Isolation and Characterization of Broad-Spectrum Disease-Resistant Arabidopsis Mutants

Corresponding author: Jeffery L. Dangl, 108 Coker Hall CB 3280, University of North Carolina, Chapel Hill, NC 27599-3280., dangl{at}email.unc.edu (E-mail)

Communicating editor: V. L. CHANDLER

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

To identify Arabidopsis mutants that constitutively express systemic acquired resistance (SAR), we constructed reporter lines expressing the firefly luciferase gene under the control of the SAR-inducible PR-1 promoter (PR-1/luc). After EMS mutagenesis of a well-characterized transgenic line, we screened 250,000 M₂ plants for constitutive expression of the reporter gene in vivo. From a mutant collection containing several hundred putative mutants, we concentrated on 16 mutants lacking spontaneous hypersensitive response (HR) cell death. We mapped 4 of these constitutive immunity (cim) mutants to chromosome arms. Constitutive expression of disease resistance was established by analyzing responses to virulent Peronospora parasitica and Pseudomonas syringae strains, by RNA blot analysis for endogenous marker genes, and by determination of salicylic acid levels in the mutants. The variety of the cim phenotypes allowed us to define distinct steps in both the canonical SAR signaling pathway and a separate pathway for resistance to Erysiphe cichoracearum, active in only a subset of the mutants.

PLANTS possess inducible disease defense systems. A major contribution to this innate defense response is systemic acquired resistance (SAR). SAR is induced in many species upon local infection by necrogenic pathogens and by hypersensitive response (HR; RYALS et al. 1996 ). During SAR, an increased ability to resist attacks of a wide array of pathogens is systemically induced, which lasts several weeks to several months after initiation. Induced expression of a subset of pathogenesis-related (PR) genes, called SAR genes, is highly correlated with the maintenance phase of SAR (WARD et al. 1991 ; UKNES et al. 1992 ). In Arabidopsis, the PR-1 gene is the most reliable molecular marker for SAR.

Salicylic acid has been shown to be both necessary and sufficient for mediating systemic triggering of SAR in some plants (VERNOOIJ et al. 1994 ). Transgenic tobacco and Arabidopsis plants expressing the bacterial salicylate hydroxylase gene, NahG, which significantly reduces accumulation of active salicylic acid (SA), are unable to establish SAR (GAFFNEY et al. 1993 ). The action of salicylic acid can be specifically mimicked by certain chemicals, such as 2,4 dichloroisonicotinic acid (INA) and benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH). The latter compound is used commercially for crop protection in various pathosystems (FRIEDRICH et al. 1996 ; GOERLACH et al. 1996 ). In the model system Arabidopsis, BTH induces resistance to many fungal and bacterial pathogens, such as the obligate biotrophic oomycete Peronospora parasitica, and virulent strains of Pseudomonas syringae (LAWTON et al. 1996 ). Arabidopsis has been used to genetically dissect the signaling cascade leading to disease responses. Mutants in the SAR pathway that are either impaired in resistance responses or constitutively express SAR have been described (DONG 1998 ). This second group contains two classes: mutants exhibiting spontaneous, HR-like cell death, called acd (accelerated cell death), lsd (lesion-simulating disease resistance), cpr (constitutive expression of PR genes; GREENBERG and AUSUBEL 1993 ; BOWLING et al. 1994 ; DIETRICH et al. 1994 ), or edr (enhanced disease resistance; FRYE et al. 2001 ), and mutants that do not exhibit this cell death in absence of external trigger. They are less common, but may be crucial for the understanding of SAR signaling downstream or independent of cell death. Only a few mutants have been identified so far, including some cpr mutants (DONG 1998 ) and two dnd (defense, no death) mutants (YU et al. 1998 ).

Mutations in the NIM1/NPR1 (noninducible immunity/no PR gene expression) gene impair inducible disease resistance in Arabidopsis (CAO et al. 1994 ; DELANEY et al. 1995 ). The cloning of this central member of the SAR signaling cascade revealed homologies to mammalian transcription factor regulators containing ankyrin domains (CAO et al. 1997 ; RYALS et al. 1997 ). By analogy to mammals, a protein kinase cascade may regulate the function of the NIM1/NPR1 protein. A MAP kinase that is activated by SA has recently been identified by biochemical means (ZHANG and KLESSIG 1997 ; ROMEIS et al. 1999 ). One mutant, called edr1, has been identified that cannot be classified as a SAR mutant because it confers resistance to Erysiphe cichoracearum in the absence of increased PR-1 gene expression and accumulation of elevated SA levels (FRYE and INNES 1998 ). edr1 supports wild-type infection upon inoculation with virulent P. parasitica isolates. edr1, which encodes a mitogen-activated protein kinase kinase (MAPKK) kinase in an SA-inducible defense response (FRYE et al. 2001 ), may therefore define a different signal transduction pathway branch involved in plant-pathogen interactions. This signaling may be linked to SAR, which also provides resistance against Erysiphe infections.

Additional SA-independent disease resistance pathways have recently been described (reviewed by MALECK and DIETRICH 1999 ; GLAZEBROOK 2001 ). The specific roles and interdependences of these pathways are not yet well understood, in part due to a lack of distinctive marker genes.

To better understand cellular signaling leading to the establishment of SAR, we performed a near genome-saturating mutant screen in Arabidopsis thaliana on the basis of constitutive expression of a PR-1/luciferase reporter gene. We identified several hundred mutants with constitutive luciferase activity. We then focused on 16 mutants from this pool that lacked spontaneous cell death and still expressed constitutive PR-1/luciferase activity. All 16 mutants accumulated high levels of SA and expressed high constitutive levels of SAR-associated marker genes. On the basis of different resistance responses to several virulent pathogens, we classified the mutants and compared them to plants elicited by BTH.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Construction and characterization of the PR-1/luciferase line:
A PR-1 genomic clone was identified by screening an Arabidopsis EMBL3 genomic library (CLONTECH, Palo Alto, CA) with the PR-1 cDNA (UKNES et al. 1992 ). A 7-kb XhoI fragment of the PR-1 genomic clone was subcloned into pBS+ (Stratagene, La Jolla, CA) using standard cloning techniques, and restriction mapping revealed the presence of a 4.2-kb promoter fragment 5' of the PR-1 coding region (GenBank accession no. AF0962949). This fragment was subcloned 5' to a cDNA coding for luciferase (excised from pDO432, OW et al. 1986 ), generating a translational fusion at the ATG that marks the start of translation for luciferase. The PR-1/luciferase construct was verified by sequencing and subcloned as a XhoI/SacI fragment into pCIB200, a binary vector that contains the neomycinphosphotransferase II gene that confers resistance to kanamycin. The resulting construct was mobilized into Agrobacterium tumefaciens strain GV3101 by electroporation. A. thaliana (ecotype Col-0) plants were transformed with this construct by Agrobacterium using the vacuum-infiltration method (BECHTOLD et al. 1993 ). A total of 32 independent transformants homozygous for the transgene were identified on the basis of resistance of the T3 progeny to kanamycin. PR-1/luciferase plants were characterized on the basis of inducibility of luciferase activity by 375 µM INA and one line, called 6E, that showed consistently a >100-fold inducibility was selected for further characterization by chemical and biological induction as described below and in the mutagenesis section.

Plant cultivation and mapping strategy:
Putative constitutive immunity (cim) mutants were isolated from an M₂ population comprising 250,000 plants of the homozygous 6E line, mutagenized by ethyl methanesulfonate. The 250,000 M₂ plants were derived from 168 independent M₁ seed pools containing 50 plants each. The coverage in the M₂ can be calculated with the formula , with P, the probability to detect a recessive homozygous mutation in the M₂; n, the number of M₂ plants screened per ; and f, the theoretical fraction of M₂ plants that do not show a mutation present in one of the proposed two effective germ cells of a . Therefore (REDEI and KONCZ 1992 ). Mutants were grown at 20°–24°, 60% relative humidity, 9-hr day/15-hr night cycle, 250 µE/m²/sec on Germination Mix Superfine (C. Farfard, Agawam, MA).

Crosses to the parental line (kan^r) and to other ecotypes were performed on half-closed buds of flowers from the female parent plant. Cross pollinations were confirmed by the presence of the luciferase gene or by selecting on plates containing 50 µg/ml kanamycin in cases of pollination from the parental line. In mixed ecotype crosses, race-specific microsatellites [single sequence length polymorphisms (SSLPs)] were used to confirm the cross. Crosses to NahG plants (hyg^r) were resistant to hygromycin and kanamycin.

Three- to 4-week-old progeny were screened for in vivo luciferase activity. Plants were evenly misted with a 7.5-mM luciferin solution (Biosynth International, Naperville, IL) containing 0.1% SilWet L77 (Union Carbide Chemicals), and after 10 min, photon emission was quantified during 10-min integration using a photon counter (Hamamatsu, Tokyo) at the most sensitive detection setting. F₁ plants of backcrosses to the PR-1/luciferase line showing luciferase activity were selected for selfing and further crosses. F₂ populations of single F₁ plants were analyzed if no F₁ progeny showed luciferase activity to identify recessive mutations and to determine the segregation ratios of progeny of F₁ plants with luciferase activity. Segregation ratios of crosses to other ecotypes and mutants were scored in the same way. Progeny that lost the luciferase marker gene due to segregation were eliminated on the basis of a luciferase gene-specific PCR (5' primer, CTATGAAGAGATACGGCCTG; 3' primer, ATGAGATGTGACGAACGTGT; 35 cycles of 30 sec 95°, 30 sec 60°, and 1 min 30 sec 72°). The selected F₂ progeny of mapping crosses were allowed to self-pollinate, and F₃ progeny were rescreened for luciferase activity, both on kanamycin-containing GM plates and on soil.

SSLP markers described by BELL and ECKER 1994 and cleaved amplified polymorphic sequences (CAPS) markers (KONIECZNY and AUSUBEL 1993 ; E. DRENKARD and F. AUSUBEL, http://genome-www.stanford.edu/Arabidopsis/maps/CAPS.html) were used to identify genetic loci linked to the cim mutations and the luciferase transgene. Restriction fragment length polymorphism (RFLP) marker mi291a was converted into a CAPS marker (5' primer, CCTTCTGCTGTTGTTAAAG; 3' primer, CCAGTTCCTTTTGTTTGAC; 35 cycles of 30 sec 95°, 30 sec 51°, and 1 min 30 sec 72°, cleaved with XbaI; New England Biolabs, Boston). RFLP marker mi185 was converted into a CAPS marker (5' primer, AGCCATCAGATTATGTTCCC; 3' primer, TGTAGGAACTCGATCCTCC; 35 cycles of 30 sec 95°, 30 sec 56°, and 2 min 72°, cleaved with XmnI; M. HUNT, unpublished data). Recombination frequencies were converted to genetic map distances using the KOSAMBI 1944 function as provided in the MapMaker 3.0b program (LANDER et al. 1987 ; LINCOLN et al. 1992 ).

Nucleic acid extractions and analysis:
Plant DNA was extracted using a hexadecyltrimethyl-ammonium bromide method (ROGERS and MILLIMAN 1984 ) for single leaves. For polymerase chain reaction, DNA was resuspended in 200 µl 10 mM Tris, pH 8.5; 5 µl of this DNA solution was used per 25-µl reaction. For Southern blot analysis, 1–5 µg DNA was digested with several appropriate restriction endonucleases according to the manufacturer's instructions (New England Biolabs) and Southern blotting was performed as described by AUSUBEL et al. 1987 . DNA was transferred onto GeneScreen Plus membranes (Du Pont-New England Nuclear, Boston) in 10x SSC and the membranes were hybridized and washed as described for Northern blot.

RNA was isolated by lithium chloride precipitation as described previously (LAGRIMINI et al. 1987 ) from 0.5 g frozen leaf tissue. For Northern blotting, RNA was photospectrometrically quantified and 10 µg total RNA was electrophoretically separated on formaldehyde-agarose gels and blotted onto a nylon membrane (GeneScreen Plus; Du Pont-New England Nuclear) as described (AUSUBEL et al. 1987 ). After UV-crosslinking (1200 µJ), RNA was hybridized to gene-specific probes that were radioactively labeled by random priming (GIBCO BRL, Gaithersburg, MD) to 200,000 counts/min/cm² membrane. Untreated wild-type Col-0, BTH-treated plants (treated 2 days prior to harvest with 300 µM BTH, 25% active ingredient; LAWTON et al. 1996 ) and Peronospora-infected tissue, harvested 8 days after inoculation, served as controls. Blots were analyzed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and standardized to -tubulin. Each RNA blot was repeated at least twice with comparable results.

Pathogen treatments:
We tested whether the cim mutants were resistant to the virulent oomycete parasite P. parasitica isolates Noco2 (obtained from J. Parker, Norwich, England) and Emco5 (obtained from E. Holub, Wellesbourne, England) by comparing disease symptoms to those of either BTH-treated (0.3 mM, 2 days prior to pathogen treatment) or water-treated wild-type Col-0 plants. P. parasitica isolate Noco2 was sprayed as a conidial suspension (10⁵ spores/ml) onto 4-week-old plants, and P. parasitica isolate Emco5 was sprayed on 2-week-old seedlings. Following inoculation, plants were maintained in high humidity and symptoms were scored 8 days after inoculation for development of conidiospores, using the rating system proposed by Holub (HOLUB et al. 1994 ). For microscopic analysis of induced cell death and fungal development, Trypan Blue staining was performed on individual leaves (KEOGH et al. 1980 ). Callose was detected using anilin blue staining on 5-µm-thick leaf sections (HUNT et al. 1997 ).

Resistance to E. cichoracearum strain UCSC (kindly provided by Dr. R. Innes, Indiana University) was tested by brushing sporulating Col-0 plants onto 4-week-old plants, as described by FRYE and INNES 1998 . To visualize the infection and fungal structures, a fluorescence dye staining was performed on infected leaves (DUCKETT and READ 1991 ). Leaves were incubated for 2 min in 50 µg/ml (DiOC₆(3)) stain (Sigma Chemicals, St. Louis), cleared for 30 sec in distilled water, and mounted in water under a coverslip. Fluorescent fungal hyphae were detected at 520 nm after blue light excitation (450–490 nm) with an epifluorescence microscope (Leitz, Wetzlar, Germany).

For the analysis of resistance to compatible phytopathogenic bacteria, the apoplast of leaves of 4-week-old cim plants and water-treated Col-0 and BTH-activated Col-0 (0.3 mg/ml) plants were injected with P. syringae pv maculicola ES 4326 (SCHOTT et al. 1990 ). Samples were taken at 0, 1, 3, and 5 days after injection. For each time point, four leaf punches were pooled, ground in 10 mM MgCl₂, and plated in appropriate dilutions on Kings B medium supplemented with streptomycin (100 µg/ml). Standard deviations were calculated from four independent experiments. The significance of differences between mean values was evaluated by Student's t-test. Differences were considered to be significant at P > 0.6. For analysis of HR in incompatible interactions, P. syringae pv tomato (avrRpt2) was infected with 5 x 10⁷ cfu/ml (INNES et al. 1993 ).

Measurements of salicylic acid levels:
Free and total salicylic acid levels of triplicate samples were determined as previously described (GAFFNEY et al. 1993 ; UKNES et al. 1993 ). For comparison, we also measured SA in tissue of E. cichoracearum-infected plants harvested 3 days after inoculation.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Screening for disease-resistant mutants:
To carry out a screen for constitutive expression of PR-1, a PR-1/luciferase reporter gene construct including a NPTII selection marker was transformed by Agrobacterium-mediated gene transfer into Arabidopsis and homozygous lines were generated. One transgenic line in the Arabidopsis ecotype Col-0 (referred to as 6E line) was chosen for further characterization on the basis of the ratio of in vivo luciferase background (noninduced) to induced (24 hr after 0.3 mM BTH treatment) activity. In an F₂ population of an outcross to untransformed Col-0 plants, 147 out of 203 plants survived on selection for kanamycin resistance (, P < 0.4 for a 3:1 segregation ratio). Southern analysis using either the luciferase gene or the right border of the T-DNA as a probe showed that only one insert was integrated into the genome (data not shown). The extent and timing of expression (quantified as enzyme activity) from the PR-1-LUC transgene in the 6E line after chemical and biological induction matched the expression pattern of the endogenous PR-1 gene (data not shown). Induction kinetics of luciferase activity following chemical treatment with different concentrations of BTH or INA paralleled PR-1 gene expression, as confirmed by Northern blots. Similarly, luciferase activity over time matched PR-1 gene expression kinetics in compatible and incompatible pathogen interactions (P. parasitica Emwa and Noco; data not shown). Luciferase activity was routinely induced >100-fold in these induction experiments. The 6E line was indistinguishable from wild type both morphologically and in terms of gene expression. No increased resistance to virulent pathogens or PR-gene expression was detected. On the basis of these observations, the 6E line was taken as a wild-type control in all further experiments.

A total of 8400 M₁ seeds of the 6E line were used for EMS mutagenesis (performed at Lehle Seeds) with an M value of 0.147 (HAUGHN and SOMERVILLE 1987 ; MEDNIK 1988 ). Out of 168 independent M₁ seed pools, screened with 98% coverage in the M₂ population (250,000 plants, see MATERIALS AND METHODS for calculation of coverage), 160 pools contained at least one plant that constitutively expressed PR-1/luciferase, and there were 602 putative mutants in total. Sixteen of these mutants (Table 1), isolated from different M₂ seed lots, did not exhibit spontaneous lesion formation under conditions used in our assays, as revealed by Trypan Blue staining of dead cell lesions and microscopy (Fig 1). As a control, a mutant with spontaneous cell death, designated mutant 779, was included in all the following experiments. Mutant 779 displayed patches of autofluorescence and callose that normally accompany HR-like cell death (data not shown).

View larger version (70K): In this window In a new window Download PPT slide   Figure 1. The disease-resistant mutants do not exhibit spontaneous cell death, but morphological changes are common. Photography and Trypan Blue lesion staining of 10 cim mutants (cim5–14), wild-type PR-1/luc line (6E), and a lesion mimic mutant (779), which was included as a positive control in the staining, were performed as described in MATERIALS AND METHODS.

Although free of lesions, other pleiotropic phenotypic alterations in the 16 mutants were not separated from the mutation that caused constitutive PR gene expression after three backcrosses. In general, cim mutants have a prolonged life cycle, a delayed flowering time (2 weeks later than in wild-type Col-0), and they set less seed (approximately one-third of Col-0). Some mutants also showed reduced germination. Leaf morphology varied from long, often curly leaves (cim6, cim12; Fig 1) to extremely small round leaves (cim9, cim13; Fig 1). Mutant cim9 showed bright green leaf pigmentation. However, normal leaf morphology was also found, albeit mostly in the weaker mutants, cim7 and cim8 (weakness based on PR-1 expression and SA content), as well as in the cim11 that differed only in size to wild type (Fig 1). Ten cim mutants that were further characterized were denominated cim5 through cim14. Mutants cim1 through cim4 were isolated in previous mutant screens (H. STEINER and J. RYALS, unpublished results).

Genetic analysis of the disease-resistant mutants:
All 16 mutants originated from different seed pools and were therefore considered independent mutations. All mutants were backcrossed at least three times to the PR-1/luciferase parental line. Selfed progeny of all mutants stably expressed PR-1/luciferase.

To analyze the segregation ratios of the mutations, F₂ populations of backcrosses, containing 20–100 plants, were screened for constitutive luciferase activity and the resulting data were subjected to ² analysis (Table 1). The expression of the reporter gene in the F₁, confirmed in random samples by Northern blot analysis for endogenous PR-1 expression, indicated that in all but two cases (mutant 2 and cim9) the mutant phenotype was dominant. However, the analysis of the F₂ segregation ratios suggested that many of these mutations were not fully penetrant (Table 1, segregation ratios in the F₂ populations). In addition, we cannot exclude the possibility that in some cases (cim12), two dominant genes are required to cause the observed phenotype (² for 9:7 = 0.69, P < 0.4). In the case of cim11, the morphological changes were inherited in a recessive manner, while the closely linked constitutive PR-1/luciferase expression was incompletely penetrant, with varying expression of the phenotype in the heterozygous plants. In cases where F₂ segregation ratios were normal, we mapped the mutations. cim11 was placed on the genetic map of A. thaliana on chromosome 1 between the markers mi291a (5 recombinants in 120 meioses) and nga280 (2 recombinants in 124 meioses). cim6 is also located on chromosome 1, between markers nga280 (20 recombinants in 116 analyzed meioses) and m185 (19 recombinants in 116 meioses). cim5 is located on chromosome 2, between markers ve017 (16 recombinants in 148 meiosis) and nga168 (9 recombinants in 122 meioses). cim10 lies on chromosome 5 between markers DFR (22 recombinants in 106 meioses) and LFY3 (17 recombinants in 110 meioses). The map positions of the mutations on chromosomes 1 and 2 do not match the map positions of known mutations in genes encoding functions in disease resistance and/or SAR. Mutant cim10 is in a region of chromosome 5 termed MRC-J, which contains a number of R gene homologs (BOTELLA et al. 1997 ; HOLUB and BEYNON 1997 ). cim11 and cim6 map close to, but distinct from, cpr6 (CLARKE et al. 1998 ).

SAR genes are overexpressed in the disease-resistant mutants:
To confirm the identification of mutants affected in the SAR signaling cascade leading to PR gene expression, the expression of a variety of marker genes was analyzed in comparison to the parental line 6E (Fig 2), as well as to biologically and chemically induced tissue.

View larger version (101K): In this window In a new window Download PPT slide   Figure 2. Gene expression pattern of defense-related, PR genes and cell death-related genes in disease-resistant mutants. Columns are as follows: 6E, wild-type PR-1/luc line; B, wild type treated 2 days before harvest with 0.3 mM BTH; P, wild type treated 8 days before harvest with P. parasitica Noco2 (105 spores/ml); 6–14, 10 cim mutants; 779, a mutant that shows spontaneous cell death. Gene probes shown are as follows: PR-1 and PR-5, pathogenesis-related proteins 1 and 5 (UKNES et al. 1992 ); NIM, NIM1/NPR1 (RYALS et al. 1997 ); NDR, nonhost disease resistance (CENTURY et al. 1997 ); PAL1, phenylalanine ammonia lyase (WANNER et al. 1995 ); CHS, chalcone synthase (SHIRLEY et al. 1995 ); PAT1, phosphoribosyl anthranilate synthase (ROSE et al. 1992 ); RAB18, responsive to abscisic acid (GOSTI et al. 1995 ); and CuZnSOD, Cu-Zn superoxide dismutase (JABS et al. 1996 ). Genes whose expressions were quantified but not altered included lipid transfer protein (LTP1; THOMA 1994), lipoxygenase (LOX1; MELAN et al. 1993 ), an At MLO gene (BUSCHGES et al. 1997 ), the Arabidopsis homolog of the defense against death (DAD) gene (SUGIMOTO et al. 1995 ), the lesion simulating disease resistance gene 1 (LSD1; DIETRICH et al. 1997 ), the Arabidopsis homolog of lethal leaf spot (LLS1; GRAY et al. 1997 ), superoxide dismutases (MnSOD, FeSOD), catalases 2 and 3 (CAT2 and CAT3), peroxidase C (PRX C), glutathione-S-transferase type III (GST; all described in JABS et al. 1996 ), and the gene encoding for vascular storage protein (AtVSP; BERGER et al. 1995 ). Details about the probes used are available upon request. All blots were prepared with the same RNA; 5 µg RNA per sample was loaded.

Several Arabidopsis SAR genes (PR-1, -2, and -5; UKNES et al. 1992 ) were induced in all mutants except cim7 and cim8 to levels comparable to a strong BTH induction or a pathogen treatment with a virulent race (Fig 2; data not shown). PR-4 gene expression is inducible by ethylene. Its expression in cim mutants was 20-fold weaker than that observed in an ethylene-treated control plant (data not shown).

Hormone-inducible genes, such as AtVSP for monitoring jasmonic acid-induced gene expression (BERGER et al. 1995 ), were either weakly or not induced (data not shown). A possible exception may be the RAB18 gene, an example of an ABA-inducible gene (MERLOT and GIRAUDAT 1997 ). Rab18 gene expression is induced in cim7, cim10, and mutant 779. The induction of SAR in cim mutants most likely does not activate or depend on other hormonally regulated pathways as monitored by marker gene expression.

Similarly, the expression of stress-inducible genes of secondary metabolism, such as PAL and CHS (WANNER et al. 1995 ), or of the SAR-inducible NIM gene and NDR gene in disease resistance pathways was not correlated to the particular phenotypes of the mutants. Induction of the shikimate pathway can lead to antimicrobial metabolites and to SA biosynthesis and hence to increased resistance. The induction of NIM has been shown to be sufficient to increase resistance in Arabidopsis (CAO et al. 1998 ; FRIEDRICH et al. 2001 ).

Expression of genes involved in regulating the cellular redox state or in the oxidative burst (LOX, GST, PRXC, MnSOD; not shown; JABS et al. 1996 ) was not induced in the lesion-free mutants with the possible exception of the Cu-ZnSOD gene (Fig 2). Cu-ZnSOD activity has previously been shown to be altered during oxidative stress and by pathogen infection (FODOR et al. 1997 ; KLIEBENSTEIN et al. 1999 ).

Most disease-resistant mutants accumulate high levels of salicylic acid:
The direct dependence of the natural induction of SAR on SA (WILLITS and RYALS 1998 ) makes this compound a key metabolite to measure in mutants expressing altered SAR phenotypes. Although we expected to find some mutants downstream of SA, for example, possible gain-of-function nim1/npr1 alleles, all mutants (with the exception of mutant cim8) accumulated 3–15 times more SA than untreated wild-type plants (Table 2). A control treatment with a virulent E. cichoracearum pathogen caused a sevenfold increase in total SA content after 3 days of infection. The levels of free and total SA were always correlated to each other, thus excluding from our collection mutations in the regulation of this equilibrium or in the degradation/conjugation of SA (data not shown). On the basis of SA content and PR gene expression, mutants can be classified into strong cim mutants (e.g., cim5, cim6, cim9, cim10, cim13, cim14) and weak cim mutants (e.g., cim7, cim8). Interestingly, no correlation between SA content and HR-like lesion formation has been found in the 90 lesion mimic mutants from this screen for which SA analysis has been performed (data not shown).

Most mutants are resistant to fungal pathogens:
We tested the response of the mutants to various pathogens to which BTH confers significant protection in wild type. We tested resistance to two isolates of the oomycete parasite P. parasitica, which are virulent on wild-type Col-0 (HOLUB et al. 1994 ). We scored resistance to P. parasitica isolate Noco2 in adult leaves 8 days after infection. Neither chlorosis nor spontaneous macroscopic necrosis were observed in the "strong" cim mutants, defined as those with high levels of SA and PR gene expression. Only two "weak" mutants, cim7 and cim8, allowed some hyphal growth and slight sporulation (Fig 3). Trypan Blue staining for hyphal growth and cell death revealed, however, that in some mutants (cim10, cim12, and to a lesser extent in mutants cim6, cim9, and cim13) very occasional trailing necrosis (HOLUB et al. 1994 ) occurred around the hyphal penetration sites (data not shown). This phenomenon was not correlated to relative SA content or PR gene expression. A second compatible P. parasitica isolate Emco5 (HOLUB and BEYNON 1997 , no. 2253; MCDOWELL et al. 1998 ) was applied to younger plants in a cotyledon assay, because infection of wild type is more effective at this earlier stage (data not shown). Each cim line expressed a similar phenotype when infected with either P. parasitica isolate Emco5 or isolate Noco2 (Fig 3). These results suggest that the observed resistance is not an age-dependent or an isolate-specific reaction.

View larger version (49K): In this window In a new window Download PPT slide   Figure 3. cim mutants are resistant to two virulent Peronospora parasitica isolates. Trypan Blue staining of cim mutants 8 days after spray inoculation with P. parasitica spores of the isolates Noco2 and Emco5 is shown. With the exception of cim7 and cim8, all mutants exhibit a complete protection against Peronospora. In mutants cim10 and cim12, spore inoculation causes HR-like lesion formation. 6E, wild-type PR-1/luciferase line; B, wild-type PR-1/luciferase line pretreated with BTH (0.3 mM).

We also tested resistance of the cim mutants to a fungal pathogen, E. cichoracearum, which is virulent on most A. thaliana ecotypes (ADAM and SOMERVILLE 1996 ), including Col-0. Col-0, however, can be completely protected from Erysiphe infection by BTH pretreatment (0.3 mM; K. MALECK, unpublished observation). We utilized a disease rating system between 1 (resistant) and 3 (susceptible) to quantify macroscopic symptoms. Interestingly, this assay revealed a differential response among the cim mutants. Some cim mutants (e.g., cim7, cim13) are completely resistant to E. cichoracearum, and others are completely susceptible (Table 3). The resistance did not correlate with the strength of PR-1 gene expression or SA content. The two strongest mutants cim9 and cim13 were resistant, but cim7, with low PR-1 gene expression and SA accumulation, also displayed an almost complete resistance (rating 1.01).

Many cims are resistant to bacterial pathogens:
To check for resistance to prokaryotic pathogens, we inoculated the cim mutants with several different virulent P. syringae strains. Significance of these experiments was often hampered by the non-wild-type leaf morphology and developmental stage of the cim mutants. It became clear, however, that resistance to P. syringae isolates was, in many mutants, not as good as resistance to Peronospora and Erysiphe. Differences in resistance to the aggressive pathogen P. syringae pv syringae DC 3000 were small among the mutants. We therefore chose the less virulent strain P. syringae pv maculicola ES4326 to better illustrate the spectrum of resistance to P. syringae among these mutants. Mutants cim9, cim10, cim11, and cim13 exhibited a bacterial proliferation reduced >10-fold compared to wild type at 5 days after inoculation (Fig 4). For mutants cim6 and cim12, the bacterial titer 5 days after inoculation was 2-fold lower than that in wild type. While mutants cim5 and cim14 are both in the class of strong mutants, they were at least as susceptible to this P. syringae isolate as wild type (Fig 4).

View larger version (39K): In this window In a new window Download PPT slide   Figure 4. Resistance of cim mutants to Pseudomonas syringae pv maculicola (Psm) ES4326. Three and 5 days after inoculation with Psm, infected leaves were assayed for bacterial density. Bacterial viable counts, expressed as colony forming units (cfu) per 1 cm2 corresponding to four-leaf discs, calculated from four independent repetitions, are indicated with standard deviations. Lightly shaded bars, 3 days after inoculation (dpi); darkly shaded bars, 5 dpi. The t values and confidence limits are as follows, for each mutant compared with the 6E line: 3 dpi, BTH-induced plants (B), 5.82(P > 0.995); cim5, 0.53 (P > 0.65);cim6, 2.53 (P > 0.975); cim9, 5.40 (P > 0.995); cim10, 1.33 (P > 0.85); cim12, 5.47 (P > 0.995); cim13, 1.13 (P > 0.85); cim14, 0.56 (P > 0.7); cim7, 0.94 (P > 0.8); cim11, 1.74 (P > 0.9); 5 dpi, BTH-induced plants, 1.74 (P > 0.9); cim5, 3.37 (P > 0.99); cim6, 0.60 (P > 0.7); cim9, 1.74 (P > 0.9); cim10, 1.71 (P > 0.9); cim12, 1.04 (P > 0.8); cim13, 1.5 (P > 0.9); cim14, 0.58 (P > 0.7); cim7, 3.23 (P > 0.99); cim11, 4.66 (P > 0.995).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We isolated and characterized new disease-resistance mutants by screening for plants that constitutively express the PR-1 gene. PR-1 gene expression is the most reliable marker for monitoring the onset of SAR in Arabidopsis (UKNES et al. 1992 ), although its function remains unclear. To saturate the genome with this mutant class, we used a reporter gene that is readily detectable in vivo. Out of 250,000 M₂ plants, we isolated 16 mutants that constitutively expressed the PR-1 gene without spontaneous microscopic cell death. These were called cim mutants. Interestingly, our screen for cim mutants yielded mainly dominant or semidominant mutations, thus rendering genetic analysis, complementation tests, and pathway classification by epistasis studies more difficult. We did, however, map four of the cim mutants, demonstrating that several independent loci have been identified. In spite of the theoretically near-saturating screen, only 16 cim mutants were identified, maybe because many lesion mimic mutants were allelic to cim mutants or because of lethality, poor growth, and penetrance of cim phenotypes. Hence, given our near-saturating screen, neo- or hypermorphic mutations in the SAR signaling pathway are extremely rare.

All mutants exhibited increased resistance to at least two virulent pathogens, thus validating the marker-gene-based approach. cim mutants define a diverse group of loci with different disease-resistance spectrums. It is tempting to speculate about the mechanistic nature of broad-spectrum disease resistance. Since all cim mutants are resistant to at least two virulent pathogens, the resistance appears R-gene independent and does generally not require an HR. Most cims are able to develop an HR in response to an avirulent pathogen (data not shown) but some appear to simply bypass HR and thus resemble dnd mutants (YU et al. 1998 ). As in the barley mlo mutants (PETERHANSEL et al. 1997 ), a compatible interaction is converted into an incompatible interaction. Because of the very different lifestyles of the pathogens used (Erysiphe, Peronospora spp, Pseudomonas), it is unlikely that simple host morphological changes, for example, in the cuticle, are responsible for this resistance. In principle, a mutation in an R gene could activate the cascade leading to an activation of SAR, but it has previously been shown that such mutations can also cause a lesion mimic phenotype (Rp1 in maize; HU et al. 1996 ). The similar nature of the dnd mutants, which were identified because of an altered gene-for-gene interaction, when compared to some of the cim mutants, reveals a link between SAR and AVR/R-gene mediated resistance. The DND1 gene was recently cloned and encodes a probable ion channel (CLOUGH et al. 2000 ). A truncation in this protein leads to high levels of SA and PR-gene expression and stunted growth, thus mimicking constitutive SAR. Yet another constitutive SAR mutant is caused by a mutation in a MAP kinase (PETERSEN et al. 2000 ). A direct interaction between SA and the MAPK4 protein is unlikely, and the entire pathway is clearly far from being understood. However, the characterization of the MAPK4 mutant confirmed that SAR induction might be negatively regulated (PETERSEN et al. 2000 ).

We can assemble a first-order classification of these cim mutants, using differential resistance against pathogens. Several mutants were highly resistant to all tested pathogens (e.g., cim9, cim13). Others were resistant only to fungal pathogens (e.g., cim6). Mutant cim10 was resistant to Pseudomonas and P. parasitica spp., but not to Erysiphe. Mutant cim7 was strongly resistant only to Erysiphe. The identification of an edr-like mutant such as cim7 with weak accumulation of PR gene transcripts was possible because the luciferase reporter gene assay is very sensitive. Together with the different map positions obtained for some of the mutants, these quantitative differences confirm our identification of several novel disease-resistance mutants and reveal a complex regulation pattern for the different branches of resistance signaling in Arabidopsis. Thus, monitoring the expression of one marker gene provided us with an array of mutant phenotypes. Using all our cim mutants (that might contain the majority of all possible mutants in this category) we conceivably could dissect a variety of branch points and possibly discern divergences in the plant's innate immune system (CLARKE et al. 2000 , CLARKE et al. 2001 ; JIRAGE et al. 2001 ). These mutants may also provide good starting points for dissection of transcriptional responses (MALECK et al. 2000 ).

Molecular cloning of the underlying cim genes and epistasis studies of known recessive regulatory mutants, such as ndr1 (CENTURY et al. 1995 ), eds1 (PARKER et al. 1996 ), and pad4 (GLAZEBROOK et al. 1997 ), together with broadening the spectrum of diseases tested will give further insight into the relative relationships among the loci identified by this collection of cim mutants and others like it (CLARKE et al. 2000 , CLARKE et al. 2001 ; JIRAGE et al. 2001 ) and by similar mutants such as dnd1.

	ACKNOWLEDGMENTS

We thank the Ohio Stock Center, J. Giraudat (Institut des Sciences Vegetales, Centre National de la Recherche Scientifique, Gif-sur-Yvette, France), A. Rose (University of California, Davis), H. Bohlmann (Eidgenössiche Technische Hochschule, Zürich, Switzerland), and A. Molina (Universidad Complutense, Madrid, Spain) for providing us with several gene probes. We are grateful to Drs. Eric Ward (Syngenta Biotechnology Institute, North Carolina), Pablo Tornero, and Petra Epple (University of North Carolina) for valuable comments on the manuscript and Drs. Klaus Hahlbrock and Imre Somssich (Max-Planck-Institute for Plant Breeding, Cologne, Germany) for continuing support. Work at University of North Carolina-Chapel Hill was funded by National Institutes of Health grant 5RO1-GM057171-01 to J.L.D.

Manuscript received September 2, 1999; Accepted for publication February 8, 2002.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAM, L. and S. C. SOMERVILLE, 1996  Genetic characterization of five powdery mildew disease resistance loci in Arabidopsis thaliana.. Plant J. 9:341-356[Medline].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1987 Current Protocols in Molecular Biology. John Wiley & Sons, New York.

BECHTOLD, N., J. ELLIS, and G. PELLETIER, 1993  In planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. Life Sci. 316:1194-1199.

BELL, C. J. and J. R. ECKER, 1994  Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.. Genomics 19:137-144[Medline].

BERGER, S., E. BELL, A. SADKA, and J. E. MULLET, 1995  Arabidopsis thaliana Atvsp is homologous to soybean VspA and VspB, genes encoding vegetative storage protein acid phosphatases, and is regulated similarly by methyl jasmonate, wounding, sugars, light and phosphate. Plant Mol. Biol. 27:933-942[Medline].

BOTELLA, M. A., M. J. COLEMAN, D. E. HUGHES, M. T. NISHIMURA, and J. D. G. JONES et al., 1997  Map positions of 47 Arabidopsis sequences with sequence similarity to disease resistance genes. Plant J. 12:1197-1212[Medline].

BOWLING, S. A., A. GUO, H. CAO, A. S. GORDON, and D. F. KLESSIG et al., 1994  A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6:1845-1857[Abstract/Free Full Text].

BÜSCHGES, R., K. HOLLRICHTER, R. PANSTRUGA, G. SIMONS, and M. WOLTER et al., 1997  The barley MLO gene: a novel control element of plant pathogen resistance. Cell 88:695-705[Medline].

CAO, H., S. A. BOWLING, S. GORDON, and X. DONG, 1994  Characterization of an Arabidopsis mutant that is non-responsive to inducers of systemic acquired resistance. Plant Cell 6:1583-1592[Abstract].

CAO, H., J. GLAZEBROOK, J. D. CLARKE, S. VOLKO, and X. DONG, 1997  The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88:57-63[Medline].

CAO, H., X. LI, and X. DONG, 1998  Generation of broad-spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance. Proc. Natl. Acad. Sci. USA 95:6531-6536[Abstract/Free Full Text].

CENTURY, K. S., E. B. HOLUB, and B. J. STASKAWICZ, 1995  NDR1, a locus of Arabidopsis thaliana that is required for disease resistance to both a bacterial and a fungal pathogen. Proc. Natl. Acad. Sci. USA 92:6597-6601[Abstract/Free Full Text].

CENTURY, K. S., A. D. SHAPIRO, P. P. REPETTI, D. DAHLBECK, and E. HOLUB et al., 1997  NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278:1963-1965[Abstract/Free Full Text].

CLARKE, J. D., Y. LIU, D. F. KLESSIG, and X. DONG, 1998  Uncoupling PR gene expression from NPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1 mutant. Plant Cell 10:557-569[Abstract/Free Full Text].

CLARKE, J. D., S. M. VOLKO, H. LEDFORD, F. M. AUSUBEL, and X. DONG, 2000  Roles of salicylic acid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. Plant Cell 12:2175-2190[Abstract/Free Full Text].

CLARKE, J. D., N. AARTS, B. J. FEYS, X. DONG, and J. E. PARKER, 2001  Constitutive disease resistance requires EDS1 in the Arabidopsis mutants cpr1 and cpr6 and is partially EDS1-dependent in cpr5.. Plant J. 26:409-420[Medline].

CLOUGH, S. J., K. A. FENGLER, I. C. YU, B. LIPPOK, and R. K. SMITH et al., 2000  The Arabidopsis dnd1 "defense, no death" gene encodes a mutated cyclic nucleotide-gated ion channel. Proc. Natl. Acad. Sci. USA 97:9323-9328[Abstract/Free Full Text].

DELANEY, T., L. FRIEDRICH, and J. RYALS, 1995  Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc. Natl. Acad. Sci. USA 92:6602-6606[Abstract/Free Full Text].

DIETRICH, R. A., T. P. DELANEY, S. J. UKNES, E. R. WARD, and J. A. RYALS et al., 1994  Arabidposis mutants simulating disease resistance response. Cell 77:565-577[Medline].

DIETRICH, R. A., M. H. RICHBERG, R. SCHMIDT, C. DEAN, and J. L. DANGL, 1997  A novel zinc finger protein is encoded by the Arabidopsis LSD1 gene and functions as a negative regulator of plant cell death. Cell 88:685-694[Medline].

DONG, X., 1998  SA, JA, ethylene, and disease resistance in plants. Curr. Opin. Plant Biol. 1:316-323[Medline].

DUCKETT, J. G. and D. J. READ, 1991  The use of the fluorescent dye, 3,3'-dihexyloxacarbocyanine iodide, for selective staining of ascomycete fungi associated with liverwort rhizoids and ericoid mycorrhizal roots. New Phytol. 118:259-272.

FODOR, F., G. GULLNER, A. L. ADAM, B. BARNA, and T. KONIVES et al., 1997  Local and systemic responses of antioxidants to tobacco mosaic virus infection and to salicylic acid in tobacco. Plant Physiol. 114:1443-1451[Abstract].

FRIEDRICH, L., K. LAWTON, W. RUESS, P. MASNER, and N. SPECKER et al., 1996  A benzothiadiazole derivate induces systemic acquired resistance in tobacco. Plant J. 10:61-70.

FRIEDRICH, L., K. LAWTON, R. A. DIETRICH, M. WILLITS, and R. CADE et al., 2001  NIM1 overexpression in Arabidopsis potentiates plant disease resistance and results in enhanced effectiveness of fungicides. Mol. Plant Microbe Interact. 14:1114-1124[Medline].

FRYE, C. A. and R. W. INNES, 1998  An Arabidopsis mutant with enhanced resistance to powdery mildew. Plant Cell 10:947-956[Abstract/Free Full Text].

FRYE, C. A., D. TANG, and R. W. INNES, 2001  Negative regulation of defense responses in plants by a conserved MAPKK kinase. Proc. Natl. Acad. Sci USA 98:373-378[Abstract/Free Full Text].

GAFFNEY, T., L. FRIEDRICH, B. VERNOOIJ, D. NEGROTTO, and G. NYE et al., 1993  Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261:754-756.

GLAZEBROOK, J., 2001  Genes controlling expression of defense responses in Arabidopsis—2001 status. Curr. Opin. Plant Biol. 4:301-308[Medline].

GLAZEBROOK, J., M. ZOOK, F. MERT, I. KAGAN, and E. E. ROGERS et al., 1997  Phytoalexin-deficient mutants of Arabidopsis reveal that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 146:381-392[Abstract].

GOERLACH, J., S. VOLRATH, G. KNAUF-BEITER, G. HENGY, and U. BECKHOVE et al., 1996  Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell 8:629-643[Abstract].

GOSTI, F., N. BERAUCHE, N. VARTANIAN, and J. GIRAUDAT, 1995  Abscisic acid-dependent and -independent regulation of gene expression by progressive drought in Arabidopsis thaliana. Mol. Gen. Genet. 246:10-18[Medline].

GRAY, J., P. S. CLOSE, S. P. BRIGGS, and G. S. JOHAL, 1997  A novel suppressor of cell death in plants encoded by the Lls1 gene of maize. Cell 89:25-31[Medline].

GREENBERG, J. T. and F. M. AUSUBEL, 1993  Arabidopsis mutants compromised for the control of cellular damage during pathogenesis and aging. Plant J. 4:327-342[Medline].

HAUGHN, G., and C. R. SOMERVILLE, 1987 Selection for herbicide resistance at the whole-plant level, pp. 98–107 in Biotechnology in Agricultural Chemistry. American Chemical Society, Washington, DC.

HOLUB, E. B. and J. L. BEYNON, 1997  Symbiology of mouse-ear cress (Arabidopsis thaliana) and oomycetes. Advances in botanical research. Adv. Plant Pathol. 24:227-273.

HOLUB, E. B., J. L. BEYNON, and I. R. CRUTE, 1994  Phenotypic and genotypic characterization of interactions between isolates of Peronospora parasitica and accessions of Arabidopsis thaliana.. Mol. Plant-Microbe Interact. 7:223-239.

HU, G., T. E. RICHTER, S. H. HULBERT, and T. PRYOR, 1996  Disease lesion mimicry caused by mutations in the rust resistance gene rp1.. Plant Cell 8:1367-1376[Abstract].

HUNT, M. D., T. P. DELANEY, R. A. DIETRICH, K. B. WEYMANN, and J. L. DANGL et al., 1997  Salicylate-independent lesion formation in Arabidopsis lsd mutants. Mol. Plant-Microbe Interact. 10:531-536[Medline].

INNES, R. W., A. F. BENT, B. N. KUNKEL, S. R. BISGROVE, and B. J. STASKAWICZ, 1993  Molecular characterization of avirulence gene avrRpt2 and identification of a putative regulatory sequence common to all known Pseudomonas syringae avirulence genes. J. Bacteriol. 175:4859-4869[Abstract/Free Full Text].

JABS, T., R. DIETRICH, and J. DANGL, 1996  Extracellular superoxide is necessary and sufficient for runaway cell death in an Arabidopsis mutant. Science 273:1853-1856[Abstract/Free Full Text].

JIRAGE, D., N. ZHOU, B. COOPER, J. CLARKE, and X. DONG et al., 2001  Constitutive salicylic acid-dependent signaling in cpr1 and cpr6 mutants requires PAD4. Plant J. 26:395-407[Medline].

KEOGH, R. C., B. J. DEVERALL, and S. MCLEOD, 1980  Comparison of histological and physiological responses to Phakopsora pachyrhizi in resistant and susceptible soybean. Trans. Br. Mycol. Soc. 74:329-333.

KLIEBENSTEIN, D. J., R. A. DIETRICH, A. C. MARTIN, R. L. LAST, and J. L. DANGL, 1999  LSD1 regulates salicylic acid induction of copper-zinc superoxide dismutase in Arabidopsis thaliana.. Mol. Plant-Microbe Interact. 12:1022-1026[Medline].

KONIECZNY, A. and F. M. AUSUBEL, 1993  A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4:403-410[Medline].

KOSAMBI, D. D., 1944  The estimation of map distances from recombination values. Ann. Eugen. 12:172-175.

LAGRIMINI, L. M., W. BURKHART, M. MOYER, and S. ROTHSTEIN, 1987  Molecular cloning of complementary DNA encoding the lignin-forming peroxidase from tobacco: molecular analysis and tissue-specific expression. Proc. Natl. Acad. Sci. USA 84:7542-7546[Abstract/Free Full Text].

LANDER, E. S., P. GREEN, J. ABRAHAMSON, A. BARLOW, and M. J. DALY et al., 1987  MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1:174-181[Medline].

LAWTON, K., L. FRIEDRICH, M. HUNT, K. WEYMANN, and T. DELANEY et al., 1996  Benzothiadiazole induces disease resistance in Arabidopsis by activation of the systemic acquired resistance signal transduction pathway. Plant J. 10:71-82[Medline].

LINCOLN, S., M. DALY and E. LANDER, 1992 Constructing Genetic Maps With Matchmaker/EXP 3.0. Whitehead Institute Technical Report, Cambridge, MA.

MALECK, K. and R. A. DIETRICH, 1999  Defense on multiple fronts: how do plants cope with diverse enemies. Trends Plant Sci. 4:215-219[Medline].

MALECK, K., A. LEVINE, T. EULGEM, A. MORGAN, and J. SCHMID et al., 2000  The transcriptome of Arabidopsis during systemic acquired resistance. Nat. Genet. 26:403-410[Medline].

MCDOWELL, J. M., M. DHANDAYDHAM, T. A. LONG, M. G. M. AARTS, and S. GOFF et al., 1998  Intragenic recombination and diversifying selection contribute to the evolution of downy mildew resistance at the RPP8 locus of Arabidopsis. Plant Cell 10:1861-1874[Abstract/Free Full Text].

MEDNIK, I. G., 1988  On methods evaluating the frequencies of induced mutations in Arabidopsis based on embryo-test data. Arabidopsis Inf. Serv. 26:67-72.

MELAN, M. A., X. DONG, M. E. ENDARA, K. R. DAVIS, and F. M. AUSUBEL et al., 1993  An Arabidopsis thaliana lipoxygenase gene can be induced by pathogens, abscisic acid, and methyl jasmonate. Plant Physiol. 101:441-450[Abstract].

MERLOT, S. and J. GIRAUDAT, 1997  Genetic analysis of abscisic acid signal transduction. Plant Physiol. 114:751-757[Medline].

OW, D., K. V. WOOD, M. DELUCA, J. R. DEWET, and D. R. HELINSKI et al., 1986  Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science 234:856-859[Abstract/Free Full Text].

PARKER, J. E., E. B. HOLUB, L. N. FROST, A. FALK, and N. D. GUNN et al., 1996  Characterization of eds1, a mutation in Arabidopsis suppressing resistance to Peronospora parasitica specified by several different RPP genes. Plant Cell 8:2033-2046[Abstract].

PETERHANSEL, C., A. FREIALDENHOFEN, J. KURTH, R. KOLSCH, and P. SCHULZE-LEFERT, 1997  Interaction analysis of genes required for resistance responses to powdery mildew in barley reveals distinct pathways leading to leaf cell death. Plant Cell 9:1397-1409[Abstract].

PETERSEN, M., P. BRODERSEN, H. NAESTED, E. ANDREASSON, and U. LINDHART et al., 2000  Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103:1111-1120[Medline].

REDEI, G. P., and C. KONCZ, 1992 Classical mutagenesis, pp. 16–82 in Methods in Arabidopsis Research, edited by C. KONCZ, N.-H. CHUA and J. SCHELL. World Scientific, Singapore.

ROGERS, J. C. and C. MILLIMAN, 1984  Coordinate increase in major transcripts from the high pI a-amylase multigene family in barley aleurone cells stimulated with gibberellic acid. J. Biol. Chem. 259:12234-12240[Abstract/Free Full Text].

ROMEIS, T., P. PIEDRAS, S. ZHANG, D. F. KLESSIG, and H. HIRT et al., 1999  Rapid, Avr9- and Cf9-dependent, activation of MAP kinases in tobacco cell cultures and leaves: convergence in resistance gene, elicitor, wound and salicylate responses. Plant Cell 11:273-287[Abstract/Free Full Text].

ROSE, A. B., A. L. CASSELMAN, and R. L. LAST, 1992  A phosphoribosylanthranilate transferase gene is defective in blue fluorescent Arabidopsis thaliana tryptophan mutants. Plant Physiol. 100:582-592[Abstract/Free Full Text].

RYALS, J., K. WEYMANN, K. LAWTON, L. FRIEDRICH, and D. ELLIS et al., 1997  The Arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor IkB. Plant Cell 9:425-439[Abstract].

RYALS, J. A., U. H. NEUENSCHWANDER, M. G. WILLITS, A. MOLINA, and H.-Y. STEINER et al., 1996  Systemic acquired resistance. Plant Cell 8:1809-1819[Medline].

SCHOTT, E. J., K. R. DAVIS, X. DONG, M. MINDRINOS, P. GUEVARA et al., 1990 Pseudomonas syringae infection of Arabidopsis thaliana as a model system for studying plant-bacterial interactions, pp. 82–90 in Pseudomonas: Biotransformations, Pathogenesis, and Evolving Biotechnology, edited by S. SIVER, A. CHAKRABARTY and B. IGLEWSKI. American Society for Microbiology, Washington, DC.

SHIRLEY, B., W. KUBASEK, G. STORZ, E. BRUGGEMAN, and M. KOORNEEF et al., 1995  Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis. Plant J. 8:659-671[Medline].

SUGIMOTO, A., R. R. HOZAK, T. NAKASHIMA, T. NISHIMOTO, and J. H. ROTHMAN, 1995  dad-1, an endogenous programmed cell death suppressor in Caenorhabditis elegans and vertebrates. EMBO J. 14:4434-4441[Medline].

THOMA, S., U. HECHT, A. KIPPERS, J. BOTELLA, S. DE VRIES et al., 1994 Tissue-specific expression of a gene encoding a cell wall-localized lipid transfer protein from Arabidopsis. Plant J. 1994: 35–45.

UKNES, S., B. MAUCH-MANI, M. MOYER, S. WILLIAMS, and S. DINCHER et al., 1992  Acquired resistance in Arabidopsis.. Plant Cell 4:645-656