- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- A corrigendum has been published
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Barlow, M.
- Articles by Hall, B. G.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Barlow, M.
- Articles by Hall, B. G.
Predicting Evolutionary Potential: In Vitro Evolution Accurately Reproduces Natural Evolution of the TEM ß-Lactamase
Miriam Barlowa and Barry G. Hallaa Biology Department, University of Rochester, Rochester, New York 14627-0211
Corresponding author: Barry G. Hall, Hutchison Hall, University of Rochester, Rochester, NY 14627-0211., drbh{at}mail.rochester.edu (E-mail)
Communicating editor: G. B. GOLDING
| ABSTRACT |
|---|
To evaluate the validity of our in vitro evolution method as a model for natural evolutionary processes, the TEM-1 ß-lactamase gene was evolved in vitro and was selected for increased resistance to cefotaxime, cefuroxime, ceftazadime, and aztreonam, i.e., the "extended-spectrum" phenotype. The amino acid substitutions recovered in 10 independent in vitro evolvants were compared with the amino acid substitutions in the naturally occurring extended-spectrum TEM alleles. Of the nine substitutions that have arisen multiple times in naturally occurring extended-spectrum TEM alleles, seven were recovered multiple times in vitro. We take this result as evidence that our in vitro evolution technique accurately mimics natural evolution and can therefore be used to predict the results of natural evolutionary processes. Additionally, our results predict that a phenotype not yet observed among TEM ß-lactamases in natureresistance to cefepimeis likely to arise in nature.
THERE is a long history of using microbial systems as models to study the evolution of novel enzyme functions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
There is also growing evidence that in vitro evolution mimics natural evolutionary processes and can therefore be used as a predictor of natural evolutionary processes (![]()
![]()
![]()
![]()
To assess the validity of a given in vitro evolution method as a predictor of natural evolution we need to compare the outcomes of the two processes. Ideally, we would begin with a natural ancestral gene, evolve that gene in vitro under selective conditions similar to those encountered by natural descendants of that gene, and compare the profile of resulting amino acid substitutions obtained in the laboratory with those that occurred in nature. Very few examples in nature will allow us to obtain an ancestral gene, to know the conditions under which it evolved, and to obtain the descendants that evolved under those conditions. Fortunately, the recent rapid evolution of antibiotic resistance has provided us with exactly such a system.
The evolution of antibiotic resistance has had an enormous impact on modern medicine, industry, and science. Drug resistance has threatened public health and has caused doctors and hospitals to revise their strategies for treating infections and illness (![]()
Because of their efficiency, specificity, and general absence of toxicity, ß-lactam antibiotics, including penicillin, ampicillin, and the cephalosporins and monobactams and their derivatives, account for
50% of global antibiotic consumption (![]()
![]()
![]()
![]()
![]()
The evolution of the TEM ß-lactamases has occurred largely in response to selection imposed by the clinical use of ß-lactam antibiotics. At this time, >90 different alleles descended from TEM-1 have been isolated in clinics and hospitals. TEM alleles are distinguished strictly by differences in amino acid, not nucleotide, sequences. For a complete list of the currently identified TEM alleles see http://www.lahey.org/studies/webt.htm. The TEM-1 ß-lactamase hydrolyzes only penicillins and very early cephalosporins effectively, but hydrolyzes more modern cephalosporins and monobactams ineffectively. Within 3 years of the clinical debuts of most new ß-lactam antibiotics, descendants of TEM-1 have typically evolved the ability to hydrolyze the new drugs effectively (![]()
![]()
Through the directed evolution of the TEM-1 ß-lactamase, several researchers have been able to recover substitutions that have arisen in nature. ![]()
![]()
![]()
Each of these studies recovered amino acid substitutions that are present in naturally occurring extended-spectrum or inhibitor-resistant TEM ß-lactamases, but only two explicitly addressed the issue of using directed evolution to predict the natural evolution of TEM ß-lactamases (![]()
![]()
![]()
![]()
![]()
![]()
We are not convinced that it is possible to generalize the validity of in vitro evolution as a predictor of natural evolution over all in vitro evolution methods. For instance, the mutagenic spectra of the various methods differ significantly from each other and from spontaneous mutagenic spectra that have been measured (see Table 1) and we consider it unlikely that such dissimilar mutagenic spectra would yield equally valid predictions of natural evolution. It is our purpose here to test the specific in vitro evolution method that we use with respect to its validity as a predictor of natural evolution. If the method validly predicts natural evolution then it can be used to predict the natural evolution of novel substrate specificities for the TEM ß-lactamases, to predict the evolution of other ß-lactamases, to predict the evolution of other antibiotic resistance genes, and to predict the evolution of other functions in microorganisms.
|
The several studies that have used in vitro evolution to improve the activity of TEM ß-lactamases have all selected for improved activity toward a single drug, and in most cases the goal has been to maximize the resistance conferred by the mutant allele. While the results of each of those studies may well represent a technical tour de force, we do not think that they represent a very realistic approach to predicting natural evolution. For instance, selection for improved resistance to a single drug fails to take into account the fact that in nature extant alleles are likely to encounter a variety of drugs. Indeed, no systematic approach for using in vitro evolution to predict how evolution will occur in nature has yet been described.
For evolution to act the same way in vitro that it does in vivo, three features of natural evolution should be preserved in an artificial evolutionary system. First, the target gene should be randomly mutated and the mutagenic spectrum of the enzyme used to mutate it should be similar to the mutagenic spectrum of the organism from which the gene was taken. Second, the selective pressure used for the in vitro evolution of a gene should be similar to the selective pressure in nature. Third, selection for advantageous phenotypes already conferred by the gene should be maintained during the in vitro evolution of that gene.
In this article we expand upon the preliminary work that others have done to show that our method of in vitro evolution mimics natural evolutionary processes, and we develop a systematic approach for using in vitro evolution as a general predictor of natural evolution and assess the validity of this approach in more general terms than have previously been addressed.
| MATERIALS AND METHODS |
|---|
Bacterial strains and plasmids:
Escherichia coli strain DH5
E [F-
80dlacZ
M15
(lacZYA-argF)U169 endA1 recA1 hsdR17(r - m+) deoR thi-1 phoA supE44
- gyrA96 relA1 gal-; GIBCO BRL, Gaithersburg, MD] was used as the host for all plasmids.
Plasmid pACSE3 was used as the vector for cloning and expressing TEM alleles. pACSE3 was created in three steps. In step 1 the MscI fragment (base pairs 29383980) of pACYC184 (![]()
Plasmids pACTEM1 and pACTEM3 are pACSE3, into which the TEM-1 and TEM-3 genes, respectively, have been cloned as described below.
Media:
L-broth is 10 g tryptone, 5 g yeast extract, 10 g NaCl, and 1 g/liter glucose. L-tetracycline medium is L-broth containing 15 mg/liter tetracycline. Mueller-Hinton broth (Difco), the standard medium for assessing antibiotic resistance, was prepared according to the manufacturer's instructions. SOC medium is 20 g tryptone and 5 g/liter yeast extract with 10 mM NaCl, 2.5 mM KCl, 10 mM MgSO4, 10 mM MgCl2, and 20 mM glucose. Solid media contained 15 g/liter agar.
Recombinant DNA methodology:
Plasmids were prepared from overnight cultures grown in L-tetracycline broth. Plasmids were purified using the QIAGEN (Chatsworth, CA) QuickSpin kit according to manufacturer's instructions.
TEM-1, TEM-3, and the mutated TEM alleles were amplified with the Failsafe (Epicentre, Madison, WI) polymerase system using FailSafe Buffer A and the following cycling program: denaturation at 94° for 30 sec, annealing at 65° for 30 sec and extension at 72° for 90 sec repeated for 25 cycles, followed by 1 cycle of 72° for 5 min. TEM-1 was amplified from pBR322 (![]()
The resulting amplicons were purified with QIAGEN PCR purification columns according to the manufacturer's instructions and digested with the restriction endonucleases BspHI (New England Biolabs) and SacI (New England Biolabs, Beverly, MA). The plasmid pACSE3 was digested with the restriction endonucleases BspHI and SacI and dephosphorylated with calf intestinal alkaline phosphatase (New England Biolabs). Digested amplicons and vector were purified with QIAGEN PCR purification columns, combined, ligated with T4 DNA Ligase (GIBCO BRL), and transformed into strain DH5
E by electroporation.
Mutagenesis:
Mutant TEM alleles were created by introducing random mutations into TEM-1 with the Genemorph PCR mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The primers used for the PCR amplification were P3 (TCATCCGGCTCGTATAATGTGTGGA) and P4 (ACTCTCTTCCGGGCGCTATCAT). Those primers flank the multiple cloning site of pACSE3 and are used to amplify inserts cloned into this vector.
The mutation frequency is determined by the number of amplification cycles using the Mutazyme enzyme in the Genemorph kit. The number of cycles was chosen to introduce, on average, two mutations into the TEM coding sequence.
The resulting mutated amplicons were further amplified with the FailSafe system as described above, digested with BspHI and SacI endonucleases, ligated into plasmid pACSE3, and electroporated into strain DH5
E. After allowing 90 min for expression in SOC medium at 37°, an aliquot of the transformed culture was suitably diluted and spread onto L-tetracycline plates to estimate the total number of transformants, i.e., the total library size. The remainder of the culture was diluted into L-tetracycline broth and allowed to grow overnight to expand the library. An aliquot of the expanded library was stored frozen in 9% dimethylsulfoxide at -80°.
The following day nine colonies were randomly chosen from an L-tetracycline plate, boiled to make a crude DNA preparation, and used as template in a PCR reaction with primers P3 and P4. The resulting amplicons were subjected to agarose gel electrophoresis, and the effective library size was estimated from the fraction of colonies containing insert-bearing plasmids.
Expression of TEM alleles:
Cloned TEM alleles from pACSE3-based plasmids are expressed from the pTac promoter that is tightly regulated by the lac repressor that is encoded by the lacI gene on plasmid pACSE3. Expression of the TEM alleles was induced by isopropyl-ß-D-thiogalactopyranoside (IPTG). To determine the concentration of IPTG required to induce the expression of TEM at appropriate levels, the minimum inhibitory concentrations (MICs) of pipericillin, cephalothin, and cefuroxime for a strain of DH5
-E carrying a naturally occurring plasmid bearing TEM-3 were determined. The concentration of IPTG required to give an equivalent MIC for those antibiotics for the DH5
E-carrying plasmid pACTEM3 was determined to be 50 µM IPTG.
Antibiotics and determination of MICs:
The following ß-lactam antibiotics were used in this study: ampicillin (Sigma, St. Louis), pipericillin (Sigma), pipericillin + tazobactam (Lederle), temocillin (SmithKline Beecham), ticarcillin (SmithKline Beecham), ticarcillin + clavulanate (SmithKline Beecham), cephalothin (Sigma), cefuroxime (Sigma), ceftriaxone (Roche), ceftazidime (Glaxo Wellcome), cefotaxime (Sigma), cefepime (Bristol-Myers Squibb), and aztreonam (Bristol-Myers Squibb). Stock solutions of antibiotics were prepared in 0.1 M NaPO4 buffer, pH 7.0, and stored at -80° in single-use aliquots.
MICs were determined from 0.5-ml cultures at a titre of 105 cells/ml in Mueller-Hinton broth (Difco) containing 50 µM IPTG. Twofold serial dilutions of the antibiotics were added to each culture and the cultures were grown overnight at 37°. The MIC is defined as the lowest concentration of antibiotic that completely prevented visible growth of the culture.
Disk diffusion test for antibiotic resistance:
Mueller-Hinton agar containing 50 µM IPTG was spread with
108 cells from standing overnight cultures in L-tetracycline broth of the strains being tested. The plates were then stamped with a set of antibiotic discs (BBL) containing cephalothin (30 µg), pipericillin (100 µg), ceftazadime (30 µg), cefotaxime (30 µg), cefuroxime (30 µg), and aztreonam (30 µg). The resistance phenotype is indicated by the zone of inhibition around each disk after incubation of the plate overnight at 37°.
Selection for extended-spectrum TEM alleles:
Fifty-milliliter cultures in Mueller-Hinton broth containing 50 µM IPTG, each containing a number of cells equivalent to 10 times the total library size, were adjusted to cefotaxime concentrations, in twofold increments, ranging from 0.125 µg/ml (the TEM-1 MIC) to 32 µg/ml (the cefotaxime MIC for TEM-3 in our hands). Cultures were incubated for 36 hr at 37°, a time sufficient for a single cell to grow to culture saturation. The inoculum of 10 times the total library size ensured that the probability that any member of the library was absent from a culture was <10-4. The culture that grew at the highest concentration of cefotaxime was selected and grown in a similar dilution series of cultures in cefuroxime-containing medium, followed by similar selections in ceftazadime and aztreonam at concentrations from the TEM-1 MIC up to twice the concentration that is defined by the NCCLS as indicating clinical resistance (NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS 1999). To ensure that resistance to ampicillin, pipericillin, and cephalothin had been retained, the culture was sequentially grown in the presence of each drug at twice the clinical MIC concentration.
A population was considered to be fully resistant to a drug only if it grew at the highest concentration used for selection. At the end of the first round of selection no population was fully resistant to any of the four "extended-spectrum" drugs. Plasmid was prepared from the final culture grown in cephalothin-containing medium and subjected to mutagenesis and cloning as described above. A second, identical, round of selection was carried out, after which the population was fully resistant to all four extended-spectrum drugs.
To assess the number of unique alleles, plasmid was purified from the final second-round culture, electroporated into DH5
E, and 15 individual transformants were selected on L-tetracycline agar. Phenotypic differences were assessed by disk diffusion tests. In eight of the nine evolved lines the phenotypes of the 15 individuals were indistinguishable, suggesting that a single mutant clone dominated the culture, a phenomenon known as clonal displacement. One individual was retained, phenotypically characterized on several drugs (Table 2), and sequenced (Table 3).
|
|
Eight similar experiments were conducted, differing only in the order with which the mutagenized libraries were challenged by the extended-spectrum drugs. Experiments 1, 2, and 3 were as described above. For experiments 4 and 5, the order of selection was cefuroxime, ceftazadime, aztreonam, cefotaxime; for experiments 6 and 7, the order was ceftazadime, aztreonam, cefotaxime, cefuroxime; and for experiments 8 and 9, the order was aztreonam, cefotaxime, cefuroxime, ceftazadime.
Sequencing:
For TEM-1, TEM-3, and each TEM allele that was selected, the sequence was verified or determined from an amplicon of the TEM insert. Amplification reactions were carried out using Taq PCR Master Mix (QIAGEN) with primers P3 and P4 under the conditions described above. The amplicons were purified with the QIAGEN PCR purification columns and sequenced on an ABI Prism 377 DNA sequencer with the ABI Prism BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems) according to the manufacturer's protocol.
Phylogenetic analysis:
Sequences were obtained from GenBank. A complete list of accession numbers and references is available at http://www.rochester.edu/College/BIO/labs/HallLab/TEM_Phylo.html. Sequences were aligned using ClustalX (![]()
Phylogenies were constructed by the Bayesian method (![]()
![]()
![]()
![]()
![]()
The evolutionary model was the general time reversible model (![]()
One of the advantages of Bayesian inference of phylogeny is that the results are easy to interpret. For example, the sum of the posterior probabilities of all trees will be 1. Moreover, the posterior probability of any single clade is simply the sum of the posterior probabilities of all trees that contain that clade. The consensus tree calculated by MrBayes does not include the posterior probabilities of the clades; thus the entire set of trees was imported into PAUP* (![]()
![]()
The consensus trees calculated by MrBayes were imported into PAUP* for the purposes of displaying and printing the tree. The tree was rooted by using the SHV sequences as a monophyletic outgroup.
| RESULTS AND DISCUSSION |
|---|
The target gene TEM-1 was mutated by random PCR mutagenesis with the GeneMorph PCR mutagenesis kit (Stratagene), because the spectrum of mutations introduced by the Mutazyme polymerase in that kit is similar to the average mutation spectrum of E. coli (Table 1) and because the frequency of mutations can be controlled. Conditions were chosen to introduce, on average, two mutations per copy into the TEM-coding sequence. That mutation rate ensured that all possible single-point mutations were sampled and that a fraction of all possible double- and triple-point mutations were sampled in each experiment. Mutations were introduced at that frequency because, in nature, mutations usually occur one at a time and very rarely in pairs. A low mutation rate is important because mutations that may be deleterious when introduced one at a time may confer a fitness advantage when introduced simultaneously. Such mutations would probably not go to fixation in nature because it is unlikely that they would arise simultaneously in the same genome. High mutation rates also cause more neutral and deleterious mutations to hitchhike their way to fixation.
Nine independent libraries of mutated TEM alleles were created as described in MATERIALS AND METHODS. The average library size was 1.3 x 106 insert-bearing transformants per experiment.
Extended-spectra TEM alleles typically confer elevated resistance to one or more of the following drugs: cefotaxime, cefuroxime, ceftazadime, or aztreonam. In addition, they confer resistance to ampicillin, pipericillin, and cephalothin.
The selective pressures that have directed the natural evolution of the TEM ß-lactamase have not been high concentrations of a single antibiotic such as ![]()
![]()
We selected for increased resistance by subjecting the population from each mutagenized library to selection for growth in the presence of cefotaxime, cefuroxime, ceftazadime, and aztreonam as described in MATERIALS AND METHODS. Those antibiotics were selected because they have been in clinical use for several years, TEM-1 does not confer resistance to them, and many of TEM-1's descendants do confer resistance to them. Drug concentrations ranged from the minimum concentration that inhibited cells expressing the TEM-1 ß-lactamase up to twice the concentration that the NCCLS (NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS 1999) defines as indicating clinical resistance. The exception was cefotaxime, for which the maximum concentration used was the MIC for strains expressing the TEM-3 ß-lactamase. Selection for new resistance phenotypes was followed by selection for the maintenance of resistance to ampicillin, pipericillin, and cephalothin, in that order. Those antibiotics were selected because TEM-1 confers resistance to them and because natural TEM alleles have been subjected to them through extensive clinical use. The selection strategy is realistic because naturally occurring TEM alleles have evolved in response to different antibiotics (![]()
![]()
None of the populations reached the desired level of resistance in one round of selection and were therefore subjected to a second round of mutagenesis and subjected to the same selection that had been applied during the initial round. After the second round of selection, all populations grew at the maximum concentration of each of the drugs used.
Following the second round of mutagenesis and selection, to determine the extent of phenotypic variation in each population, plasmid was purified from each population and transformed into DH5
E to eliminate any phenotypic variation that resulted from selection on the host. Fifteen transformants from each population were chosen and phenotypes were identified by disk diffusion tests. For every population except line 7, only one phenotype was recovered, indicating that in most populations one allele conferred the greatest fitness advantage and the carrier of that allele eliminated all others in the population. One isolate from each population (two from line 7) was retained for phenotypic characterization and sequencing.
Phenotypic evolution:
Table 2 shows that the order of selection is very important in determining the phenotype that is recovered. In each case resistance to a given drug was greatest when that drug was used first in the selection procedure. Clonal displacement, the rapid domination of the population by the fittest alleles, probably ensures that very few alleles remain after selection in the initial drug used. Clearly selection imposed by low-to-moderate concentrations of antibiotics selects for high levels of resistance. For example, populations 13, selected for growth in 32 µg/ml cefotaxime, include alleles that confer resistance to cefotaxime at MICs of either 256 or 512 µg/ml. In every population, resistance was selected at a much higher concentration than the concentration of the first antibiotic to which they were first exposed. This suggests that the greater the level of resistance, the greater the fitness advantage even at low concentrations of that antibiotic. Alleles that conferred even higher levels of resistance may well have been present immediately after selection in the first drug, but those that may have conferred lower resistance levels in subsequent drugs may well have been lost.
Table 2 also shows that there is indirect selection for resistance to antibiotics that were not used for selection. For example, selection in cefotaxime and cefuroxime caused ceftriaxone resistance to evolve. Selection in ceftazadime and aztreonam caused cefepime resistance to increase greatly.
Sequence evolution:
Table 3 shows the mutations and resulting amino acid substitutions that were recovered during the nine in vitro evolution experiments, while Table 4 shows the amino acid substitutions that are present in the naturally occurring extended-spectrum TEM alleles. The bottom row in Table 4 indicates the number of times that each amino acid substitution has arisen independently. Independent occurrence is based on analysis of the TEM phylogeny (Fig 1). For instance, although the Q39K substitution is present in nine naturally occurring TEM alleles, it arose only once in TEM-2. The E104K substitution, in contrast, has arisen independently seven times. We assume that substitutions that have arisen and been fixed more than once have been fixed by positive selection; i.e., they contribute directly to a fitness advantage conferred by that allele. Substitutions that have arisen only once may be advantageous, neutral, or even slightly deleterious.
|
|
Nine mutations have arisen independently multiple times in nature: L12F, E104K, R164S, R164H, M182T, A237T, G238S, E240K, and T265M. Seven of those, E104K, R164S, R164H, M182T, G238S, E240K, and T265M, were recovered during our in vitro evolution experiments (Table 4). Of those, all except R164S were recovered multiple times in independent experiments. The A237S substitution was also recovered twice. Although that substitution has not been recovered in natural TEM alleles, the A237T substitution has arisen independently at least twice in nature, and we note that serine and threonine differ by a single methyl group. The other mutation we recovered multiple times that has not been found in nature is I173V.
These results demonstrate that in vitro evolution with the Mutazyme polymerase recovers substantially the same mutations that are selected in nature. We take this as evidence that our method of in vitro evolution accurately mimics nature and can validly be used to predict natural evolution not only for antibiotic resistance genes but for other genes of interest.
Although this project was designed primarily to validate in vitro evolution as a good mimic of natural evolution, these results do allow us to begin making predictions about the evolution of antibiotic resistance. For instance, natural TEM alleles that confer clinical resistance to cefepime have not yet been recovered. The highest level of resistance to cefepime that has been reported is a MIC of 8 µg/ml (![]()
![]()
We note that the clones most resistant to cefepime are the least resistant to cefuroxime. We speculate that cefepime resistance conferred by a TEM allele has not yet been observed in nature because of the high use of cefuroxime (http://www.rxlist.com/top200a.htm) and the relatively recent introduction of cefepime.
We have provided strong evidence that in vitro evolution reproduces natural evolution that has already occurred and that, when used properly, in vitro evolution can make strong predictions about how natural evolution will proceed in the future. Evolutionary biologists can now proceed to use in vitro evolution with confidence to predict the evolution of their favorite genes. There is also an immediate and practical application of in vitro evolution to antibiotic resistance: As new antibiotics are developed, in vitro evolution can be used to predict how known resistance genes are likely to evolve in response to use of the new antibiotic. In turn, the in vitro evolved genes that confer resistance to the novel antibiotic can be used as a test bed for the next generation of drug. In vitro evolution can also be used to search for resistance phenotypes that are mutually exclusive and, from this information, devise prescription strategies that inhibit the evolution of resistance.
| ACKNOWLEDGMENTS |
|---|
We are grateful to George Jacoby for generously providing the strain of K. pneumoniae that harbors a naturally occurring TEM-3 plasmid. This study was supported by grant GM-60761 from the National Institutes of Health.
Manuscript received October 17, 2001; Accepted for publication January 7, 2002.
| LITERATURE CITED |
|---|
AMBLER, R. P., A. F. COULSON, J. M. FRERE, J. M. GHUYSEN, and B. JORIS et al., 1991 A standard numbering scheme for the class A beta-lactamases. Biochem. J. 276:269-270.
ARNOLD, F. H. and J. C. MOORE, 1997 Optimizing industrial enzymes by directed evolution. Adv. Biochem. Eng. Biotechnol. 58:1-14[Medline].
BLAZQUEZ, J., M. R. BAQUERO, R. CANTON, I. ALOS, and F. BAQUERO, 1993 Characterization of a new TEM-type beta-lactamase resistant to clavulanate, sulbactam, and tazobactam in a clinical isolate of Escherichia coli. Antimicrob. Agents Chemother. 37:2059-2063
BLAZQUEZ, J., M. I. MOROSINI, M. C. NEGRI, and F. BAQUERO, 2000 Selection of naturally occurring extended-spectrum TEM beta-lactamase variants by fluctuating beta-lactam pressure. Antimicrob. Agents Chemother. 44:2182-2184
BOLIVAR, F., R. L. RODRIGUEZ, P. J. GREENE, M. C. BETLACH, and H. L. HEYNEKER et al., 1977 Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113[Medline].
CHANAL, C., M. C. POUPART, D. SIROT, R. LABIA, and J. SIROT et al., 1992 Nucleotide sequences of CAZ-2, CAZ-6, and CAZ-7 beta-lactamase genes. Antimicrob. Agents Chemother. 36:1817-1820
CHANAL, C., R. BONNET, C. DE CHAMPS, D. SIROT, and R. LABIA et al., 2000 Prevalence of beta-lactamases among 1,072 clinical strains of Proteus mirabilis: a 2-year survey in a French hospital. Antimicrob. Agents Chemother. 44:1930-1935
CHANG, A. C. and S. N. COHEN, 1978 Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156
COCO, W. M., W. E. LEVINSON, M. J. CRIST, H. J. HEKTOR, and A. DARZINS et al., 2001 DNA shuffling method for generating highly recombined genes and evolved enzymes. Nat. Biotechnol. 19:354-359[Medline].
COURVALIN, P. and P. TRIEU-CUOT, 2001 Minimizing potential resistance: the molecular view. Clin. Infect. Dis. 33(Suppl. 3):S138-S146.
CRAMERI, A., E. A. WHITEHORN, E. TATE, and W. P. STEMMER, 1996 Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat. Biotechnol. 14:315-319[Medline].
HALL, B. G., 1999 The spectra of spontaneous growth-dependent and adaptive mutations in ebgR.. J. Bacteriol. 181:1149-1155
HALL, B. G., 2001 Phylogenetic Trees Made Easy: A How-To Manual for Molecular Biologists. Sinauer Associates, Sunderland, MA.
HALLIDAY, J. A. and B. W. GLICKMAN, 1991 Mechanisms of spontaneous mutation in DNA repair-proficient Escherichia coli.. Mutat. Res. 250:55-71[Medline].
HUELSENBECK, J. P., 2000 MrBayes: Bayesian Inferences of Phylogeny. Rochester, NY.
KITZIS, M. D., D. BILLOT-KLEIN, F. W. GOLDSTEIN, R. WILLIAMSON, and G. TRAN VAN NHIEU et al., 1988 Dissemination of the novel plasmid-mediated beta-lactamase CTX-1, which confers resistance to broad-spectrum cephalosporins, and its inhibition by beta-lactamase inhibitors. Antimicrob. Agents Chemother. 32:9-14
LASSNER, M. and J. BEDBROOK, 2001 Directed molecular evolution in plant improvement. Curr. Opin. Plant Biol. 4:152-156[Medline].
LIVERMORE, D. M., 1996 Are all beta-lactams created equal? Scand. J. Infect. Dis. 101(Suppl.):33-43.
LONG-MCGIE, J., A. D. LIU, and V. SCHELLENBERGER, 2000 Rapid in vivo evolution of a beta-lactamase using phagemids. Biotechnol. Bioeng. 68:121-125[Medline].
MATAGNE, A., J. LAMOTTE-BRASSEUR, and J. M. FRERE, 1998 Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem. J. 330:581-598. [erratum: Biochem. J. 331 (Pt. 3): 975]..
MAU, B. and M. NEWTON, 1997 Phylogenetic inference for binary data on dendrograms using Markov chain Monte Carlo. J. Comp. Graph. Stat. 6:122-131.
MAU, B., M. NEWTON, and B. LARGET, 1999 Bayesian phylogenetic inference via Markov chain Monte Carlo methods. Biometrics 55:1-12[Medline].
MEDEIROS, A. A., 1997 Evolution and dissemination of beta-lactamases accelerated by generations of beta-lactam antibiotics. Clin. Infect. Dis. 24:S19-45.
MINSHULL, J. and W. P. STEMMER, 1999 Protein evolution by molecular breeding. Curr. Opin. Chem. Biol. 3:284-290[Medline].
MOORE, J. C. and F. H. ARNOLD, 1996 Directed evolution of a para-nitrobenzyl esterase for aqueous-organic solvents. Nat. Biotechnol. 14:458-467[Medline].
MORTLOCK, R. P. (Editor), 1984 Microorganisms as Model Systems for Studying Evolution. Plenum Press, New York/London.
NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS, 1999 Performance standards for antimicrobial susceptibility testing: ninth informational supplement. NCCLS Document M100-S9. National Committee for Clinical Laboratory Standards, Wayne, PA.
ORENCIA, M. C., J. S. YOON, J. E. NESS, W. P. STEMMER, and R. C. STEVENS, 2001 Predicting the emergence of antibiotic resistance by directed evolution and structural analysis. Nat. Struct. Biol. 8:238-242[Medline].
PERILLI, M., B. SEGATORE, M. R. DE MASSIS, M. L. RICCIO, and C. BIANCHI et al., 2000 TEM-72, a new extended-spectrum beta-lactamase detected in Proteus mirabilis and Morganella morganii in Italy. Antimicrob. Agents Chemother. 44:2537-2539
RANNALA, B. and Z. H. YANG, 1996 Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. J. Mol. Evol. 43:304-311[Medline].
REBUCK, J. A., K. M. OLSEN, P. D. FEY, K. L. BERGMAN, and M. E. RUPP, 2000 In vitro activities of parenteral beta-lactam antimicrobials against TEM-10-, TEM-26- and SHV-5-derived extended-spectrum beta-lactamases expressed in an isogenic Escherichia coli host. J. Antimicrob. Chemother. 46:461-464
SCHMIDT-DANNERT, C. and F. H. ARNOLD, 1999 Directed evolution of industrial enzymes. Trends Biotechnol. 17:135-136[Medline].
SHAFIKHANI, S., R. A. SIEGEL, E. FERRARI, and V. SCHELLENBERGER, 1997 Generation of large libraries of random mutants in Bacillus subtilis by PCR-based plasmid multimerization. Biotechniques 23:304-310[Medline].
STEMMER, W. P. C., 1994 Rapid evolution of a protein in vitro by DNA shuffling. Nature 370:389-390[Medline].
SWOFFORD, D. L., 2000 PAUP*Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates, Sunderland, MA.
TAVARÉ, L., 1986 Some probabilistic and statistical problems on the analysis of DNA sequences. Lect. Math. Life Sci. 17:57-86.
THOMPSON, J. D., T. J. GIBSON, F. PLEWNIAK, F. JEANMOUGIN, and D. G. HIGGINS, 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882
VAKULENKO, S. B., B. GERYK, L. P. KOTRA, S. MOBASHERY, and S. A. LERNER, 1998 Selection and characterization of beta-lactam-beta-lactamase inactivator-resistant mutants following PCR mutagenesis of the TEM-1 beta-lactamase gene. Antimicrob. Agents Chemother. 42:1542-1548
YAN, J. J., S. M. WU, S. H. TSAI, J. J. WU, and I. J. SU, 2000 Prevalence of SHV-12 among clinical isolates of Klebsiella pneumoniae producing extended-spectrum beta-lactamases and identification of a novel AmpC enzyme (CMY-8) in Southern Taiwan. Antimicrob. Agents Chemother. 44:1438-1442
ZACCOLO, M. and E. GHERARDI, 1999 The effect of high-frequency random mutagenesis on in vitro protein evolution: a study on TEM-1 beta-lactamase. J. Mol. Biol. 285:775-783[Medline].
This article has been cited by other articles:
![]() |
J. E. Mroczkowska and M. Barlow Recombination and Selection Can Remove blaTEM Alleles from Bacterial Populations Antimicrob. Agents Chemother., September 1, 2008; 52(9): 3408 - 3410. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Novais, R. Canton, T. M. Coque, A. Moya, F. Baquero, and J. C. Galan Mutational Events in Cefotaximase Extended-Spectrum {beta}-Lactamases of the CTX-M-1 Cluster Involved in Ceftazidime Resistance Antimicrob. Agents Chemother., July 1, 2008; 52(7): 2377 - 2382. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Cochran, Y.-S. Kim, S. M. Lippow, B. Rao, and K.D. Wittrup Improved mutants from directed evolution are biased to orthologous substitutions Protein Eng. Des. Sel., June 1, 2006; 19(6): 245 - 253. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Weinreich, N. F. Delaney, M. A. DePristo, and D. L. Hartl Darwinian evolution can follow only very few mutational paths to fitter proteins. Science, April 7, 2006; 312(5770): 111 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fujii, M. Kitaoka, and K. Hayashi RAISE: a simple and novel method of generating random insertion and deletion mutations Nucleic Acids Res., February 21, 2006; 34(4): e30 - e30. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Delmas, F. Robin, F. Bittar, C. Chanal, and R. Bonnet Unexpected Enzyme TEM-126: Role of Mutation Asp179Glu Antimicrob. Agents Chemother., October 1, 2005; 49(10): 4280 - 4287. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Welsh, M. Barlow, F. C. Tenover, J. W. Biddle, J. K. Rasheed, L. A. Clark, and J. E. McGowan Jr. Experimental Prediction of the Evolution of Ceftazidime Resistance in the CTX-M-2 Extended-Spectrum Beta-Lactamase Antimicrob. Agents Chemother., March 1, 2005; 49(3): 1242 - 1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Haeggman, S. Lofdahl, A. Paauw, J. Verhoef, and S. Brisse Diversity and Evolution of the Class A Chromosomal Beta-Lactamase Gene in Klebsiella pneumoniae Antimicrob. Agents Chemother., July 1, 2004; 48(7): 2400 - 2408. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Hall In Vitro Evolution Predicts that the IMP-1 Metallo-{beta}-Lactamase Does Not Have the Potential To Evolve Increased Activity against Imipenem Antimicrob. Agents Chemother., March 1, 2004; 48(3): 1032 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Salipante, M. Barlow, and B. G. Hall GeneHunter, a Transposon Tool for Identification and Isolation of Cryptic Antibiotic Resistance Genes Antimicrob. Agents Chemother., December 1, 2003; 47(12): 3840 - 3845. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Galan, M.-I. Morosini, M.-R. Baquero, M. Reig, and F. Baquero Haemophilus influenzae blaROB-1 Mutations in Hypermutagenic {Delta}ampC Escherichia coli Conferring Resistance to Cefotaxime and {beta}-Lactamase Inhibitors and Increased Susceptibility to Cefaclor Antimicrob. Agents Chemother., August 1, 2003; 47(8): 2551 - 2557. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Barlow and B. G. Hall Experimental Prediction of the Evolution of Cefepime Resistance From the CMY-2 AmpC {beta}-Lactamase Genetics, May 1, 2003; 164(1): 23 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Barlow and B. G. Hall Experimental Prediction of the Natural Evolution of Antibiotic Resistance Genetics, April 1, 2003; 163(4): 1237 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Salipante and B. G. Hall Determining the Limits of the Evolutionary Potential of an Antibiotic Resistance Gene Mol. Biol. Evol., April 1, 2003; 20(4): 653 - 659. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. G. Hall Predicting Evolution by In Vitro Evolution Requires Determining Evolutionary Pathways Antimicrob. Agents Chemother., September 1, 2002; 46(9): 3035 - 3038. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- A corrigendum has been published
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Barlow, M.
- Articles by Hall, B. G.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Barlow, M.
- Articles by Hall, B. G.






