Functional Characterization of the Adenylyl Cyclase Gene sgs-1 by Analysis of a Mutational Spectrum in Caenorhabditis elegans

Corresponding author: Ronald H. A. Plasterk, Centre for Biomedical Genetics, Uppsalalaan 8, 3584 CT, Utrecht, The Netherlands., plasterk{at}niob.knaw.nl (E-mail)

Communicating editor: P. ANDERSON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The sgs-1 (suppressor of activated G_s) gene encodes one of the four adenylyl cyclases in the nematode C. elegans and is most similar to mammalian adenylyl cyclase type IX. We isolated a complete loss-of-function mutation in sgs-1 and found it to result in animals with retarded development that arrest in variable larval stages. sgs-1 mutant animals exhibit lethargic movement and pharyngeal pumping and (while not reaching adulthood) have a mean life span that is >50% extended compared to wild type. An extensive set of reduction-of-function mutations in sgs-1 was isolated in a screen for suppressors of a neuronal degeneration phenotype induced by the expression of a constitutively active version of the heterotrimeric G_s subunit of C. elegans. Although most of these mutations change conserved residues within the catalytic domains of sgs-1, mutations in the less-conserved transmembrane domains are also found. The sgs-1 reduction-of-function mutants are viable and have reduced locomotion rates, but do not show defects in pharyngeal pumping or life span.

ADENYLYL cyclases convert intracellular adenosine triphosphate (ATP) into cyclic adenosine monophosphate (cAMP), a major second messenger in the cell that regulates many cellular processes. Mammalian membrane-bound adenylyl cyclases consist of a short cytoplasmic N-terminal sequence, a six-transmembrane-spanning region (M1), and a cytoplasmic catalytic domain (C1), followed by a second six-transmembrane-spanning region (M2) and a second cytoplasmic catalytic domain (C2). The C1 and C2 domains together form the catalytic core of the protein. The first 200–250 amino acids of each catalytic domain (the C1a and C2a regions) are similar to each other and to the catalytic domains of other adenylyl and guanylyl cyclases. In mammals, nine different types of adenylyl cyclase genes have been reported, all of which are directly activated by the heterotrimeric G-protein -subunit G_s. In addition, certain adenylyl cyclases can be regulated by G_i, Gß, calcineurin, calmodulin, protein kinase A, protein kinase C, and forskolin (reviewed in HURLEY 1999 ; SIMONDS 1999 ; PATEL et al. 2001 ).

We have previously reported that the Caenorhabditis elegans adenylyl cyclase SGS-1 (suppressor of activated G_s) is a downstream target of the C. elegans G_s subunit in motoneurons (KORSWAGEN et al. 1998 ): mutations in SGS-1 suppress the neuronal degeneration induced by a constitutively activating mutation in G_s (BERGER et al. 1998 ; KORSWAGEN et al. 1998 ). In humans, activating mutations in G_s are implicated in pituitary and thyroid malignancies (LANDIS et al. 1989 ; LYONS et al. 1990 ) and endocrine disorders (SHENKER et al. 1993 ; IIRI et al. 1994 ). SGS-1 has significant sequence similarity to mammalian membrane-bound adenylyl cyclases and is most similar to the divergent type IX mammalian adenylyl cyclase. Human adenylyl cyclase type IX is predominantly expressed in vital organs, including brain, heart, and pancreas (PATERSON et al. 2000 ). The sgs-1 gene is ubiquitously expressed in the nervous system and muscle cells of C. elegans (BERGER et al. 1998 ; KORSWAGEN et al. 1998 ). A second adenylyl cyclase gene in C. elegans, acy-2, shows a more restricted expression pattern (KORSWAGEN et al. 1998 ). This gene is not involved in G_s-induced neuronal degeneration, but probably has an essential function together with G_s in the canal-associated neurons of C. elegans (KORSWAGEN et al. 1998 ).

Over the last decade, great effort has been undertaken to understand the catalytic mechanism of adenylyl cyclase and its regulation. Most studies have focused on the function of the highly conserved catalytic domains, and several residues that are important for catalytic activity (TANG et al. 1992 , TANG et al. 1995 ; LIU et al. 1997 ; YAN et al. 1997B ; ZIMMERMANN et al. 1998B ), G_s binding (YAN et al. 1997A ; ZIMMERMANN et al. 1998A ), G_i binding (DESSAUER et al. 1998 ), forskolin stimulation (YAN et al. 1998 ), and ATP binding (DESSAUER et al. 1997 ) have been determined, mainly through in vitro studies. In addition, the determination of the crystal structure of the catalytic domains of adenylyl cyclase (TESMER et al. 1997 , TESMER et al. 1999 ) has provided new insight into the catalytic mechanism and the key residues for catalytic activity and binding of its regulators. The function of the two transmembrane domains of adenylyl cyclase is less well understood. A recent study has now revealed that these domains interact with each other persistently and that this interaction plays a critical role in the targeting and functional assembly of adenylyl cyclase (GU et al. 2001 ); thus, these domains are very important for the proper functioning of the protein.

In this study, we show that sgs-1 is an essential gene and that sgs-1 is involved in behaviors such as locomotion and pharyngeal pumping. To identify new residues in sgs-1 that are important for normal response to G_s, we performed a genetic screen for suppressors of the activated G_s-induced neuronal degeneration. In total, we identified 14 residues in sgs-1 that can be mutated to suppress the neuronal degeneration. Ten of these residues are located in the catalytic domains of sgs-1, but four mutations in the transmembrane domains were also found. Although none of the mutations are located in the proposed active site of the protein, we show here that catalytic activity of sgs-1 is required for G_s-induced neuronal degeneration.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Nematode strains and culturing:
All strains were maintained as described by LEWIS and FLEMING 1995 . DNA transformations by microinjection in C. elegans were as described by MELLO and FIRE 1995 . Strains used in this study were Bristol N2, CB1282 (dpy-20(e1282) IV), NL545 (dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (KORSWAGEN et al. 1997 ), NL585 (sgs-1(pk301) III, dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (KORSWAGEN et al. 1998 ), NL586 (sgs-1(pk310) III, dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (KORSWAGEN et al. 1998 ), NL597 (sgs-1(pk384) III, dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (KORSWAGEN et al. 1998 ), NL1250 (mut-2(r459) I; sgs-1(pk450::Tc1) III) (KORSWAGEN et al. 1998 ), NL3200 (sgs-1(pk1279)/+ III; dpy-20(e1282) IV), and NL3224 (sgs-1(pk1279) dpy-17(+)/sgs-1(+) dpy-17(e164) III; pkIs296[hsp::gsa-1QL dpy-20(+)] X). sgs-1 alleles pk484, pk487, pk862, pk866, pk867, pk871, pk875, pk880, pk884, pk886, pk904, pk907, and pk927 were generated in an NL545 background in this study.

Isolation of an sgs-1 knockout animal:
We used the outer primers delsgs1-9 GGCGGAAAAGTTGAAAATGA and delsgs1-10 TGCAATGCTTCTCACCTGTC and the nested primers delsgs1-11 CACGTGAAGGAGGTGGAAGT and delsgs1-12 CTGGTTTTTGTGCTGGGACT, spanning a genomic region of 4.1 kb, to screen for deletion derivatives of pk450::Tc1 (ZWAAL et al. 1993 ), a transposon insertion in the ninth exon of sgs-1 (KORSWAGEN et al. 1998 ). A 2.9-kb deletion derivative of pk450::Tc1, sgs-1(pk1279), was isolated and could not be maintained as a homozygote. The sgs-1(pk1279) PCR product was isolated from gel and sequenced to determine the deletion end points. The following sequence in capitals was found around the deletion site: (5'-TGGAAGTAatacagat-gtgaccacTATCTTTA-3'). The pk1279 allele was backcrossed four times to an N2 background and then crossed with CB164 (dpy-17(e164) III), resulting in strain NL1999 sgs-1(pk1279)/dpy-17(e164). One-fourth of the progeny of NL1999 sgs-1 (pk1279)/dpy-17(e164) arrested in larval development, and we confirmed by PCR that these are homozygous for sgs-1(pk1279) (data not shown). The homozygous pk1279 phenotype was rescued with a wild-type sgs-1 genomic construct, pRP1522 (KORSWAGEN et al. 1998 ). This construct was injected at a concentration of 50 µg/ml together with 100 µg/ml pMH86 (HAN and STERNBERG 1991 ) in CB1282, and the transgenic array was crossed in NL3200 (sgs-1(pk1279)/+ III; dpy-20 (e1282) IV). A rescuing strain, NL3212 (sgs-1(pk1279) III; dpy-20(e1282) IV; pkEx1288[sgs-1(+) dpy-20(+)]), which does not segregate viable Dpy-20 worms, was obtained. Single worm PCR confirmed homozygosity for the pk1279 allele (data not shown).

Isolation of suppressors of the activated G_s-induced neuronal degeneration:
The screen that was used to identify suppressors of the activated G_s phenotype was a modified version of an earlier described screen (KORSWAGEN et al. 1998 ). L4 NL545 animals were treated with 50 mM EMS in M9 buffer for 4 hr, washed, and seeded at 40–60 animals per 9-cm nematode growth medium (NGM) agar plate. The F₂ generation was synchronized using NaOCl bleaching, and L1 larvae were heat-shocked for 2 hr at 33° to induce expression of pkIs296. The animals that grew out to adults were again synchronized using NaOCl bleaching, and L1 larvae were heat-shocked for 2 hr at 33° to induce expression of pkIs296. Animals that did not show neuronal degeneration were collected. sgs-1 alleles were identified by complementation testing.

Activated G_s-induced neuronal degeneration:
The activated G_s-induced pattern of neuronal cell death was measured as described in KORSWAGEN et al. 1997 . Synchronized L1-L2 larvae were heat-shocked for 2 hr at 33° and after 24 hr the neuronal degeneration pattern was examined in at least 20 animals using a high-powered dissection microscope (Wild M3C). Animals that did not show 100% suppression of the neuronal degeneration were further examined using a Nomarski microscope (Zeiss Axioskop 2): the total number of degenerated neurons was determined in 20 animals. The percentage suppression was calculated by comparing this number with the total number of degenerated neurons in NL545 (dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (100% degeneration) and NL586 (sgs-1(pk310) III; dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20(+)] X) (100% suppression). Statistics were calculated using directed Student's t-tests.

sgs-1(pk1279) trans experiments:
NL1999 sgs-1(pk1279)/dpy-17(e164) males were crossed with Bristol N2 hermaphrodites and with homozygous sgs-1 mutants. 40 L1 progeny were picked and their growth was followed. After 1-week of growth at 20°, we checked for the presence of the sgs-1(pk1279) allele by PCR.

Construction and expression of a catalytically inactive sgs-1 mutant:
SGS-1 R1187A was constructed by PCR using primers R1187-1 TGCTAGCGCAATGTACAGCAC and R1187-2 GCTGTACATTGCGCTAGCAATG containing the mutation. The PCR fragment was cloned into a 15.6-kb NheI-BspEI fragment of pRP1522 (KORSWAGEN et al. 1998 ), giving rise to SGS-1 R1187A. The cloned PCR fragment was sequenced completely and found to be free of errors. SGS-1 R1187A was injected at the same concentration as the wild-type SGS-1 construct pRP1522 (50 µg/ml; KORSWAGEN et al. 1998 ) together with the markers pRF6 (100 µg/ml; KRAMER et al. 1990 ) and pRP2017 (gpb-2::gfp; 50 µg/ml; VAN DER LINDEN et al. 2001 ) in N2 animals. Three independent SGS-1 R1187 transgenic lines and two independent wild-type SGS-1 transgenic lines were crossed in NL3224 and examined for their rescue of the larval lethality and suppression of the neuronal degeneration.

Behavioral assays:
Life span was determined by transferring L1-L2 larvae individually to plates 24 hr after synchronization using NaOCl bleaching. The animals were incubated at 20° and monitored once daily until death. Day of synchronization was used as the first time point. The animals were transferred to fresh plates once in 2 days while producing eggs to keep them separate from their progeny. Animals were scored as dead when they stopped moving and no longer responded to prodding the head (KENYON et al. 1993 ). Mean life spans were compared by using Student's t-test assuming unequal variances.

Pharyngeal pumping rates were determined by measuring the number of pumps per minute. Animals that had been raised for 96 hr after synchronization using NaOCl bleaching were placed on NGM agar plates seeded with OP50. Ten animals for each genotype were scored for 2 min and each animal was scored twice. Statistics were calculated by using directed Student's t-tests.

Movement levels were determined by measuring thrashing levels. One thrash is defined as one change in direction of bending at the mid-body (MILLER et al. 1996 ). Animals were synchronized using NaOCl bleaching and were raised at 20° for 96 hr after synchronization using NaOCl. An animal was placed in microtiter plates with 50 µl M9 and allowed to recover for 2 min. Subsequently, thrashes were counted for 2 min. Ten animals were examined for each genotype. Statistics were calculated by using directed Student's t-tests.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

sgs-1 is essential for viability:
A transposon-based method (ZWAAL et al. 1993 ) was used to isolate a deletion allele of sgs-1, sgs-1(pk1279). As shown in Fig 1A, 2.9 kb of sgs-1 sequence is deleted in this allele, thereby removing exon 8 up to exon 13. Nearly one-half of the sgs-1 coding sequence is removed, including the complete second transmembrane and second catalytic domain. Therefore, it is highly likely that pk1279 is a null allele. Animals homozygous for pk1279 undergo severely retarded development (Fig 1B). All animals passed the first larval stage, but arrested and died in one of the later larval stages. The length of embryogenesis in pk1279 homozygotes was comparable to Bristol N2 animals, and pk1279 homozygotes were morphologically normal at hatching (results not shown). The pk1279 homozygotes showed reduced body-wall muscle activity (Fig 1C) and pharyngeal muscle activity (Fig 1D). We also observed difficulties with molting (Fig 1E). In spite of these developmental abnormalities, pk1279 animals had an extended life span: they lived >50% longer than the wild type (Fig 1F).

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Phenotypes of sgs-1(pk1279) animals. (A) Genomic representation of the sgs-1 gene showing the deleted region in pk1279. GENEFINDER prediction of the sgs-1 coding sequence was confirmed by sequencing of random and oligo(dT) primed cDNA amplified by reverse transcriptase PCR (KORSWAGEN et al. 1998 ). (B) The development of the sgs-1(pk1279) animal (arrowhead) is compared with similarly aged Bristol N2 animal. (C) Movement levels of N2, sgs-1(pk1279) animals and sgs-1(pk1279) pkEx1228[sgs-1(+)] animals were assayed 96 hr after synchronization. Each bar represents the average of 10 animals. The error bars represent the standard error of the mean (SEM). Differences between N2 and sgs-1(pk1279) were analyzed using Student's t-test. sgs-1 (pk1279) animals are significantly different for movement when compared with N2 animals (P < 0.001). (D) Pharyngeal pumping levels of N2, sgs-1(pk1279) animals and sgs-1(pk1279) pkEx1288[sgs-1(+)] animals were assayed 96 hr after synchronization. Each bar represents the average of 20 determinations. The error bars represent the SEM. Differences between N2 and sgs-1(pk1279) were analyzed using Student's t-test. sgs-1(pk1279) animals are significantly different with respect to pharyngeal pumping when compared with N2 animals (P < 0.001). (E) In many sgs-1(pk1279) animals, a cuticular plug is attached to the mouth opening. (F) The percentage of worms alive on a given day after synchronization: N2, sgs-1(pk1279) animals and sgs-1(pk1279) pkEx1288[sgs-1(+)] animals. Mean life spans ± SEM, with sample size in parentheses, are 18.0 ± 0.8 (56), 27.9 ± 2.8 (32), and 19.0 ± 1.0 (27), respectively. Significance levels were calculated using Student's t-test. sgs-1(pk1279) lived significantly longer than the wild-type strain (P < 0.001), whereas there was no significant difference between N2 and sgs-1(pk1279) pkEx1288[sgs-1(+)] animals (P = 0.42).

Rescue of the larval lethality was obtained with an extrachromosomal array containing pRP1522, a 14-kb subclone containing the entire sgs-1 gene (KORSWAGEN et al. 1998 ). The rescued sgs-1(pk1279) transgenic animals were used to address whether maternally provided sgs-1 mRNA or protein is needed for development. Extrachromosomal arrays are unstable and can be lost during meiosis and mitosis (STINCHCOMB et al. 1985 ; MELLO and FIRE 1995 ). This results in mosaic expression of the transgene as it is lost in certain cells and cell lineages. Rescued sgs-1(pk1279) transgenic animals that lost the rescuing transgene in the germ line will have progeny that lack both sgs-1 transgene expression and sgs-1 expression in the form of maternal inheritance of sgs-1 mRNA or protein (ZWAAL et al. 1996 ). Of the rescued pk1279 animals, 1–2% segregated only arrested larvae that were identical to the arrested larvae segregated by heterozygous pk1279 animals. We did not observe any brood consisting of animals with a phenotype more severe than that of the arrested larvae. This result suggests that zygotic sgs-1 performs an essential function during development and that the ability to develop into larva is not the result of the presence of maternal sgs-1 mRNA or protein.

sgs-1 mutants are suppressors of activated G_s-induced neuronal degeneration:
sgs-1 mutants were initially selected as suppressors of activated G_s-induced neuronal degeneration (BERGER et al. 1998 ; KORSWAGEN et al. 1998 ). The neuronal degeneration phenotype is already visible in the first larval stage, and it is therefore possible to test the sgs-1 knockout animals for suppression of this neuronal degeneration phenotype. Animals homozygous for the null allele pk1279 that express the activated G_s from a heat-shock promoter did not show neuronal degeneration. Thus, sgs-1(pk1279) is a suppressor of the activated G_s-induced neuronal degeneration (Table 1). In screens for suppressors of the activated G_s phenotype, we have now obtained a set of 23 sgs-1 alleles (Table 1), of which 7 were described earlier (KORSWAGEN et al. 1998 ). The sgs-1 alleles were isolated with a frequency of 1 in 50,000 mutagenized genomes; they are all homozygous viable and recessive for the suppression of the activated G_s phenotype. We conclude from the viability of these sgs-1 alleles that they are not complete loss-of-function alleles, but partial reduction-of-function alleles. All 23 sgs-1 alleles were sequenced and mutations were found in all alleles, except allele pk310, which was not studied further (Table 1). In three independent alleles (pk311, pk474, and pk871), an identical splice donor site mutation in the first catalytic domain was found. One allele (pk862) contained a mutation 39 bp upstream of the ATG. In 18 independent alleles, mutations were found that change 14 distinct (mostly conserved) amino acids. Most mutations that were found to suppress the activated G_s phenotype were located in one of the conserved regions of the catalytic domains of sgs-1, suggesting that catalytic activity of SGS-1 is needed for the activated G_s phenotype. The mutations that did not map in the conserved regions of the catalytic domains were located in the first transmembrane domain (pk393, pk884, pk363, pk863, and pk866) or at the border of the second transmembrane domain and the nonconserved region of the second catalytic domain (pk907).

SGS-1 mutations are not located in the active site:
The availability of the crystal structure of the catalytic domains of adenylyl cyclase (TESMER et al. 1997 , TESMER et al. 1999 ) has made it possible to map the mutations in the catalytic domains of sgs-1 to the crystal structure. This analysis revealed that none of the 10 residues mutated in the catalytic domains of sgs-1 was located in the proposed active site of the protein (Fig 2). Two of the mutated amino acids (G1068 and R1074) were located at the interaction interface with G_s. It has been shown for mammalian adenylyl cyclases that mutations in the amino acid analogous to R1074 result in decreased binding to G_s, with a consequent decrease in activation (YAN et al. 1997A ; ZIMMERMANN et al. 1998A ). This suggests that in the mutants G1068R and R1074K suppression of the neuronal degeneration is the result of decreased binding to G_s. The remaining eight mutated amino acids were distributed over the structure and were changed to larger residues (L314F, L347F, A374V, H455Y, and S457F) or to residues that no longer make contact with the backbone or side chain of other amino acids (M411I, S1109N, and R1216H). Biochemical analysis of mammalian adenylyl cyclase type II with a mutation analogous to R1216H has shown that mutation of this amino acid does not result in gross structural alterations (DESSAUER et al. 1997 ). This suggests that R1216H has a specific effect on adenylyl cyclase activity or regulation.

View larger version (57K): [in this window] [in a new window] [Download PPT slide]   Figure 2. Structural representation of the residues that are changed in sgs-1 mutants. Complex of Gs (red) with the catalytic domains of mammalian adenylyl (TESMER et al. 1997 , TESMER et al. 1999 ). Green, the C1a domain from adenylyl cyclase V; cyan, the C2 domain from adenylyl cyclase II; yellow, the residues that are changed in sgs-1 mutants mapped on their analogous residues in the crystal structure. Forskolin (FSK) and adenosine 5'-( thio)-triphosphate (ATP) are located in the active site of the enzyme. Modeling was done using RasMol.

Catalytic activity of sgs-1 is necessary for induction of neuronal degeneration:
Induction of activated G_s in an sgs-1 null background did not result in neuronal degeneration, showing that sgs-1 is essential for this process. Indeed, overexpression of the wild-type sgs-1 allele in sgs-1(pk1279) animals both rescued the lethal phenotype and restored the neuronal degeneration phenotype upon induction of activated G_s (Fig 3A). Since none of the sgs-1 reduction-of-function mutations directly affected the active site of the SGS-1 protein, we asked whether catalytic activity of SGS-1 is required for the activated G_s-induced neuronal degeneration. We constructed a point mutation in the active site of SGS-1 (SGS-1 R1187A). R1187 is the residue analogous to R1029 of mammalian type II adenylyl cyclase. R1029 of type II adenylyl cyclase is an important residue for catalysis, and it was shown that changing this residue into an alanine reduces catalysis by 30-fold, but does not cause gross structural alterations (YAN et al. 1997B ). To our surprise, overexpression of the SGS-1 R1187 mutant into sgs-1(pk1279) animals rescued the lethality of these animals, most probably due to residual catalytic activity (YAN et al. 1997B ). However, we found that this residual activity was not sufficient for the induction of neuronal degeneration, as these animals looked completely wild type upon induction of activated G_s expression (Fig 3B). We conclude from this result that a mutation in the active site suppresses the activated G_s-induced neuronal degeneration and that catalytic activity of sgs-1 is required for the neuronal degeneration phenotype. Probably, mutations in the active site are not found in our screen for suppressors of the neuronal degeneration because these mutations are lethal. However, we cannot exclude other explanations for the fact that we have not found these mutations in our screen.

View larger version (146K): [in this window] [in a new window] [Download PPT slide]   Figure 3. Catalytically inactive SGS-1 does not rescue the suppression of activated Gs-induced neuronal degeneration. (A) sgs-1(pk1279) pkIs296[hsp::gsa-1QL] animal expressing pkEx1353[sgs-1(+)] shows neuronal degeneration (arrowheads) after induction of activated Gs by 2 hr of heat shock at 33°. (B) sgs-1(pk1279) pkIs296[hsp::gsa-1QL] animal expressing pkEx1348[sgs-1R1187A] does not show neuronal degeneration after induction of activated Gs by 2 hr of heat shock at 33°.

sgs-1 alleles form an allelic series:
Most sgs-1 alleles, including the null allele pk1279, showed 100% suppression of the activated G_s-induced neuronal degeneration. However, three alleles, pk384 (G1068R), pk867 (M411I), and pk884 (P152S), showed <100% suppression: a few neurons were degenerated in most animals (Table 1). This suggests that the SGS-1 protein is less disturbed in these alleles than in the other alleles. These alleles had mutations in different domains of the SGS-1 protein, and thus there was no correlation between the activity of the mutant proteins and the position of their mutations. Animals heterozygous for pk1279 suppressed the activated G_s-induced neuronal degeneration weakly: they showed a slight reduction in the number of degenerated neurons induced by activated G_s expression compared to homozygous sgs-1(+) animals (Table 1). A possible explanation for this observation is that in these animals, sgs-1 activity is reduced due to the presence of only one functional copy and that in a small percentage of neurons the sgs-1 activity is reduced to a level that is too low to induce neuronal degeneration.

We were also able to detect variation in SGS-1 activity among the different sgs-1 alleles when we placed all alleles in trans to pk1279 (Table 1). Most heterozygous animals grew normally. However, animals that had allele pk301 (S457F), pk484 (S1109N), or pk907 (E992K) in trans to pk1279 did not show normal growth: their phenotype was an intermediate form between wild-type and homozygous pk1279 animals. These results suggest that the SGS-1 protein was more affected in pk301, pk484, and pk907 than in the other alleles. The growth defect of pk484/pk1279 and pk907/pk1279 animals is more severe than the growth defect in pk301/pk1279 animals, indicating that pk484 and pk907 are the most severe alleles of sgs-1. Both these alleles have mutations in the part of sgs-1 that is deleted in sgs-1(pk1279). We cannot exclude that certain alleles with a mutation in the part of sgs-1 that is not deleted in sgs-1(pk1279) experience intragenic complementation when placed in trans to sgs-1(pk1279) and therefore have a less severe phenotype than pk484 and pk907. When we placed sgs-1(pk484) (S1109N), which has a point mutation in the second catalytic domain, in trans to sgs-1(pk301) (S457F), sgs-1 (pk487) (L314F), sgs-1(pk867) (M411I), or sgs-1(pk880) (A374V), which are all mutated in the first catalytic domain, we did not observe an enhancement of the neuronal degeneration phenotype after expression of the activated G_s from heat shock. This indicates that there is no intragenic complementation between the different sgs-1 reduction-of-function mutants.

sgs-1 reduction-of-function mutants have a normal life span and pharyngeal pumping rates, but reduced locomotion rates:
Observation of the sgs-1(pk1279) allele suggests that SGS-1 is involved in locomotion and pharyngeal pumping and life span determination. We measured these three phenotypes in two additional sgs-1 reduction-of-function alleles, one strong sgs-1 allele (pk484) and one weak sgs-1 allele (pk867). We found that there was no difference compared to the background strain for either life span (Fig 4A) or pharyngeal pumping (Fig 4B). This indicates that in these mutants the remaining SGS-1 activity is sufficient for normal function in these processes. Since sgs-1(pk484) is the strongest sgs-1 reduction-of-function allele, it is not likely that any of the other sgs-1 reduction-of-function alleles will show effects on either life span or pharyngeal pumping. The locomotion rate, however, was reduced in the two sgs-1 reduction-of-function mutants tested (Fig 4C), indicating that in these sgs-1 reduction-of-function mutants, SGS-1 activity is not sufficient for wild-type locomotion. The locomotion rate of sgs-1(pk484) was significantly less than the locomotion rate of sgs-1(pk867). This confirms that the allelic series showed that sgs-1(pk484) is a more severe allele than sgs-1(pk867). Since sgs-1(pk867) is one of the weakest alleles we have, probably all sgs-1 reduction-of-function alleles will show reduced locomotion rates. Indeed, sgs-1(pk904) (R1074K) animals also showed significantly reduced locomotion rates compared to the background strain (results not shown). In mammalian adenylyl cyclases, mutation of the amino acid analogous to R1074 was shown to result in decreased binding of G_s, but in normal regulation by G_i or the adenylyl cyclase activator forskolin (YAN et al. 1997A ; ZIMMERMANN et al. 1998A ). This suggests that the reduced locomotion of sgs-1(pk904) animals is the result of decreased response to G_s and thus that G_s functions together with SGS-1 in locomotion. We did not observe any other obvious defects in development or behavior in the sgs-1 reduction-of-function alleles.

View larger version (13K): [in this window] [in a new window] [Download PPT slide]   Figure 4. Phenotypes of sgs-1 reduction-of-function animals. sgs-1(pk484) and sgs-1(pk867) were backcrossed two times to NL545 (dpy-20(e1362) IV; pkIs296[hsp::gsa-1QL dpy-20 (+)]X), the background strain in which these alleles were generated. (A) The percentage of worms alive on a given day after synchronization: () NL545, () sgs-1(pk484) animals, and (X) sgs-1(pk867) animals. Mean life spans ± SEM, with sample size in parentheses, are 17.1 ± 0.7 (29), 17.0 ± 0.6 (32), and 16.0 ± 0.8 (29), respectively. Significance levels were calculated using Student's t-test. There was no significant difference between NL545 and sgs-1(pk484) (P = 0.91) or sgs-1(pk867) (P = 0.14). (B) Pharnygeal pumping levels of () NL545, () sgs-1 (pk484) animals, and () sgs-1(pk867) animals were assayed 96 hr after synchronization. Each bar represents the average of 20 determinations. The error bars represent the SEM. Significance levels were calculated using Student's t-test. There was no significant difference between NL545 and sgs-1(pk484) (P = 0.076) or sgs-1(pk867) (P = 0.80). (C) Movement levels of () NL545, () sgs-1(pk484) animals, and () sgs-1(pk867) animals were assayed 96 hr after synchronization. Each bar represents the average of 10 animals. The error bars represent the SEM. Differences between the different genotypes for the movement levels were analyzed using Student's t-test. NL545 animals are significantly different with respect to movement levels when compared to sgs-1(pk484) (P < 0.001) or sgs-1(pk867) (P = 0.048). In addition, sgs-1(pk484) animals are significantly different with respect to movement when compared to sgs-1(pk867) (P < 0.001).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

sgs-1 is an essential gene:
Adenylyl cyclases have complex functions and integrate and respond to diverse extracellular and intracellular signals. Genetic and biochemical evidence indicates that both catalytic domains (C1 and C2) are essential for high enzymatic activity (TANG and GILMAN 1995 ). In this study, we have isolated a deletion allele of an adenylyl cyclase of C. elegans, sgs-1(pk1279), in which part of the nonconserved first catalytic domain (C1b) and the complete second transmembrane (M2) and second catalytic domain (C2) of the SGS-1 protein are removed. Therefore, pk1279 is likely to be a null allele. Deletion of sgs-1 results in retarded development and eventually in larval lethality. This larval lethal phenotype is different from the larval lethal phenotype of knockout animals for gsa-1 (KORSWAGEN et al. 1997 ), the heterotrimeric G_s subunit that acts directly upstream of SGS-1 (KORSWAGEN et al. 1998 ). This suggests that SGS-1 is not the only downstream target of G_s. Presumably, ACY-2, a second adenylyl cyclase protein in C. elegans that shows a more limited expression pattern than sgs-1, is one of the other targets of G_s (KORSWAGEN et al. 1998 ), since acy-2 null mutant animals have a larval lethal phenotype similar to gsa-1 null mutants. Two additional genes encode adenylyl cyclases in the C. elegans genome, acy-3 (located on chromosome V, our unpublished observation) and acy-4 (located on chromosome III, C44F1.5; C. ELEGANS SEQUENCING CONSORTIUM 1998). Little is known about the role played by these molecules in G_s signaling.

sgs-1 is required for pharyngeal pumping and affects life span:
Pharyngeal pumping is disturbed in homozygous sgs-1(pk1279) animals, indicating that SGS-1 is required for proper functioning of the pharynx. SGS-1 is a downstream target of G_s, but it is not known whether G_s is also involved in pharyngeal pumping. It is therefore possible that in the pharynx, SGS-1 is regulated by a protein other than G_s. In several homozygous sgs-1 (pk1279) animals the molting process was not completed, since a cuticular plug remains attached to the mouth opening. The pharynx plays an important role in the molting process (SINGH and SULSTON 1978 ), suggesting that the pharyngeal defects seen in sgs-1 deletion animals account for the incomplete molting. sgs-1 reduction-of-function mutants do not have pharyngeal defects, and we do not observe difficulties with molting in these mutants.

We observed that loss of sgs-1 significantly lengthens life span: sgs-1(pk1279) mutants live >50% longer than wild-type animals. Lakowski and co-workers showed that eat mutants, which have defects in pharyngeal function, have significantly increased mean and maximum life span because of food restriction (LAKOWSKI and HEKIMI 1998 ). Furthermore, it has been shown that signals from the reproductive system influence the life span of an animal (HSIN and KENYON 1999 ). sgs-1 mutants have both pharyngeal defects and a defective reproductive system, and we therefore suggest that the extended life span is the result of these phenotypes. This is further supported by the fact that sgs-1 reduction-of-function mutants do not show pharyngeal or reproductive system defects and that their life span is comparable with the background strain. However, it is also possible that sgs-1 has a direct effect on life span.

SGS-1 and G_s function together in locomotion:
Recent studies have shown that two G-protein -subunit genes in C. elegans, goa-1 (G_o) and egl-30 (G_q), are involved in a complex signaling network that regulates locomotion (HAJDU-CRONIN et al. 1999 ; LACKNER et al. 1999 ; MILLER et al. 1999 ; NURRISH et al. 1999 ; CHASE et al. 2001 ; ROBATZEK et al. 2001 ; VAN DER LINDEN et al. 2001 ). Loss of function of goa-1 results in increased locomotion rates (MENDEL et al. 1995 ; SEGALAT et al. 1995 ), whereas reduction of function of egl-30 results in decreased locomotion rates (BRUNDAGE et al. 1996 ). These G-protein pathways regulate diacylglycerol levels in an antagonistic manner (LACKNER et al. 1999 ; MILLER et al. 1999 ), either stimulating or inhibiting acetylcholine release through the diacylglycerol-binding protein, UNC-13. Our results show that there is yet another G-protein signaling cascade involved in locomotion: G_s signals to the adenylyl cyclase SGS-1 to regulate locomotion. The GOA-1-GL-30 network is shown to act in ventral nerve cord motoneurons (LACKNER et al. 1999 ; MILLER et al. 1999 ). sgs-1 and gsa-1 (G_s) are both expressed in ventral nerve cord motor neurons and in body-wall muscle cells. It is therefore possible that the G_s–SGS-1 pathway acts in parallel to the GOA-1-EGL-30 network in motor neurons, but it is also possible that the G_s–SGS-1 pathway acts downstream of the GOA-1–EGL-30 network in the body-wall muscles. In the latter hypothesis, acetylcholine release at the neuromuscular junction regulated by EGL-30 and GOA-1 possibly results in regulation of G_s in muscle cells.

sgs-1 reduction-of-function mutants reveal important residues in the adenylyl cyclase gene:
Several studies have been performed to identify residues that are involved in the catalytic mechanism of adenylyl cyclase and its regulation. However, none of these studies was performed in a complex organism, and in only one study, using the Dictyostelium discoideum adenylyl cyclase ACA, were mutations in the transmembrane domains described (PARENT and DEVREOTES 1995 ). Here, we have used a genetic selection system in a complex organism, C. elegans, that identified mutations in both the catalytic and transmembrane domains of the adenylyl cyclase gene. sgs-1 is an essential gene, and therefore only mutations that do not completely disrupt sgs-1 function were isolated. Out of the 14 residues that were mutated, 10 residues were located in the catalytic domains. All, except L314, are conserved residues between different adenylyl cyclases. Only 2 of the conserved residues, R1074 and R1216H, were described in other studies, and there it was shown by biochemical analysis that mutation of these residues does not result in gross structural alterations (DESSAUER et al. 1997 ; YAN et al. 1997A ; ZIMMERMANN et al. 1998A ). Further studies should reveal whether, in the other sgs-1 reduction-of-function alleles, the reduced sgs-1 activity is the result of a defect in a specific function of the protein or the result of improper folding or instability of the protein.

Four mutations revealed residues that are important for a normal response to G_s, but that are not located in one of the catalytic domains. Three of these residues (G68, P152, and G181) are located in the first transmembrane domain, and one (E992) is located at the border of the second transmembrane domain and the nonconserved part of the second catalytic domain. Recently, it was shown that the transmembrane domains interact persistently and are involved in two important processes, namely, the proper localization of the protein in the membrane and functional assembly of the two catalytic domains (GU et al. 2001 ). It is possible that our transmembrane mutants are disturbed in the localization of the adenylyl cyclase gene, as was shown for the Dictyostelium ACA mutants in the transmembrane domain (PARENT and DEVREOTES 1995 ), but it is also possible that in these mutants the two catalytic domains are not correctly assembled and therefore result in reduced adenylyl cyclase activity. Further studies should reveal, for each of these transmembrane domain mutants, which of these two possibilities is correct. In summary, our study shows not only that C. elegans can be used to study gene function, but also that it can be a powerful tool to study protein domain function.

	ACKNOWLEDGMENTS

We thank Stephen Wicks, Edwin Cuppen, and Hendrik C. Korswagen for critically reading the manuscript and Titia Sixma for assistance with the structural analysis. The Caenorhabditis Genetics Center provided some of the strains used in this study. This work was supported by the Netherlands Organization for Scientific Research (NWO), grant 901-04-094.

Manuscript received September 4, 2001; Accepted for publication February 14, 2002.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

BERGER, A. J., A. C. HART, and J. M. KAPLAN, 1998  G_s-induced neurodegeneration in Caenorhabditis elegans.. J. Neurosci. 18:2871-2880[Abstract/Free Full Text].

BRUNDAGE, L., L. AVERY, A. KATZ, U. J. KIM, and J. E. MENDEL et al., 1996  Mutations in a C. elegans G_q gene disrupt movement, egg laying, and viability. Neuron 16:999-1009[Medline].

Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2018[Abstract/Free Full Text].

CHASE, D. L., G. A. PATIKOGLOU, and M. R. KOELLE, 2001  Two RGS proteins that inhibit G_o and G_q signaling in C. elegans neurons require a Gß₅-like subunit for function. Curr. Biol. 11:222-231[Medline].

DESSAUER, C. W., T. T. SCULLY, and A. G. GILMAN, 1997  Interactions of forskolin and ATP with the cytosolic domains of mammalian adenylyl cyclase. J. Biol. Chem. 272:27787-27795[Abstract/Free Full Text].

DESSAUER, C. W., J. J. TESMER, S. R. SPRANG, and A. G. GILMAN, 1998  Identification of a G_i binding site on type V adenylyl cyclase. J. Biol. Chem. 273:25831-25839[Abstract/Free Full Text].

GU, C., A. SORKIN, and D. M. COOPER, 2001  Persistent interactions between the two transmembrane clusters dictate the targeting and functional assembly of adenylyl cyclase. Curr. Biol. 11:185-190[Medline].

HAJDU-CRONIN, Y. M., W. J. CHEN, G. PATIKOGLOU, M. R. KOELLE, and P. W. STERNBERG, 1999  Antagonism between G_o and G_q in Caenorhabditis elegans: The RGS protein EAT-16 is necessary for G_o signaling and regulates G_q activity. Genes Dev. 13:1780-1793[Abstract/Free Full Text].

HAN, M. and P. W. STERNBERG, 1991  Analysis of dominant-negative mutations of the Caenorhabditis elegans let-60 ras gene. Genes Dev. 5:2188-2198[Abstract/Free Full Text].

HSIN, H. and C. KENYON, 1999  Signals from the reproductive system regulate the lifespan of C. elegans.. Nature 399:362-366[Medline].

HURLEY, J. H., 1999  Structure, mechanism, and regulation of mammalian adenylyl cyclase. J. Biol. Chem. 274:7599-7602[Free Full Text].

IIRI, T., P. HERZMARK, J. M. NAKAMOTO, C. VAN DOP, and H. R. BOURNE, 1994  Rapid GDP release from G_s in patients with gain and loss of endocrine function. Nature 371:164-168[Medline].

KENYON, C., J. CHANG, E. GENSCH, A. RUDNER, and R. TABTIANG, 1993  A C. elegans mutant that lives twice as long as wild type. Nature 366:461-464[Medline].

KORSWAGEN, H. C., J. H. PARK, Y. OHSHIMA, and R. H. PLASTERK, 1997  An activating mutation in a Caenorhabditis elegans G_s protein induces neural degeneration. Genes Dev. 11:1493-1503[Abstract/Free Full Text].

KORSWAGEN, H. C., A. M. VAN DER LINDEN, and R. H. PLASTERK, 1998  G protein hyperactivation of the Caenorhabditis elegans adenylyl cyclase SGS-1 induces neuronal degeneration. EMBO J. 17:5059-5065[Medline].

KRAMER, J. M., R. P. FRENCH, E. C. PARK, and J. J. JOHNSON, 1990  The Caenorhabditis elegans rol-6 gene, which interacts with the sqt-1 collagen gene to determine organismal morphology, encodes a collagen. Mol. Cell. Biol. 10:2081-2089[Abstract/Free Full Text].

LACKNER, M. R., S. J. NURRISH, and J. M. KAPLAN, 1999  Facilitation of synaptic transmission by EGL-30 G_q and EGL-8 PLCß: DAG binding to UNC-13 is required to stimulate acetylcholine release. Neuron 24:335-346[Medline].

LAKOWSKI, B. and S. HEKIMI, 1998  The genetics of caloric restriction in Caenorhabditis elegans.. Proc. Natl. Acad. Sci. USA 95:13091-13096[Abstract/Free Full Text].

LANDIS, C. A., S. B. MASTERS, A. SPADA, A. M. PACE, and H. R. BOURNE et al., 1989  GTPase inhibiting mutations activate the chain of G_s and stimulate adenylyl cyclase in human pituitary tumours. Nature 340:692-696[Medline].

LEWIS, J. A. and J. T. FLEMING, 1995  Basic culture methods. Methods Cell. Biol. 48:3-29[Medline].

LIU, Y., A. E. RUOHO, V. D. RAO, and J. H. HURLEY, 1997  Catalytic mechanism of the adenylyl and guanylyl cyclases: modeling and mutational analysis. Proc. Natl. Acad. Sci. USA 94:13414-13419[Abstract/Free Full Text].

LYONS, J., C. A. LANDIS, G. HARSH, L. VALLAR, and K. GRUNEWALD et al., 1990  Two G protein oncogenes in human endocrine tumors. Science 249:655-659[Abstract/Free Full Text].

MELLO, C. and A. FIRE, 1995  DNA transformation. Methods Cell. Biol. 48:451-482[Medline].

MENDEL, J. E., H. C. KORSWAGEN, K. S. LIU, Y. M. HAJDU-CRONIN, and M. I. SIMON et al., 1995  Participation of the protein G_o in multiple aspects of behavior in C. elegans.. Science 267:1652-1655[Abstract/Free Full Text].

MILLER, K. G., A. ALFONSO, M. NGUYEN, J. A. CROWELL, and C. D. JOHNSON et al., 1996  A genetic selection for Caenorhabditis elegans synaptic transmission mutants. Proc. Natl. Acad. Sci. USA 93:12593-12598[Abstract/Free Full Text].

MILLER, K. G., M. D. EMERSON, and J. B. RAND, 1999  G_o and diacylglycerol kinase negatively regulate the G_q pathway in C. elegans.. Neuron 24:323-333[Medline].

NURRISH, S., L. SEGALAT, and J. M. KAPLAN, 1999  Serotonin inhibition of synaptic transmission: G_o decreases the abundance of UNC-13 at release sites. Neuron 24:231-242[Medline].

PARENT, C. A. and P. N. DEVREOTES, 1995  Isolation of inactive and G protein-resistant adenylyl cyclase mutants using random mutagenesis. J. Biol. Chem. 270:22693-22696[Abstract/Free Full Text].

PATEL, T. B., Z. DU, S. PIERRE, L. CARTIN, and K. SCHOLICH, 2001  Molecular biological approaches to unravel adenylyl cyclase signaling and function. Gene 269:13-25[Medline].

PATERSON, J. M., S. M. SMITH, J. SIMPSON, O. C. GRACE, and A. A. SOSUNOV et al., 2000  Characterisation of human adenylyl cyclase IX reveals inhibition by Ca(2+)/calcineurin and differential mRNA polyadenylation. J. Neurochem. 75:1358-1367[Medline].

ROBATZEK, M., T. NIACARIS, K. STEGER, L. AVERY, and J. H. THOMAS, 2001  eat-11 encodes GPB-2, a Gß₅ ortholog that interacts with G_o and G_q to regulate C. elegans behavior. Curr. Biol. 11:288-293[Medline].

SEGALAT, L., D. A. ELKES, and J. M. KAPLAN, 1995  Modulation of serotonin-controlled behaviors by G_o in Caenorhabditis elegans.. Science 267:1648-1651[Abstract/Free Full Text].

SHENKER, A., L. S. WEINSTEIN, A. MORAN, O. H. PESCOVITZ, and N. J. CHAREST et al., 1993  Severe endocrine and nonendocrine manifestations of the McCune-Albright syndrome associated with activating mutations of stimulatory G protein G_s. J. Pediatr. 123:509-518[Medline].

SIMONDS, W. F., 1999  G protein regulation of adenylate cyclase. Trends Pharmacol. Sci. 20:66-73[Medline].

SINGH, R. N. and J. E. SULSTON, 1978  Some observations on moulting in Caenorhabditis elegans.. Nematologica 24:63-71.

STINCHCOMB, D. T., J. E. SHAW, S. H. CARR, and D. HIRSH, 1985  Extrachromosomal DNA transformation of Caenorhabditis elegans.. Mol. Cell. Biol. 5:3484-3496[Abstract/Free Full Text].

TANG, W. J. and A. G. GILMAN, 1995  Construction of a soluble adenylyl cyclase activated by G_s alpha and forskolin. Science 268:1769-1772[Abstract/Free Full Text].

TANG, W. J., J. A. INIGUEZ-LLUHI, S. MUMBY, and A. G. GILMAN, 1992  Regulation of mammalian adenylyl cyclases by G-protein and ß subunits. Cold Spring Harbor Symp. Quant. Biol. 57:135-144[Medline].

TANG, W. J., M. STANZEL, and A. G. GILMAN, 1995  Truncation and alanine-scanning mutants of type I adenylyl cyclase. Biochemistry 34:14563-14572[Medline].

TESMER, J. J., R. K. SUNAHARA, A. G. GILMAN, and S. R. SPRANG, 1997  Crystal structure of the catalytic domains of adenylyl cyclase in a complex with G_s.GTPS. Science 278:1907-1916[Abstract/Free Full Text].

TESMER, J. J., R. K. SUNAHARA, R. A. JOHNSON, G. GOSSELIN, and A. G. GILMAN et al., 1999  Two-metal-ion catalysis in adenylyl cyclase. Science 285:756-760[Abstract/Free Full Text].

VAN DER LINDEN, A. M., F. SIMMER, E. CUPPEN, and R. H. PLASTERK, 2001  The G-protein ß-subunit GPB-2 in Caenorhabditis elegans regulates the G_o-G_q signaling network through interactions with the regulator of G-protein signaling proteins EGL-10 and EAT-16. Genetics 158:221-235[Abstract/Free Full Text].

YAN, S. Z., Z. H. HUANG, V. D. RAO, J. H. HURLEY, and W. J. TANG, 1997a  Three discrete regions of mammalian adenylyl cyclase form a site for G_s activation. J. Biol. Chem. 272:18849-18854[Abstract/Free Full Text].

YAN, S. Z., Z. H. HUANG, R. S. SHAW, and W. J. TANG, 1997b  The conserved asparagine and arginine are essential for catalysis of mammalian adenylyl cyclase. J. Biol. Chem. 272:12342-12349[Abstract/Free Full Text].

YAN, S. Z., Z. H. HUANG, R. K. ANDREWS, and W. J. TANG, 1998  Conversion of forskolin-insensitive to forskolin-sensitive (mouse-type IX) adenylyl cyclase. Mol. Pharmacol. 53:182-187[Abstract/Free Full Text].

ZIMMERMANN, G., D. ZHOU, and R. TAUSSIG, 1998a  Genetic selection of mammalian adenylyl cyclases insensitive to stimulation by G_s. J. Biol. Chem. 273:6968-6975[Abstract/Free Full Text].

ZIMMERMANN, G., D. ZHOU, and R. TAUSSIG, 1998b  Mutations uncover a role for two magnesium ions in the catalytic mechanism of adenylyl cyclase. J. Biol. Chem. 273:19650-19655[Abstract/Free Full Text].

ZWAAL, R. R., A. BROEKS, J. VAN MEURS, J. T. GROENEN, and R. H. PLASTERK, 1993  Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435[Abstract/Free Full Text].

ZWAAL, R. R., J. AHRINGER, H. G. VAN LUENEN, A. RUSHFORTH, and P. ANDERSON et al., 1996  G proteins are required for spatial orientation of early cell cleavages in C. elegans embryos. Cell 86:619-629[Medline].

This article has been cited by other articles:

				N. K. Charlie, A. M. Thomure, M. A. Schade, and K. G. Miller The Dunce cAMP Phosphodiesterase PDE-4 Negatively Regulates G{alpha}s-Dependent and G{alpha}s-Independent cAMP Pools in the Caenorhabditis elegans Synaptic Signaling Network Genetics, May 1, 2006; 173(1): 111 - 130. [Abstract] [Full Text] [PDF]

				N. K. Charlie, M. A. Schade, A. M. Thomure, and K. G. Miller Presynaptic UNC-31 (CAPS) Is Required to Activate the G{alpha}s Pathway of the Caenorhabditis elegans Synaptic Signaling Network Genetics, February 1, 2006; 172(2): 943 - 961. [Abstract] [Full Text] [PDF]

				A. U. Rao, L. K. Carta, E. Lesuisse, and I. Hamza Lack of heme synthesis in a free-living eukaryote PNAS, March 22, 2005; 102(12): 4270 - 4275. [Abstract] [Full Text] [PDF]

				M. A. Schade, N. K. Reynolds, C. M. Dollins, and K. G. Miller Mutations That Rescue the Paralysis of Caenorhabditis elegans ric-8 (Synembryn) Mutants Activate the G{alpha}s Pathway and Define a Third Major Branch of the Synaptic Signaling Network Genetics, February 1, 2005; 169(2): 631 - 649. [Abstract] [Full Text] [PDF]

				N. K. Reynolds, M. A. Schade, and K. G. Miller Convergent, RIC-8-Dependent G{alpha} Signaling Pathways in the Caenorhabditis elegans Synaptic Signaling Network Genetics, February 1, 2005; 169(2): 651 - 670. [Abstract] [Full Text] [PDF]

				T. C. Jacob and J. M . Kaplan The EGL-21 Carboxypeptidase E Facilitates Acetylcholine Release at Caenorhabditis elegans Neuromuscular Junctions J. Neurosci., March 15, 2003; 23(6): 2122 - 2130. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited