help button home button Genetics AJP: Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Melnikova, L.
Right arrow Articles by Georgiev, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Melnikova, L.
Right arrow Articles by Georgiev, P.
Genetics, Vol. 160, 1549-1560, April 2002, Copyright © 2002

The gypsy Insulators Flanking yellow Enhancers Do Not Form a Separate Transcriptional Domain in Drosophila melanogaster: The Enhancers Can Activate an Isolated yellow Promoter

Larisa Melnikovaa, Maria Gause1,a, and Pavel Georgieva
a Department of the Control of Genetic Processes, Institute of Gene Biology, Russian Academy of Sciences, Moscow 117334, Russia

Corresponding author: Pavel Georgiev, Russian Academy of Sciences, 34/5 Vavilov St., Moscow 117334, Russia., pgeorg{at}biogen.msk.su (E-mail)

Communicating editor: J. A. BIRCHLER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The best-characterized insulator in Drosophila melanogaster is the Su(Hw)-binding region contained within the gypsy retrotransposon. In the y2 mutant, Su(Hw) protein partially inhibits yellow transcription by blocking the function of transcriptional enhancers located distally from the yellow promoter with respect to gypsy. Previously we have shown that yellow enhancers can overcome inhibition by a downstream insulator in the yrh1 allele, when a second gypsy element is located upstream of the enhancers. To understand how two insulators neutralize each other, we isolated various deletions that terminate in the regulatory region of the yrh1 allele. To generate these alleles we used DNA elongation by gene conversion of the truncated chromosomes at the end of the yellow regulatory region. We found that gypsy insulator can function at the end of the truncated chromosome. Addition of the gypsy insulator upstream of the yellow enhancers overcomes the enhancer-blocking activity of the gypsy insulator inserted between the yellow enhancers and promoter. These results suggest that the gypsy insulators do not form separate transcriptional domains that delimit the interactions between enhancers and promoters.


ENHANCERS exert long-distance effects, which raises the question as to how an enhancer specifically activates its target gene without affecting adjacent genes. Several sequences, referred to as insulators, have been found to prevent activation or repression from extending across them to a promoter. Two properties of the sequence making it an insulator have been described. Insertion of the insulator between an enhancer and a promoter inhibits the transcriptional activity (HOLDRIDGE and DORSETT 1991 Down; GEYER and CORCES 1992 Down); in addition, a transgene flanked on both sides by this sequence is protected from the repressive effect of heterochromatic sequences (ROSEMAN et al. 1993 Down, ROSEMAN et al. 1995 Down). Studies of the last few years have led to the identification and characterization of insulator sequences in a variety of organisms, ranging from yeast to mammals (CORCES and FELSENFELD 2000 Down; BELL et al. 2001 Down). Well-characterized insulators in Drosophila include the scs and scs' elements of the Drosophila heat shock gene (KELLUM and SCHEDL 1991 Down; ZHAO et al. 1995 Down), the Fab-7 (HAGSTROM et al. 1996 Down; ZHOU et al. 1996 Down; MIHALY et al. 1998 Down) and Fab-8 (ZHOU and LEVINE 1999 Down; ZHOU et al. 1999 Down; BARGES et al. 2000 Down), elements of the bithorax complex, and the insulator sequences found in the gypsy retrotransposon (CAI and LEVINE 1995 Down; GERASIMOVA et al. 1995 Down; SCOTT and GEYER 1995 Down). The best-studied vertebrate insulator was found in the 5' region of the chicken ß-globin locus (CHUNG et al. 1993 Down; BELL et al. 1999 Down). Recently, boundary elements flanking the repressed HMR locus that prevent spreading of silenced chromatin have been identified and characterized in yeast (BI and BROACH 1999 Down; BI et al. 1999 Down; DONZE et al. 1999 Down).

The best-characterized insulator is the gypsy insulator of Drosophila contained in the sequence of the gypsy retrotransposon (GEYER 1997 Down; CORCES and FELSENFELD 2000 Down; BELL et al. 2001 Down). Genetic and molecular approaches have led to the identification and characterization of two protein components of the gypsy insulator. One of them encoded by the suppressor of Hairy wing [su(Hw)] gene is a zinc-finger protein that binds to insulator DNA (DORSETT 1990 Down; SPANA and CORCES 1990 Down; SCOTT et al. 1999 Down). Modifier of mdg4 [Mod(mdg4)] is the second protein component of the gypsy insulator complex (GERASIMOVA et al. 1995 Down; GEORGIEV and KOZYCINA 1996 Down; GDULA and CORCES 1997 Down). The Mod(mdg4) protein has the BTB/POZ domain at the N-terminal end (GERASIMOVA et al. 1995 Down; BUCHNER et al. 2000 Down). It was shown (GAUSE et al. 2001 Down; GHOSH et al. 2001 Down) that the BTB domain of Mod(mdg4) is involved in self-interactions, whereas the C-terminal region of the protein is involved in interactions with the Su(Hw) protein. The interaction between BTB domains of Mod(mdg4) is postulated to be important for the insulator function (GEORGIEV et al. 2000 Down; GAUSE et al. 2001 Down; GHOSH et al. 2001 Down).

The yellow locus was used as a model system for study of the gypsy insulator (GEYER et al. 1986 Down; PARKHURST and CORCES 1986 Down; GEYER and CORCES 1992 Down). The yellow gene is required for larval and adult cuticle pigmentation (NASH and YARKIN 1974 Down). The pattern of temporal and spatial expression of the yellow gene is controlled by at least five independent, tissue-specific transcription enhancers (GEYER and CORCES 1987 Down; MARTIN et al. 1989 Down). The enhancers that control yellow expression in the wings and body cuticle are located in the 5' upstream region of the yellow gene, whereas the enhancers controlling yellow expression in the tarsal claw and bristles reside in the intron of the gene. In the y2 mutation (Fig 1A), the gypsy retrotransposon is inserted between the enhancers controlling the yellow expression in the wings and body cuticle and the yellow promoter (GEYER et al. 1986 Down). After gypsy insertion, enhancers active in the body and wing are blocked due to insulation.



View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. The structure of the yellow locus. (A) The y2 allele. (B) The yrh1 allele. The first exon of the yellow gene is shown by a thick black line. The arrow indicates the start and direction of transcription. The gypsy element is inserted at -700 bp from the transcriptional start site. The solid circle shows the Su(Hw)-binding sites. The wing (W) and body (B) enhancers of the yellow gene are represented by ovoid structures. The arrowheads indicate hobo elements and their direction. d-pr and p-pr, distal and proximal yellow promoters; d-En and p-En, distal and proximal yellow enhancers responsible for yellow activation in wing blade (W) and body cuticle (B); d-Su(Hw) and p-Su(Hw), distal and proximal gypsy insulators.

Previously we described a derivative of the y2 mutation, yrh1, that was generated by mobilization of hobo transposons flanking the gypsy transposon. As a result the yrh1 allele contained a duplication of the y2 regulatory region. Hobo-mediated duplication of the gypsy element completely inhibits the insulation of the yellow promoter separated from the body and wing enhancers by the gypsy insulator (Fig 1B). One interpretation of this observation is that intrachromosomal pairing between the two gypsy retrotransposons might cause the enhancers located between them to loop out and contact the promoter. Recent results have suggested that spatial constraints induced by homologous pairing could fold the chromatin in a loop and allow the yellow enhancers to bypass the gypsy insulator in the y2 allele (MORRIS et al. 1998 Down). Alternatively, an interaction between the proteins bound to the gypsy insulators might neutralize insulator activity. Recently it was found that when two copies of the gypsy insulator are inserted between an enhancer and a promoter, they can also neutralize each other and may even facilitate enhancer-promoter interaction (CAI and SHEN 2001 Down; MURAVYOVA et al. 2001 Down).

To explore these possibilities, we obtained various deletions in the yrh1 allele by using terminally deleted chromosomes that end in the regulatory region of the yellow gene. It was found that Su(Hw) may block the interaction between the yellow enhancers and promoter if the truncated chromosome ends distally to the yellow enhancers. Addition of at least 5 of 12 binding sites for Su(Hw) contained in the gypsy insulator upstream of the yellow enhancers overcomes the enhancer-blocking activity of the gypsy insulator inserted between the yellow enhancers and promoter. Thus, only the Su(Hw)-binding sites but not other gypsy sequences are required for neutralization of proximal insulator activity. These results suggest that pairs of gypsy insulators do not form separate loop domains to delimit the enhancer-promoter communication. It seems likely that two or several neighboring insulators preferentially interact with each other, either blocking or facilitating enhancer-promoter communication, depending on a local configuration of cis-regulatory elements.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila strains and crosses:
All flies were maintained at 25° on a standard yeast medium. The lines bearing mutations in the su(Hw) gene were obtained from V. Corces. The structure and origin of the su(Hw) mutations is described by HARRISON et al. 1993 Down.

To balance the truncated chromosome terminated in the yellow regulatory region, we used the yacw chromosome. This chromosome contains a deletion of the yellow and achaete genes but not of any vital genes and thus provides an opportunity to examine the behavior of the yellow gene on a homolog in the absence of other yellow sequences.

All other mutant alleles and chromosomes used in this work and all balancer chromosomes are described in LINDSLEY and ZIMM 1992 Down.

The lines with a su(Hw)- background were obtained by consecutive crossing of males bearing the transposons with C(1)RM,yf; D/T(2;3)apXa, C(1)RM,yf; su(Hw)v/T(2;3)apXa, and C(1)RM,yf; su(Hw)2sbd/T(2;3)apXa females as described (GEORGIEV and KOZYCINA 1996 Down). su(Hw)v is deletion of the su(Hw) gene; su(Hw)2 is a strong mutation induced by a jockey insertion in the first intron of the su(Hw) gene (HARRISON et al. 1993 Down).

Pigmentation scale:
For yellow phenotype determination, the extent of pigmentation in different tissues of adult flies was estimated visually in 3- to 5-day-old females developing at 25°. The scores were determined independently by two people and based upon at least 30 females from one or several independent crosses.

Flies of previously characterized y alleles were used as a reference to determine the levels of pigmentation. The wild-type expression was ranked as 5 while the absence of yellow expression was ranked as 0. This scale was developed in previous studies (GAUSE et al. 1998 Down). There can be small differences in pigmentation among flies scored at a particular value. Flies with variegated wing and body pigmentation have not been found.

Molecular methods:
For Southern blot hybridization, DNA from adult flies was isolated using the protocol described by ASHBURNER 1989 Down. Treatment of DNA with restriction endonucleases, blotting, fixation, and hybridization with radioactive probes prepared by random primer extension was performed as described in the protocols for Hybond-N+ nylon membrane (Amersham, Buckinghamshire, UK) and in the laboratory manual by SAMBROOK et al. 1989 Down. Subcloning and purification of the plasmid DNA and mapping of restriction sites were performed by standard techniques (SAMBROOK et al. 1989 Down).

PCR was done by standard techniques. The primers used in DNA amplification were from the yellow gene, hobo element, and gypsy. The nucleotide position is given in parentheses in accordance with the yellow sequences (GEYER et al. 1986 Down), the hobo (STRECK et al. 1986 Down), gypsy (MARLOR et al. 1986 Down), and HeT-A (BIESSMANN et al. 1992 Down) sequences. The primers in the yellow gene were the following: y1, 5' CAACATCAGCGGAGCGCGCTA 3' (1060-1039); y2, 5' acagttctcagaacacaactc 3' (2350-2371); y3, 5' TTATATGAAATACATGCAGAC 3' (2270-2249); and y4, 5' CTG TGG ACC GTG GCG GGT AAC 3' (2898-2877). The primers in the gypsy element were g1, 5' gcaagaaatgctgagtcggct 3' (150-171). In the hobo element the primers were h1, 5' gtgcgtggcgagtagcacccg 3' (81-60) and h2, 5' CATACGGCTCTTGCGCAGCAG 3' (2780-2801). The primers in the HeT-A element were H1, ATACTGCAAGTGGCGCGCATCC (455-434) and H2, GGTGCTTCCGTACTTCTGGCGG (359-338).

The products of amplification were fractionated by electrophoresis in 1.5% agarose gels in TAE. The successfully amplified products were cloned in a Bluescript plasmid (Stratagene, La Jolla, CA) and sequenced using the Amersham (Arlington Heights, IL) sequence kit.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The proximal yellow enhancers flanked by two gypsy can activate the proximal yellow promoter at the end of the deficient chromosome:
The main aim of this work is to study in detail the previously described phenomenon of neutralization of enhancer blocking in the presence of two gypsy insulators located on both sides of the yellow upstream enhancers (GAUSE et al. 1998 Down). The yrh1 allele derived from the y2 allele displays wild-type pigmentation of body cuticle and wing blade (GAUSE et al. 1998 Down). The yrh1 allele was generated by duplication of the gypsy and yellow sequences located between two hobo elements inserted in the yellow intron and wing enhancer (Fig 1B). The duplication of the body and wing enhancers, gypsy and yellow promoter, led to the restoration of yellow expression.

The activation of yellow expression in the yrh1 allele could be explained in three different ways (GAUSE et al. 1998 Down). The first is that the transcription occurs from the distal yellow promoter (d-pr) in the yrh1 allele, which is not isolated by the gypsy insulator from the wing and body enhancers located downstream (Fig 1B). The second possibility is that the ectopic pairing between two gypsy elements interferes with insulation of the wing and body enhancers. The third possibility is that the interaction between proteins bound to the gypsy insulators facilitates communication between the proximal yellow promoter and the distal or proximal yellow enhancers, as was shown for the two gypsy insulators interposed between enhancer and promoter (CAI and SHEN 2001 Down; MURAVYOVA et al. 2001 Down).

To test these models, we used the method of terminal chromosome elongation by gene conversion, which allows different combinations of the regulatory elements to be generated at the same genomic position. Ends of the deficient chromosomes may be elongated by gene conversion using the homologous sequences as a template (MIKHAILOVSKY et al. 1999 Down). By Southern blot analysis, three lines were selected carrying deficient chromosomes terminated in the region 100–200 bp downstream of the yellow transcription start site. The chromosomes carrying yellow terminal deficiencies (abbreviated as yTD) were balanced over the yacw chromosomes bearing a deficiency of the yellow-achaete region (Fig 2A). yTD/yacw females displayed a y1-like phenotype due to inactivation of the yellow gene in both X chromosomes.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. The schemes used to obtain terminal DNA elongation. (A) The genetic scheme to obtain the deficient chromosomes ended in the different regions of the yrh1 allele. The primers in the yellow locus and the hobo element used for PCR analysis are shown in Fig 3A. (B) The genetic scheme to obtain the deficient chromosomes ended in the distal gypsy element.

To induce terminal gene conversion, the yTD chromosome was paired with the yrh1scD1waG homologous chromosome containing the yrh1 allele as a template for terminal gene conversion. yTD/yacw females were crossed to yrh1scD1waG males (Fig 2A). F1 yTD/yrh1scD1waG daughters were collected and were mated with yrh1scD1waG males. The yTD/yrh1scD1waG females had a sc+ phenotype, while homozygous yrh1scD1waG/yrh1scD1waG females had a scD1 phenotype (several bristles were missing on the thorax and head). To produce more conversion tracks of a large size, we kept 40 independent lines (yTD/yrh1scD1waG x yrh1scD1waG/Y) for three generations. After that, yTD/yrh1scD1waG females obtained independently from each line were crossed to y1hscD1waG males. y1h was generated by deletion of the regulatory region and the first exon of the yellow gene (GAUSE et al. 1998 Down).

Two yTD/y1hscD1waG females detected by the sc+ phenotype displayed a wild-type level of cuticle pigmentation (y+ phenotype). These new yTD alleles, named yTDrh1 and yTDrh2, were studied by Southern blot analysis with the aid of digestion with different restriction enzymes: BamHI, EcoRI, BamHI and NcoI (Fig 3B), EcoRI and XhoI, BglII (not shown). All bands characteristic of the proximal gypsy element, proximal yellow enhancers, distal yellow promoter, and part of the distal gypsy element, including the insulator region, were detected. The terminal breaks were mapped in the sequences of the distal gypsy at ~4.5 kb (yTDrh1) and 6.0 kb (yTDrh2) from the 5' end (Fig 3B); i.e., they included most of gypsy.



View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. The structure of the yrh1 derivatives. (A) A schematic presentation of terminal yellow deficiencies associated with different yellow phenotypes. The diagrams indicate the approximate region of the end of the terminally truncated chromosome in the particular yellow terminal deficiency. The phenotypes of the yTD lines are indicated in parentheses. The HeT-A additions in the yTD2h4 alleles were cloned by PCR between the primers in the yellow regulatory region and HeT-A element. R, EcoRI; H, HindIII, G, BglII; X, XhoI; B, BamHI; N, NcoI. The genomic DNA fragment HindIII-BamHI, used for Southern blot analysis, is indicated by the thick line. Other designations are as in Fig 1. (B) Southern blot analysis of DNA prepared from the yrh1, yTDrh1, yTDrh2, yTD2h1, yTD2h2, yTD2h3, and yTD2h4 lines. The DNA was digested with BamHI or EcoRI or BamHI and NcoI. The filters were hybridized with the HindIII-BamHI probe. The underlined numbers correspond to the DNA fragments that hybridized with the proximal HindIII-BamHI probe. These DNA fragments are identical in the studied y alleles and in the initial yrh1 allele. (C) The junction between HeT-A and yellow in the yTD2h4 allele. The HeT-A element is attached at -123 bp in relation to the yellow transcription start site.

This result shows that the phenomenon of yellow activation in the yrh1 allele is reproduced at the terminus of a truncated chromosome and that the proximal yellow enhancers are sufficient for activation of the yellow promoter. This indicates that the model in which pairing between two gypsy elements brings the distal enhancers to the proximal promoter is incorrect.

The distal yellow promoter cannot activate yellow expression using the proximal yellow enhancers:
We expected that females bearing deficient chromosomes terminated in the region of the proximal yellow enhancers or the distal yellow promoter would display the y2-like phenotype and thus these females would not be selected by the phenotype screen (Fig 2A).

To identify such terminal deficiencies, we isolated the DNA from progeny of 40 yTD/y1hscD1waG females with y2-phenotype collected from each of the 40 lines (Fig 2A). The presence of the yellow regulatory region in the yTD/y1hscD1waG subpopulation was identified by PCR analysis between two pairs of primers shown in Fig 3A. DNA isolated from 3 of 40 lines showed the amplification of the appropriate DNA fragment with either one (y1/h1) or two (y1/h1; y2/h2) pairs of primers. To isolate individual females bearing elongated chromosomes, 15 individual yTD/y1hscD1waG females from each of 3 lines were examined by PCR with the same two pairs of primers.

Four different females with truncated yTD chromosomes were identified: yTD2h1, yTD2h2, yTD2h3, and yTD2h4. The structural studies involved Southern analysis of genomic DNA digested with BamHI, EcoRI, NcoI, and BamHI (Fig 3B) and probed with sequences complementary to the yellow promoter region (HindIII-BamHI). In three of them (yTD2h2, yTD2h3, and yTD2h4) the chromosome was terminated just upstream from the distal yellow promoter. All bands characteristic of the proximal gypsy element and proximal yellow enhancers were the same as in the control yrh1 line.

DNA isolated from yTD2h1 flies and restricted with BamHI gave just one 19-kb band hybridizing to the Hind-III-BamHI. This result suggests the distal promoter region to be absent in the yTD2h1 line. Further Southern analysis showed that the truncation was extended downstream from the distal yellow promoter into the body of the proximal hobo element (Fig 3A).

Southern blot analysis (data not shown) indicated that in the yTD2h1 and yTD2h4 lines the ends of the deficient chromosomes were healed by the attachment of >7 kb of HeT-A elements. To prove the nature of the attached elements, the junctions between terminal yellow sequences and new DNA attachments were cloned by PCR. The PCR primers were located in the yellow gene (y1, y4) and in the conserved regions from the 3' ends of HeT-A (H1 and H2). The sequencing of the junctions in the yTD2h4 showed that the HeT-A elements are attached at the position -123 with respect to the yellow transcription start site (Fig 3C). Our recent observations showed that the normal function of the yellow enhancers located at the tip of the chromosome required ~4 kb of additional upstream sequences (MIKHAILOVSKY et al. 1999 Down). Attachments of the HeT-A elements to the upstream yellow regulatory region facilitate activation of the yellow promoter by the wing and body enhancers (KAHN et al. 2000 Down; L. MELNIKOVA, O. KRAVCHUK and M. SAVITSKY, unpublished data). Thus, the absence of yellow activation in the yTD2h4 line suggests that the distal yellow promoter does not contribute to yellow activation in the yrh1 allele.

To study the role of the proximal gypsy insulator in blocking the yellow enhancer, we crossed yTD2h1, yTD2h2, and yTD2h4 into a su(Hw)- background. As in the case of the y2 allele (GEYER et al. 1986 Down), inactivation of the su(Hw) gene restored yellow expression in these alleles (data not shown). Thus, the gypsy insulator can block the enhancer-promoter communication at the end of the terminally truncated chromosome as in the normal genomic position.

The distal gypsy insulator is required for neutralization of the enhancer-blocking activity by the proximal gypsy insulator:
Besides the distal gypsy insulator, both yTDrh1 and yTDrh2 alleles acquired substantial parts of the distal gypsy sequences. To rule out the role of pairing between gypsy sequences in neutralization of the proximal gypsy insulator, we generated a number of lines that had the end of the deficient chromosome within or in close proximity to the distal gypsy insulator. As targets for gene conversion, we used the yTD2h2 and yTD2h3 alleles that had terminal breakpoints closest to the distal gypsy element (Fig 3A).

To induce a high frequency of terminal DNA elongation, we used the dominant enhancer-of-terminal conversion mutation, En(tc), isolated in our lab (L. MELNIKOVA, unpublished data). As the distal gypsy and the yellow promoter sequences are duplicated, it is possible to generate terminal DNA elongation using the sequences located at the same chromosome as a template. yTD/yacw; En(tc)/En(tc) females were obtained and crossed with yacw/Y; TM6,Tb/MKRS,Sb males (Fig 2B). In the next generation, females with darker pigmentation were selected. Four phenotypes with different levels of thorax and wing blade pigmentation were obtained and designated A (y2 phenotype), B, C, and D (y+ phenotype; Fig 4A). The variation in pigmentation in a particular area of cuticle was not greater than one point of the scale for any phenotypic class. The correlation between the phenotype and size of the chromosomal terminus was determined by Southern blot analysis (Fig 4B). The B phenotype is characterized by moderate pigmentation of the body and wing cuticle. It depends on the appearance of approximately one-half of the 12 binding sites for Su(Hw) protein. yTD/yacw females with C phenotype (close to wild-type level of wing and body pigmentation) contain sequences of the gypsy insulator and at least 200 bp of additional sequences located distally to the Su(Hw)-binding sites. The wild-type level (D phenotype) was established when a sequence of up to ~1 kb distal to the gypsy insulator was added. These results suggest that only the gypsy insulator sequences are required for neutralization of the activity of the proximal insulator element. In one derivative referred to as yTDh11, the end of the terminally truncated chromosome that terminated in the sequences of the gypsy insulator was healed by the HeT-A-like sequences with a size >10 kb (Fig 4). yTDh11 flies had a nearly wild-type level of body and wing pigmentation (C-like phenotype). To find the site of HeT-A attachment, we amplified the DNA fragment between primers in the 3' end of the HeT-A element (H1 and H2) and in yellow (y3) and gypsy (g1). Sequencing of the amplified fragment showed that the HeT-A element was attached at 823 bp of gypsy sequences (MARLOR et al. 1986 Down). Thus, the presence of only 5 of 12 su(Hw)-binding sites is enough to neutralize the proximal gypsy insulator.



View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. The distal upstream region of the yellow gene and the 5' region of the distal gypsy element. (A) The coordinate (in kilobases) in the yellow gene and gypsy are defined from the BamHI site. The Su(Hw)-binding sites are indicated by vertical lines in the box. The thin horizontal lines show the regions of the yellow and gypsy sequences in which the termini of the yellow terminal deficiencies that correspond to the same class of y phenotype have been mapped. A, B, C, and D designate different levels of fly pigmentation. The fly pigmentation was independently estimated in thoracic cuticle (1) and wing blade (2). The number of solid circles indicates the level of pigmentation that is characteristic of all yTD flies with a terminal deletion of this class. The open circles indicate variation of pigmentation inside the phenotypic class. The level of pigmentation was measured on a scale from 0 to 5 (circles): 0 corresponds to the pigmentation of y1 flies, 5 to the pigmentation of y+ flies. Other designations are as in Fig 1. (B) Molecular events at the tip of the X chromosome in yTD flies as monitored by Southern blot hybridization. DNA was isolated from the yTD/yacw derivatives displaying different y phenotypes (A, B, C, and D). The DNA was digested with BamHI. The filter was hybridized with the HindIII-BamHI fragment. The size of the BamHI-BamHI DNA fragment defines the distance between the distal BamHI site and the end of the deficient chromosome. The proximal 13-kb BamHI-BamHI DNA fragment indicated by the underlined number is common for all yTD lines. (C) The junction between HeT-A and gypsy in the yTDh11 allele. The HeT-A element is attached at 823 bp of the gypsy sequences (MARLOR et al. 1986 Down). A rectangle surrounds each of the five copies of the Su(Hw)-binding sites that remain in the yTDh11 allele.

The results show that the presence of the distal gypsy insulator at the end of the deficient chromosome is sufficient for activation of yellow transcription.

Only the proximal yellow enhancers located between the gypsy elements are required for activation of the yellow proximal promoter in the yrh1 allele:
To directly confirm the role of the proximal yellow enhancers in the yellow activation in the yTDrh1 and yTDrh2 lines, two additional experiments were performed. We made deficient chromosomes bearing two copies of gypsy with the proximal enhancers deleted. As a template, we used the ylh11 allele (Fig 5A), which had two tandem copies of the gypsy element (GAUSE et al. 1998 Down). To generate the deficient chromosomes terminated in the distal gypsy element, we used the same genetic scheme as described in Fig 2. yTD/y1h11scD1; En(tc)/En(tc) females were obtained and crossed with y1h11scD1/Y; En(tc)/En(tc) males in the fourth generations. After that, yTD/y1h11scD1; En(tc)/En(tc) females were crossed to yacw/Y; TM6,Tb/MKRS,Sb males. As a result, the En(tc) mutation was removed and progeny of 34 yTD/yacw; TM6,Tb/MKRS,Sb females were examined by Southern blot analysis (Fig 5C). Control y1h11 DNA restricted with BamHI gave just one 24-kb band hybridizing to the HindIII-BamHI probe (Fig 5C). In two yTD/yacw; TM6,Tb/MKRS,Sb lines displaying a y2-like phenotype, yTDlh1 and yTDlh2, the BamHI DNA fragments were correspondingly 10 and 12 kb in size. These DNA fragments hybridized only with the HindIII-BamHI probe. The detailed Southern blot analysis confirmed the presence of the proximal gypsy in the yTDlh1 and yTDlh2 alleles and mapped the ends of the deficient chromosomes in the distal gypsy element (Fig 5A and Fig C). The absence of yellow expression in these alleles shows that two copies of the gypsy insulator themselves fail to activate yellow in the absence of the proximal yellow enhancers.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. The structure of the ylh11 and ymh32 derivatives. (A) A schematic presentation of the ylh11 allele and terminal yellow deficiencies ended in the distal gypsy of ylh11. The vertical arrows indicate the approximate region of the end of the deficient chromosome in the particular yellow terminal deficiency. The genomic DNA fragments, SalI-BglII and HindIII-BamHI, used for Southern blot analysis, are indicated by thick black lines. All other designations are as in Fig 3. (B) A schematic presentation of the ymh32 allele and the terminal yellow deficiency ended in the distal gypsy of ymh32. (C) Southern blot analysis of DNA prepared from the ymh32, ylh11, yTDlh1, yTDlh2, and yTDmh1 lines. The DNA was digested with BamHI (B) or BamHI and EcoRI (B+R) or KpnI (K). The filters were hybridized with either the HindIII-BamHI probe or the SalI-BglII probe. The underlined numbers correspond to the DNA fragments that are identical in the initial ylh11 and ymh32 alleles and the derivative terminal yellow deficiencies.

The region between two gypsy insulators contains the distal yellow promoter that may facilitate the interaction between the yellow enhancers and promoter in the presence of the distal gypsy element. To examine this possibility, we used as template the previously described ymh32 allele (Fig 5B) that is generated by rearrangement between the hobo elements in the yellow and neighboring achaete-scute complex (GAUSE et al. 1998 Down). As a result, the yellow enhancers were flanked by two gypsy elements and the distal yellow promoter was removed. We used the ymh32 allele to generate chromosomes that contain only yellow enhancers flanked by two gypsy insulators at the ends. We obtained seven yTD/ymh32waG; En(tc)/En(tc) lines and kept them during five generations. To select for terminal elongation, we crossed yTD/ymh32waG; En(tc)/En(tc) females with yacw/Y; TM6,Tb/MKRS,Sb males. One yTD/yacw; TM6,Tb/En(tc) female displaying a y+-like phenotype was identified (yTDmh1). By Southern blot analysis, the end of the yTDmh1-deficient chromosome was mapped within the sequence of the distal gypsy element (Fig 5B and Fig C). All bands characteristic of the proximal gypsy element and the proximal yellow enhancers were detected. Thus, the yTDmh1 deficiency had only the proximal yellow enhancers, hobo element, and the distal gypsy insulator. Therefore, the distal yellow promoter is not required for yellow activation.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The yellow enhancers flanked by the gypsy insulators may activate an isolated yellow promoter:
In our previous work we showed that the ectopic intrachromosomal pairing between two gypsy elements or interactions between proteins bound to the gypsy insulators suppresses the insulation and permits enhancers located between two gypsy elements to activate yellow transcription in the yrh1 allele (GAUSE et al. 1998 Down). To discriminate between different mechanisms of neutralization of the insulator effect, we used the terminally deficient chromosomes bearing different combinations of the yellow regulatory elements and the gypsy insulators.

Broken chromosomes in Drosophila behave as capped chromosomes: They are transmitted through many generations (BIESSMANN and MASON 1988 Down; BIESSMANN et al. 1990 Down, BIESSMANN et al. 1992 Down; MIKHAILOVSKY et al. 1999 Down). It was shown that the yellow promoter is active in bristles at the end of the terminally deficient chromosome (BIESSMANN and MASON 1988 Down; KAHN et al. 2000 Down). Studies of many terminally deficient chromosomes truncated in the yellow regulatory region showed that the yellow gene is not activated by trans factors due to telomere localization and that the yellow activation in the body and wings requires the presence of the corresponding upstream enhancers (BIESSMANN and MASON 1988 Down; MIKHAILOVSKY et al. 1999 Down; KAHN et al. 2000 Down).

Here we found that the gypsy insulator can block the interaction between the yellow enhancers and promoter at the end of the deficient chromosome. Addition of part or all of a second gypsy insulator distal to the yellow enhancers neutralizes the enhancer-blocking activity of the proximal gypsy insulator. Moreover, the Su(Hw)-binding sites may neutralize the enhancer-blocking activity of the proximal gypsy insulator if they are placed just at the end of the chromosome. Thus, we can exclude the existence of the distally located regulatory elements that activate yellow expression over two paired gypsy insulators. As all combinations of the regulatory elements were obtained in the same genome position, the results are not influenced by chromosomal position effects. Thus, our results suggest that the distal gypsy insulator neutralizes the enhancer-blocking activity of the proximal gypsy insulator in the yrh1 allele and its derivatives obtained at the ends of the truncated chromosomes.

The mechanisms of enhancer blocking mediated by the gypsy insulator:
Current models for explaining insulator function are based on the assumption that the normal role of insulators in the nuclear is defined by two properties: (1) Insulator elements disrupt enhancer-promoter interactions when placed between them and (2) the insulator buffers transgenes from chromosomal position effects.

Several models have been proposed to account for insulator function (GEYER 1997 Down; DORSETT 1999 Down; UDVARDY 1999 Down; CORCES and FELSENFELD 2000 Down; BELL et al. 2001 Down). These models fall into two general classes, categorized as structural and transcriptional models. Transcriptional models suggest that insulators interfere directly with the transmission or reception of the enhancer signal by a promoter (GEYER 1997 Down; DORSETT 1999 Down; BELL et al. 2001 Down). The promoter decoy model assumes that insulators are regulatory sequences of the same class as enhancers and promoters and that their function is to regulate promoter-enhancer communication (GEYER 1997 Down). Insulators might accomplish this by assembling a protein complex similar to the transcription complex. These complexes may catch an enhancer into a nonproductive interaction. The interactions between the insulator decoy and the enhancer are reversible, given that the enhancer remains active and may be similar to the normal dynamic interactions between enhancers and promoters.

Structural models propose that insulators organize and define distinct chromatin domains that are physically inaccessible to each other, linking global chromosome organization with the functional properties of insulators. One class of structural models proposes that DNA within an insulator-defined domain is folded into higher-order chromatin structures that preclude associations between proteins in different domains (KELLUM and SCHEDL 1991 Down; UDVARDY 1999 Down). A second class of structural models suggests that the normal role of insulators is to organize the chromatin into distinct domains that establish independent regions of gene activity, such that regulatory regions present in one domain are unable to interact with promoters located in a different one (GERASIMOVA et al. 1995 Down, GERASIMOVA et al. 2000 Down; GERASIMOVA and CORCES 1998 Down; GHOSH et al. 2001 Down; MONGELARD and CORCES 2001 Down). The creation of a looped domain might not require attachment to some fixed site in the nucleus, but only interaction between proteins at the base of the loop (BELL et al. 2001 Down; GHOSH et al. 2001 Down). However, it has never been demonstrated that enhancers and promoters located in different loops cannot interact. Moreover, our results show that the yellow enhancers flanked by the gypsy insulators activate the promoter that should be located in the separate chromatin domain. A similar situation exists in the regulatory region of the Abd-B gene, where boundary elements like Fab-7 and Fab-8 flank the iab enhancer regions, insulating them from the silencing or activating effects of adjacent regulatory regions (MIHALY et al. 1998 Down; ZHOU et al. 1999 Down; BARGES et al. 2000 Down). However, as insulators, the boundary elements would also block activation of the Abd-B promoter by more distant iab enhancers, thus defeating the purpose of these enhancers. To explain this discrepancy, one can suggest that the iab enhancers can interact with the Abd-B promoter in spite of localization in the different loop domains formed by boundary elements.

Recently it was shown that in contrast to the known insulating properties of single gypsy insulators, insertion of two or even three copies of them between enhancer and promoter does not lead to insulation, but rather facilitates enhancer-promoter communication (CAI and SHEN 2001 Down; MURAVYOVA et al. 2001 Down). To explain these results it was suggested that a single intervening gypsy insulator may interact with other insulator or chromosomal/nuclear sites separating the enhancer and the promoter into topologically distinct chromatin domains. Two or three copies of the gypsy insulator may preferentially interact with each other, excluding other interactions necessary to sequester the enhancer from the promoter, and may even augment the enhancer-promoter interaction by looping out the intervening DNA. In support of this explanation, the recent finding showed that multiple contacts between Su(Hw) and Mod(mdg4) multimers are required for insulation (GAUSE et al. 2001 Down; GHOSH et al. 2001 Down). However, the direct interaction between two gypsy insulators has not been experimentally demonstrated.

As was shown for embryonic enhancers, the enhancer-blocking activity mediated by the gypsy insulators is enhanced when they flank the enhancer (CAI and SHEN 2001 Down). MURAVYUVA et al. (2001) also found that the yellow enhancers flanked by the gypsy insulators are completely blocked. To explain the discrepancy with the results obtained here, we suggest that the large distance between the gypsy insulators in the yrh1 allele is required for neutralization of the enhancer-blocking activity of the proximal gypsy insulator. If the yellow enhancers are tightly flanked by the gypsy insulators, the interaction between proteins bound by the gypsy insulators causes nonspecific steric hindrance that prevents enhancer-promoter communication. With increased distance between the gypsy insulators, as in the case of the yrh1 allele, the topology of the loops formed by the gypsy insulators does not prevent communication between the yellow enhancers and promoter. It seems possible that in the yrh1 allele two gypsy insulators flanking yellow enhancers may preferentially interact with each other, excluding other interactions necessary to sequester the yellow enhancer from the promoter. The presented results also show that further studies are required to understand the mechanisms of the insulation of the yellow enhancers in the y2 allele.


*  FOOTNOTES

1 Present address: Edward A. Doisy Department of Biochemistry and Molecular Biology, St. Louis University School of Medicine, St. Louis, MO 63104. Back


*  ACKNOWLEDGMENTS

The authors are sincerely grateful to Dr. Joel Eissenberg and Dr. Dale Dorsett for critical reading of the manuscript, corrections, and comments. This work was supported by the Russian State Program "Frontiers in Genetics," the Russian Foundation for Basic Research, by an International Research Scholar award from the Howard Hughes Medical Institute to P.G., by the JRP grant, Switzerland, and by the Volkswagen-Stiftung Foundation, Federal Republic of Germany.

Manuscript received October 1, 2001; Accepted for publication January 31, 2002.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BARGES, S., J. MIHALY, M. GALLONI, K. HAGSTROM, and M. MULLER et al., 2000  The Fab-8 boundary defines the distal limit of the bithorax complex iab-7 domain and insulated iab-7 from initiation elements and a PRE in the adjacent iab-8 domain. Development 127:779-790[Abstract].

BELL, A. C., A. G. WEST, and G. FELSENFELD, 1999  The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98:387-396[Medline].

BELL, A. C., A. G. WEST, and G. FELSENFELD, 2001  Insulators and boundaries: versatile regulatory elements in the eukaryotic genome. Science 291:447-450[Abstract/Free Full Text].

BI, X. and J. R. BROACH, 1999  UASrpg can function as a heterochromatin boundary element in yeast.. Genes Dev. 13:1089-1101[Abstract/Free Full Text].

BI, X., M. BRAUNSTEIN, G. J. SHEI, and J. R. BROACH, 1999  The yeast HML I silencer defines a heterochromatin domain boundary by directional establishment of silencing. Proc. Natl. Acad. Sci. USA 96:11934-11939[Abstract/Free Full Text].

BIESSMANN, H. and J. M. MASON, 1988  Progressive loss of DNA sequences from terminal chromosome deficiencies in Drosophila melanogaster.. EMBO J. 7:1081-1086[Medline].

BIESSMANN, H., S. B. CARTER, and J. M. MASON, 1990  Chromosome ends in Drosophila without telomeric DNA sequences. Proc. Natl. Acad. Sci. USA 87:1758-1761[Abstract/Free Full Text].

BIESSMANN, H., K. VALGEIRSDOTTIR, A. LOFSKY, C. CHIN, and B. GINTHER et al., 1992  HeT-A, a transposable element specifically involved in healing broken chromosome ends in Drosophila melanogaster.. Mol. Cell. Biol. 12:3910-3918[Abstract/Free Full Text].

BUCHNER, K., P. ROTH, G. SCHOTTA, V. KRAUSS, and H. SAUMWEBER et al., 2000  Genetic and molecular complexity of the position effect variegation modifier mod(mdg4) in Drosophila.. Genetics 155:141-157[Abstract/Free Full Text].

CAI, H. and M. LEVINE, 1995  Modulation of enhancer-promoter interactions by insulators in the Drosophila embryo. Nature 376:533-536[Medline].

CAI, H. N. and P. SHEN, 2001  Effects of cis arrangement of chromatin insulators on enhancer-blocking activity. Science 291:493-495[Abstract/Free Full Text].

CHUNG, J. H., M. WHITELY, and G. FELSENFELD, 1993  A 5' element of the chicken ß-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila.. Cell 74:505-514[Medline].

CORCES, V. G., and G. FELSENFELD, 2000 Chromatin boundaries, pp. 278–299 in Chromatin Structure and Gene Expression, edited by S. C. R. ELGIN and J. L. WORKMAN. Oxford University Press, Oxford.

DONZE, D., C. R. ADAMS, J. RINE, and R. T. KAMAKAKA, 1999  The boundaries of the silenced HMR domain in Saccharomyces cerevisiae. Genes Dev. 13:698-708[Abstract/Free Full Text].

DORSETT, D., 1990  Potentiation of a polyadenylation site by a downstream protein DNA interaction. Proc. Natl. Acad. Sci. USA 87:4373-4377[Abstract/Free Full Text].

DORSETT, D., 1999  Distant liaisons: long-range enhancer-promoter interactions in Drosophila. Curr. Opin. Genet. Dev. 9:505-514[Medline].

GAUSE, M., H. HOVHANNISYAN, T. KAHN, S. KUHFITTIG, and V. MOGILA et al., 1998  hobo induced rearrangements in the yellow locus influence the insulation effect of the gypsy su(Hw)-binding region in Drosophila melanogaster.. Genetics 149:1393-1405[Abstract/Free Full Text].

GAUSE, M., P. MORCILLO, and D. DORSETT, 2001  Insulation of enhancer-promoter communication by a gypsy transposon insert in the Drosophila cut gene: cooperation between suppressor of Hairy-wing and modifier of mdg4 proteins. Mol. Cell. Biol. 21:4807-4817[Abstract/Free Full Text].

GDULA, D. A. and V. G. CORCES, 1997  Characterization of functional domains of the su(Hw) protein that mediate the silencing effect of mod(mdg4) mutations. Genetics 145:153-161[Abstract].

GEORGIEV, P. and M. KOZYCINA, 1996  Interaction between mutations in the suppressor of Hairy wing and modifier of mdg4 genes of Drosophila melanogaster affecting the phenotype of gypsy-induced mutations. Genetics 142:425-436[Abstract].

GEORGIEV, P. G., E. E. MURAVYOVA, A. K. GOLOVNIN, E. M. GRACHEVA, T. YU, and T. YUBELENKAYA, 2000  Insulators and long-distance interactions between regulatory elements in higher eukaryotes. Genetika 36:1336-1343.

GERASIMOVA, T. I. and V. G. CORCES, 1998  Polycomb and trithorax group proteins mediate the function of a chromatin insulator. Cell 92:511-521[Medline].

GERASIMOVA, T. I., D. A. GDULA, D. V. GERASIMOV, O. B. SIMONOVA, and V. G. CORCES, 1995  A Drosophila protein that impacts directionality on a chromatin insulator is an enhancer of position-effect variegation. Cell 82:587-597[Medline].

GERASIMOVA, T. I., K. BYRD, and V. G. CORCES, 2000  A chromatin insulator determines the nuclear localization of DNA. Mol. Cell 6:1025-1035[Medline].

GEYER, P. K., 1997  The role of insulator elements in defining domains of gene expression. Curr. Opin. Genet. Dev. 7:242-248[Medline].

GEYER, P. K. and V. G. CORCES, 1987  Separate regulatory elements are responsible for the complex pattern of tissue-specific and developmental transcription of the yellow locus in Drosophila melanogaster.. Genes Dev. 1:996-1004[Abstract/Free Full Text].

GEYER, P. K. and V. G. CORCES, 1992  DNA position-specific repression of transcription by a Drosophila zinc finger protein. Genes Dev. 6:1865-1873[Abstract/Free Full Text].

GEYER, P. K., C. SPANA, and V. G. CORCES, 1986  On the molecular mechanism of gypsy-induced mutations at the yellow locus of Drosophila melanogaster.. EMBO J. 5:2657-2662[Medline].

GHOSH, D., T. I. GERASIMOVA, and V. G. CORCES, 2001  Interactions between the Su(Hw) and Mod(mdg4) proteins required for gypsy insulator function. EMBO J. 20:2518-2527[Medline].

HAGSTROM, K., M. MULLER, and P. SCHEDL, 1996  Fab-7 functions as a chromatin domain boundary to ensure proper segment specification by the Drosophila bithorax complex. Genes Dev. 10:3202-3215[Abstract/Free Full Text].

HARRISON, D. A., D. A. GDULA, R. S. COYNE, and V. G. CORCES, 1993  A leucine zipper domain of the suppressor of Hairy-wing protein mediates its repressive effect on enhancer function. Genes Dev. 7:1966-1978[Abstract/Free Full Text].

HOLDRIDGE, C. and D. DORSETT, 1991  Repression of hsp70 heat shock gene transcription by the suppressor of Hairy-wing protein of Drosophila melanogaster.. Mol. Cell. Biol. 11:1894-1900[Abstract/Free Full Text].

KAHN, T., M. SAVITSKY, and P. GEORGIEV, 2000  Attachment of HeT-A sequences to chromosomal termini in Drosophila melanogaster may occur by different mechanisms. Mol. Cell. Biol. 20:7634-7642[Abstract/Free Full Text].

KELLUM, R. and P. SCHEDL, 1991  A position-effect assay for boundaries of higher order chromosomal domains. Cell 64:941-950[Medline].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, New York.

MARLOR, R. L., S. M. PARKHURST, and V. G. CORCES, 1986  The Drosophila melanogaster gypsy transposable element encodes putative gene products homologous to retroviral proteins. Mol. Cell. Biol. 6:1129-1134[Abstract/Free Full Text].

MARTIN, M., Y. B. MENG, and W. CHIA, 1989  Regulatory elements involved in the tissue-specific expression of the yellow gene of Drosophila.. Mol. Gen. Genet. 218:118-126[Medline].

MIHALY, J., I. HOGGA, S. BARGES, M. GALLONI, and R. K. MISHRA et al., 1998  Chromatin domain boundaries in the Bithorax complex. Cell. Mol. Life Sci. 54:60-70[Medline].

MIKHAILOVSKY, S., T. BELENKAYA, and P. GEORGIEV, 1999  Broken chromosome ends can be elongated by conversion in Drosophila melanogaster.. Chromosoma 108:114-120[Medline].

MONGELARD, F. and V. G. CORCES, 2001  Two insulators are not better than one. Nat. Struct. Biol. 8:192-194[Medline].

MORRIS, J. R., J.-L. CHEN, P. K. GEYER, and C.-T. WU, 1998  Two modes of transvection: enhancer action in trans and bypass of a chromatin insulator in cis.. Proc. Natl. Acad. Sci. USA 95:10740-10745[Abstract/Free Full Text].

MURAVYOVA, E., A. GOLOVNIN, E. GRACHEVA, A. PARSHIKOV, and T. BELENKAYA et al., 2001  Loss of insulator activity by paired Su(Hw) chromatin insulators. Science 291:495-497[Abstract/Free Full Text].

NASH, W. G. and R. J. YARKIN, 1974  Genetic regulation and pattern formation: a study of the yellow locus in Drosophila melanogaster. Genet. Res. 24:19-26[Medline].

PARKHURST, S. and V. G. CORCES, 1986  Interactions among the gypsy element and the yellow and suppressor of Hairy-wing loci in Drosophila melanogaster. Mol. Cell. Biol. 6:47-53[Abstract/Free Full Text].

ROSEMAN, R. R., V. PIRROTTA, and P. K. GEYER, 1993  The su(Hw) protein insulates expression of the Drosophila melanogaster white gene from chromosomal position-effects. EMBO J. 12:435-442[Medline].

ROSEMAN, R. R., E. A. JOHNSON, C. K. RODESCH, M. BJERKE, and R. N. NAGOSHI et al., 1995  A P element containing suppressor of Hairy-wing binding region has novel properties for mutagenesis in Drosophila melanogaster.. Genetics 141:1061-1074[Abstract].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCOTT, K. S. and P. K. GEYER, 1995  Effects of the su(Hw) insulator protein on the expression of the divergently transcribed Drosophila yolk protein genes. EMBO J. 14:6258-6279[Medline].

SCOTT, K. S., A. D. TAUBMAN, and P. K. GEYER, 1999  Enhancer blocking by the Drosophila gypsy insulator depends upon insulator anatomy and enhancer strength. Genetics 153:787-798[Abstract/Free Full Text].

SPANA, C. and V. G. CORCES, 1990  DNA bending is a determinant of binding specificity for a Drosophila zinc finger protein. Genes Dev. 4:1505-1515[Abstract/Free Full Text].

STRECK, R. D., J. E. MACCAFFEY, and S. K. BECKENDORF, 1986  The structure of hobo transposable elements and their insertion sites. EMBO J. 5:3615-3623[Medline].

UDVARDY, A., 1999  Dividing the empire: Boundary chromatin elements delimit the territory of enhancers. EMBO J. 18:1-8[Medline].

ZHAO, K., C. M. HART, and U. K. LAEMMLI, 1995  Visualization of chromosomal domains with boundary element-associated factor BEAF-32. Cell 81:879-889[Medline].

ZHOU, J. and M. LEVINE, 1999  A novel cis-regulatory element, the PTS, mediates an anti-insulator activity in the Drosophila embryo. Cell 99:567-575[Medline].

ZHOU, J., S. BAROLO, P. SZYMANSKI, and M. LEVINE, 1996  The Fab-7 element of the bithorax complex attenuates enhancer-promoter interactions in the Drosophila embryo. Genes Dev. 10:3195-3201[Abstract/Free Full Text].

ZHOU, J., H. ASHE, C. BURKS, and M. LEVINE, 1999  Characterization of the transvection mediating region of the Abdominal-B locus in Drosophila.. Development 126:3057-3065[Abstract].




This article has been cited by other articles:


Home page
GeneticsHome page
M. Karakozova, E. Savitskaya, L. Melnikova, A. Parshikov, and P. Georgiev
The Mod(mdg4) Component of the Su(Hw) Insulator Inserted in the P Transposon Can Repress Its Mobility in Drosophila melanogaster
Genetics, July 1, 2004; 167(3): 1275 - 1280.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Melnikova and P. Georgiev
Enhancer of terminal gene conversion, a New Mutation in Drosophila melanogaster That Induces Telomere Elongation by Gene Conversion
Genetics, November 1, 2002; 162(3): 1301 - 1312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal