of tandem inverted repeats in Saccaromyces cerevisiae.. Genetics 134:43-56[Abstract].

SARKAR, P. S., H.-C. CHANG, and S. REDDY, 1998  CTG repeats show bimodal amplification in E. coli.. Cell 95:531-540[Medline].

SUNG, P., 1994  Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science 265:1241-1243[Abstract/Free Full Text].

SZANKASI, P., W. D. HEYER, P. SCHUCHERT, and J. KOHLI, 1988  DNA sequence analysis of the ade6 gene of Schizosaccharomyces pombe: wild-type and mutant alleles including the recombination hotspot allele ade6-M26.. J. Mol. Biol. 204:917-925[Medline].

SZOSTAK, J. W., T. L. ORR-WEAVER, R. J. ROTHSTEIN, and F. W. STAHL, 1983  The double-strand-break repair model for recombination. Cell 33:25-35[Medline].

TAVASSOLI, M., M. SHAYEGHI, A. NASIM, and F. Z. WATTS, 1995  Cloning and characterization of the Schizosaccharomyces pombe rad32 gene: a gene required for repair of double strand breaks and recombination. Nucleic Acids Res. 23:383-388[Abstract/Free Full Text].

TRINH, T. Q. and R. R. SINDEN, 1991  Preferential DNA secondary structure mutagenesis in the lagging strand of replication in E. coli.. Nature 352:544-547[Medline].

TRUJILLO, K. M. and P. SUNG, 2001  DNA structure-specific nuclease activities in the Saccharomyces cerevisiae Rad50·Mre11 complex. J. Biol. Chem. 276:35458-35464[Abstract/Free Full Text].

USUI, T., T. OHTA, H. OSHIUMI, J.-I. TOMIZAWA, and H. OGAWA et al., 1998  Complex formation and functional versatility of Mre11 of budding yeast in recombination. Cell 95:705-716[Medline].

YOUNG, J. A., R. W. SCHRECKHISE, W. W. STEINER, and G. R. SMITH, 2002  Meiotic recombination remote from prominent DNA break sites in S. pombe. Mol. Cell 9:253-263[Medline].




This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
G.-F. Richard, A. Kerrest, and B. Dujon
Comparative Genomics and Molecular Dynamics of DNA Repeats in Eukaryotes
Microbiol. Mol. Biol. Rev., December 1, 2008; 72(4): 686 - 727.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Voineagu, V. Narayanan, K. S. Lobachev, and S. M. Mirkin
Replication stalling at unstable inverted repeats: Interplay between DNA hairpins and fork stabilizing proteins
PNAS, July 22, 2008; 105(29): 9936 - 9941.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Olson, C. J. Nievera, E. Liu, A. Y.-L. Lee, L. Chen, and X. Wu
The Mre11 Complex Mediates the S-Phase Checkpoint through an Interaction with Replication Protein A
Mol. Cell. Biol., September 1, 2007; 27(17): 6053 - 6067.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. A. Farah, G. Cromie, L. Davis, W. W. Steiner, and G. R. Smith
Activation of an Alternative, Rec12 (Spo11)-Independent Pathway of Fission Yeast Meiotic Recombination in the Absence of a DNA Flap Endonuclease
Genetics, December 1, 2005; 171(4): 1499 - 1511.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. K. Nag, M. Fasullo, Z. Dong, and A. Tronnes
Inverted repeat-stimulated sister-chromatid exchange events are RAD1-independent but reduced in a msh2 mutant
Nucleic Acids Res., September 15, 2005; 33(16): 5243 - 5249.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. You, C. Chahwan, J. Bailis, T. Hunter, and P. Russell
ATM Activation and Its Recruitment to Damaged DNA Require Binding to the C Terminus of Nbs1
Mol. Cell. Biol., July 1, 2005; 25(13): 5363 - 5379.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
W. W. Steiner and G. R. Smith
Optimizing the Nucleotide Sequence of a Meiotic Recombination Hotspot in Schizosaccharomyces pombe
Genetics, April 1, 2005; 169(4): 1973 - 1983.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. A. Farah, G. Cromie, W. W. Steiner, and G. R. Smith
A Novel Recombination Pathway Initiated by the Mre11/Rad50/Nbs1 Complex Eliminates Palindromes During Meiosis in Schizosaccharomyces pombe
Genetics, March 1, 2005; 169(3): 1261 - 1274.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
G. A. Cromie, C. A. Rubio, R. W. Hyppa, and G. R. Smith
A Natural Meiotic DNA Break Site in Schizosaccharomyces pombe Is a Hotspot of Gene Conversion, Highly Associated With Crossing Over
Genetics, February 1, 2005; 169(2): 595 - 605.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. J. Rattray
A method for cloning and sequencing long palindromic DNA junctions
Nucleic Acids Res., November 8, 2004; 32(19): e155 - e155.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. J. Raynard and M. D. Baker
Cis-acting regulatory sequences promote high-frequency gene conversion between repeated sequences in mammalian cells
Nucleic Acids Res., November 4, 2004; 32(19): 5916 - 5927.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. K. Nag, M. Suri, and E. K. Stenson
Both CAG repeats and inverted DNA repeats stimulate spontaneous unequal sister-chromatid exchange in Saccharomyces cerevisiae
Nucleic Acids Res., October 19, 2004; 32(18): 5677 - 5684.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
G. R. Smith, M. N. Boddy, P. Shanahan, and P. Russell
Fission Yeast Mus81{middle dot}Eme1 Holliday Junction Resolvase Is Required for Meiotic Crossing Over but Not for Gene Conversion
Genetics, December 1, 2003; 165(4): 2289 - 2293.
[Abstract] [Full Text] [PDF]


Home page
Int. J. Syst. Evol. Microbiol.Home page
R. B. Moore, K. M. Ferguson, W. K. W. Loh, O. Hoegh-Guldberg, and D. A. Carter
Highly organized structure in the non-coding region of the psbA minicircle from clade C Symbiodinium
Int J Syst Evol Microbiol, November 1, 2003; 53(6): 1725 - 1734.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Ueno, T. Nakazaki, Y. Akamatsu, K. Watanabe, K. Tomita, H. D. Lindsay, H. Shinagawa, and H. Iwasaki
Molecular Characterization of the Schizosaccharomyces pombe nbs1+ Gene Involved in DNA Repair and Telomere Maintenance
Mol. Cell. Biol., September 15, 2003; 23(18): 6553 - 6563.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Tomita, A. Matsuura, T. Caspari, A. M. Carr, Y. Akamatsu, H. Iwasaki, K.-i. Mizuno, K. Ohta, M. Uritani, T. Ushimaru, et al.
Competition between the Rad50 Complex and the Ku Heterodimer Reveals a Role for Exo1 in Processing Double-Strand Breaks but Not Telomeres
Mol. Cell. Biol., August 1, 2003; 23(15): 5186 - 5197.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
L. S. Symington
Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair
Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 630 - 670.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. J. Yanez and A. C. G. Porter
A chromosomal position effect on gene targeting in human cells
Nucleic Acids Res., November 15, 2002; 30(22): 4892 - 4901.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. de Jager and R. Kanaar
Genome instability and Rad50S: subtle yet severe
Genes & Dev., September 1, 2002; 16(17): 2173 - 2178.
[Full Text] [PDF]