- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Timakov, B.
- Articles by Zhang, P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Timakov, B.
- Articles by Zhang, P.
Timing and Targeting of P-Element Local Transposition in the Male Germline Cells of Drosophila melanogaster
Benjamin Timakova, Xiaoru Liua, Ismail Turguta, and Ping Zhangaa Department of Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269-2131
Corresponding author: Ping Zhang, U-2131, University of Connecticut, 354 Mansfield Rd., Storrs, CT 06269-2131., ping.zhang{at}uconn.edu (E-mail)
Communicating editor: S. HENIKOFF
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The P element in Drosophila melanogaster preferentially transposes into nearby sites. The local insertions display a preferential orientation toward the starting element. We investigated the mechanism of the P-element local transposition by isolating and characterizing local insertions in the male germline. We designed a genetic screen employing a marker gene that is carried in the P element and is dose sensitive. This dose effect allows isolation of flies containing newly transposed P elements in the presence of the starting element. A rapid molecular screen with PCR was used to identify 45 local insertions located within an 
40-kb genomic region on both sides of the starting element. Our system permits the isolation of the cluster progeny derived from a single insertion event, but none was isolated. The data suggest that local transposition occurs in the meiotic cell cycle. Nearly all of the local insertions were located within the promoter regions of the genes that were active in the male germline cells, suggesting that local insertions target predominantly active promoters. Our analysis shows that local transposition of the P element is highly regulated, displaying a cell-type specificity and a target specificity.
THE P-transposable element in Drosophila melanogaster is one of the best-characterized eukaryotic transposons (
400 hotspot loci (
New insertions of the P element were frequently found near the existing P elements, exhibiting a structure with two closely located P elements (
Genetically engineered P elements have been extensively used in single P-element insertional mutagenesis to study the Drosophila genes (
The P element often transposes premeiotically in the developing germline, giving rise to a cluster of progeny derived from a single insertion event (
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Drosophila strains:
Flies were grown on standard corn meal/agar media at 22°. A stock containing a P-element insertion, EP(3)3583, was obtained from The Berkeley Drosophila Genome Project at the University of California, Berkeley.
PCR to amplify Drosophila genomic DNA:
Drosophila genomic DNA was isolated as described in
- Pp31: 5'CGACGGGACCACCTTATGTTATTTCATCATG3' (the 31-bp inverted terminal repeat and with an outward orientation)
- PE5': 5'AATTCGTCCGCACACAAC3' (112 bp internal to the 5' end of the P element and with an outward orientation)
- PE3': 5'TCGCACTTATTGCAAGCA3' (72 bp internal to 3' end of the P element and with an outward orientation)
The following primers were derived from genomic sequences, which were based on a genomic scaffold sequence in 67B (GenBank accession no.
AE003552;
- Pg-L: 5'GACTTGGCCTGTTCCTTG3'
- Pg-R: 5'GAGCCAGAAGATGCGAGA3'
- Pg-A1: 5'AGCGGATAATGGCGTGTA3'
- Pg-A2: 5'GATGTACGGCAGTATCGG3'
- Pg-A3: 5'TAGCTGCACATTTGCTTG3'
- Pg-A4: 5'GCGCGTACGACAACAACT3'
- Pg-A5: 5'GTGCCTGGAGCTATAGCC3'
- Pg-A6: 5'GCTCCTTGGACTTGTCCT3'
- Pg-B1: 5'TTGTCTCTCCGCTCTCCT3'
- Pg-B2: 5'ACATTCGCATAGTGCTGG3'
- Pg-C1: 5'ATGTTCGCACTTCTTGCA3'
Sequencing:
Two rounds of PCR reactions were used to clone the genomic sequences flanking an EP element. The first PCR was carried out with a genomic primer near the inserted EP element and the EP3' primer or the EP5' primer, which were specific to the 5' end or the 3' end of the element. The PCR product was loaded on a gel of 0.7% low-melting-temperature agarose (FMC Bioproducts, Rockland, ME) in TAE and the band containing the amplified DNA was cut out. The gel-purified DNA was used as a template for a second PCR reaction with the same primers used in the first PCR reaction. The DNA product was purified using a QIAquick PCR purification kit (QIAGEN, Chatsworth, CA) and was used in a sequencing reaction (PE Applied Biosystem) with either the PE5' or PE3' primer.
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The design of our genetic screen to isolate local insertions of the P element was based on two assumptions. One was that the starting element used to produce local insertions was mostly retained in local transposition. A previous study isolated local insertions near a starting P element on a minichromosome (Dp1187) by using a genetic screen (
The other assumption was that the expression of a marker gene in the P element would allow us to identify flies carrying two closely located P elements, i.e., a retained starting element and a new local insertion. The mini-white gene is derived from the X-linked white gene and is carried in many P-element transformation vectors (
The starting element:
The starting P element for this local transposition study was an EP element located in 67B on chromosome 3 (800 bp (the sum of 72 bp from the P element and 716 bp of the genomic DNA; Fig 1B, lane 3). Similarly, the primer pair of Pg-R and PE5' (specific to the 5' end of the P element) produced a predicted product of 300 bp (the sum of 112 bp of the P element and 210 bp of the genomic DNA; Fig 1B, lane 4). These results confirmed the physical location of the EP(3)3583 element.
|
Producing local insertions in the 67B region on chromosome 3:
The EP element contains mini-white as a marker (
2-3 (99B) (2-3, Sb males (F0, Fig 2A). To isolate local insertions, 563 F0 males were crossed singly to w/w; +/+ females in vials. A total of 1554 Sb+ male progeny (F1) expressing the mini-white gene at elevated levels (Fig 2B) were collected and crossed singly to w/w; +/+ females. Up to 10 F1 males were taken from a given F0 parent and crossed singly to the females.
|
The change of eye color from light orange in the F0 males to dark orange or light red in the F1 males might be caused by the mini-white dose effect. Some of these F1 males might carry two copies of the EP elements: a locally inserted element and the starting element. Among 1554 crosses between the F1 males and the w/w; +/+ females, a total of 1444 crosses produced progeny. The remaining produced no progeny, because the involved F1 males were sterile. Among the fertile crosses, 287 produced F2 progeny displaying obvious different eye colors, indicating that they carried at least two unlinked EP elements. These strains involving the nonlocal transposition events were not characterized further. The rest of the 1157 stocks were subject to the molecular analysis described below.
Detecting local insertions with PCR:
We used a simple screen based on PCR technology to detect local insertions in the 1157 stocks carrying potential local insertions. Five PCR primers were designed according to the genomic sequences around the starting EP(3)3583 element (Pg-A1 through A5, Fig 3). The Pp31 primer was derived from the 31-bp inverted terminal repeats of the P element. We scanned the genomic region around the starting element for local insertions by using two separate PCR reactions. First, to examine local insertions to the left of the starting element, we used a set of three primers (Pp31, Pg-A1, and Pg-A2) in a reaction. Second, to examine local insertions to the right of the starting element, we used a set of four primers (Pp31, Pg-A3, Pg-A4, and Pg-A5) in another reaction. The genomic primers were 3 kb apart in both reactions. These designs allowed local insertions to be identified by a combination of Pp31 and a genomic primer (Pg). In addition, local insertions immediately adjacent to the starting element would be detected by the Pp31 primer, which amplifies a genomic sequence between two P elements (i.e., the retained starting element and a local insertion).
|
To further improve the efficiency of the PCR screen, DNA samples were extracted from pooled flies from different stocks. We combined flies with elevated eye pigmentation from 5 stocks and isolated their genomic DNA (five flies per stock, with a total of 232 DNA pools for 1157 stocks).
From the screen, PCR products were obtained from 29 pools of the genomic DNA. DNA samples were then extracted from individual stocks in which these DNA pools were isolated. The presence of a local insertion in a stock was determined by PCR with the same primers used for the DNA pools. We isolated a total of 32 stocks carrying independent local insertions. This was because 3 of the 29 DNA pools actually contained two independent local insertions per pool, which were revealed when DNA from the stocks was individually examined by PCR. These data showed that the frequency of the local insertions within this genomic region (21 kb, from -9000 to +12,000, Fig 3) was 2.7% (32/1157). In addition, all 32 stocks containing the local insertions displayed strong eye pigmentation, as shown in Fig 2B, (a) and (b).
Localizing the insertions within several genomic subregions:
The genomic sequences around the starting element were divided into seven genomic regions, regions A through G, by the sites of the genomic primers used in the PCR screen (Pg-A1 through A5, Fig 3). To map the 32 local insertions identified in the screen, two series of experiments were carried out. First, the local insertions within regions C and D were mapped by using the Pp31 primer, which amplifies the templates between a local insertion and the starting element. This analysis identified 10 insertions. These insertions were further mapped to +200 (3 insertions), +400 (2 insertions), +600 (2 insertions), +700 (1 insertion), and +2500 (2 insertions) by using several additional genomic primers in regions C and D (data not shown).
Second, 22 insertions were mapped to regions F (17 insertions) and G (5 insertions) by using pairs of primers containing Pp31 and a genomic primer (Pg-A1–Pg-A5). Among 17 insertions mapped to region F, 15 were located within a small segment of 100 bp at +6600 (Fig 3). Mapping data for five examples of these insertions are shown in Fig 4. The PCR products from these insertions with Pp31 and Pg-4 (+6316) were 300 bp in size (Fig 4), indicating that the insertions were located at +6600. The Pg-A6 primer is located at +7302 (Fig 3) and is oriented in a direction opposite to that of the Pg-A4 primer (Fig 3). The PCR products from the insertions at +6600 with Pp31 and Pg-A6 were 750 bp (Fig 4), which agrees with the sizes of the predicted products from these insertions. In addition to the insertions at +6600, two additional insertions in region F were mapped to the sites at +6400 (Fig 3). In region G, 5 insertions were mapped at +10,100 with Pp31 and Pg-5 (+9420).
|
To determine the precise physical locations of the local insertions, we selected 12 local insertions from region D (5 insertions), region F (4 insertions), and region G (3 insertions). The genomic sites of these insertions were determined by cloning and sequencing (see MATERIALS AND METHODS for details). The results are shown in Table 1. For example, the genomic sites for 3 insertions in region F (nos. 7, 8, and 9) were very close, at positions +6561, +6577, and +6582, respectively. Another insertion (no. 6) was 200 bp away at position +6361. These analyses confirmed the PCR mapping data obtained by estimating the sizes of the PCR products (Fig 3 and Fig 4).
|
The genomic sequences around the local insertions were further examined for an 8-bp target site duplication, a characteristic of P-element insertional activity (
The sites of the insertions showed interesting features about the local transposition. None of these sites was located within the genomic sequences inside the transcription units of the local genes (Fig 3 and Table 1). Instead, they were distributed within several base pairs to several hundred base pairs upstream of the transcription starting sites of four genes, including Hsp27, Hsp23, Hsp26, and Hsp22 (Table 1). These data suggested that the local transposition of EP(3)3583 targeted the promoter regions that are near the starting element. In addition, the data showed an intriguing correlation between the local insertions and the transcriptional activity of the targeted promoters. Three of the targeted genes, Hsp27, Hsp23, and Hsp26, were expressed in the male germline cells where the local transposition took place, as indicated by the expressed sequence tags (ESTs) in a testis-cDNA library (Table 2). Another targeted gene, Hsp22, was also expressed in the male germline, as shown in an immunostaining study (3 kb apart (Fig 3). The observation that the local insertions produced in the male germline (Fig 1) were located within the promoter regions that were active in the same tissue suggested that the local transposition preferentially targeted the active promoters.
|
Local insertions into transcriptionally active genes:
To test the hypothesis that active promoters were the preferential targets of local insertions, we further divided the local insertions into active and inactive promoters. The expression of the Hsp67Ba gene with the transcription starting site at +4548 was not detected in the male germline (Table 2). Thus, this gene was not predicted by the hypothesis to be a frequent target of the local transposition. The initial PCR screen did not find any insertions into Hsp67Ba (Fig 3). Although this result supported our hypothesis, it could also be explained if the primer set of Pg-A3 and Pp31 was less efficient in detecting the insertions within region E where Hsp67Ba resides. To confirm the observation that local insertions within the Hsp67Ba gene were not present in our screen, the following PCR experiment was carried out. By employing Pg-A6 and Pp31 in PCR, we screened the genomic DNA pools for local insertions into the genomic region containing Hsp26 and Hsp67Ba. All of the 17 insertions into Hsp26 (Fig 3), which had been isolated from the initial screen, were readily identified by the Pg-A6 and Pp31 pair. For example, 5 insertions isolated from the initial screen produced 300-bp PCR products with Pp31 and Pg-4 (Fig 4). These insertions were also identified in the screen using Pp31 and Pg-6, which produced 750-bp products (Fig 4). However, this screen found no new insertions into Hsp67Ba. These results provided strong evidence that the local transposition preferentially inserted the P element into the active promoters.
Our examination of local insertions was extended into three additional genes expressed in the male germline. These included the CG4080 gene, the eIF-4E gene, and the CG4452 gene. The CG4080 gene was expressed in the male germline, but no insertions were isolated within it in the initial screen (Fig 3 and Table 2). This failure of recovering local insertions in CG4080 could be the result of our initial experimental design, which did not cover the CG4080 promoter located outside the initial PCR range (Fig 3). To determine if CG4080 was a target of local transposition, PCR with three primers, Pg-B1, Pg-B2, and Pp31, was used to screen the genomic DNA pools for local insertions in this gene (Fig 5). Pg-B2 was a primer located at -13,347, orientating toward the CG4080 promoter (its transcription starting site at -14,085). The experiment isolated six local insertions in the CG4080's promoter region (Fig 5). Using PCR with the Pg-B2 and Pp31 pair mapped the genomic locations of these insertions to -14,000. The precise locations for two of these insertions were determined by cloning and sequencing as described in MATERIALS AND METHODS. One was located at -14,055, while the other was only 2 bp away at -14,057 (Table 1, region I). These results revealed that CG4080, a transcriptionally active gene in the male germline, was a frequent target of the local insertions.
|
The PCR screen with Pg-B1, Pg-B2, and Pp31 also recovered two insertions at -17,000, which was determined by using the Pg-B1 (at -16,706) and Pp31 pair (Fig 5). The insertion site for one of these insertions was cloned and sequenced. This site, at -16,993 (Table 1, region H), was 283 bp upstream of the transcription starting site of eIF-4E (at -17,275, Table 1), which was expressed in the male germline (Table 2).
Another PCR screen with the Pg-C1 (+15,852) and Pp31 primer pair recovered five insertions at +17,100 (Fig 5). By cloning and sequencing, two of these insertion sites were located at the same position, +17,075 (Table 1, region J). These insertions were near the transcription starting sites of the CG4452 and Klp67A genes at +16,574 and +17,051, respectively (Table 1). The CG4452 gene was expressed in the male germline (Table 2).
The absence of the cluster events in the local transposition:
In the spermatogenesis of D. melanogaster, a germline stem cell undergoes four rounds of mitotic divisions, producing 16 primary spermatocytes in a cyst (
Retaining of the original element:
As described above, one of the assumptions in our strategy to isolate the local insertions was that the starting element was retained following local transposition. The fate of the starting element on the chromosomes carrying the local insertions was determined by using PCR with two primer sets. One pair of the primers contained Pp31 and Pg-L, whereas the other pair contained Pp31 and Pg-R (Fig 1 and Fig 3). An example of these examinations is shown in Fig 6. Out of eight chromosomes carrying the local insertions, seven retained the starting element, indicated by the production of an 750-bp product with the Pp31 and Pg-L primer pair and an 250-bp product with the Pp31 and Pg-R primer pair. The exceptional chromosome produced a 250-bp product with Pp31 and Pg-R, but not with Pp31 and Pg-L (8a and 8b, Fig 6). Thus, this chromosome retained the 5' end of the starting element, but had a rearrangement around the 3' end. These analyses showed that nearly all of the chromosomes carrying the local insertions (43/45) retained the starting element. Two exceptional chromosomes retained the 5' end of the starting element, although they carried the DNA rearrangement around the 3' end as described above.
|
Preferential orientation of the local insertions:
The orientation of the local insertions relative to the starting element was determined by using PCR with a genomic primer around a local insertion and either the PE5' or PE3' primer. A significant preference for the insertion orientation was observed. Among a total of 40 local insertions randomly chosen for this analysis, 28 were in the opposite orientation (head to head or tail to tail), while 12 were in tandem orientation (head to tail). However, the preference for the insertion orientation was present only among the insertions located to the 5' side of the starting element. The vast majority of these insertions displayed a head-to-head orientation (24/32 or 75%). In contrast, 8 insertions 3' to the starting element appeared to be randomly distributed in either orientation (50% vs. 50%).
Rearrangement associated with the local transposition:
The screen with the primer set of Pp31 and Pg-6 identified not only the local insertions within the Hsp26 gene (Fig 4), but also a group of five chromosomes with irregular properties. The PCR products of these unusual chromosomes with Pp31 and Pg-6 were the same size as the regular insertions in Hsp26, which was 750 bp (Fig 4). However, no PCR products were seen in the PCR experiments with Pp31 and Pg-4. The results suggested that these chromosomes carried local insertions within Hsp26, but the insertions were accompanied by genomic rearrangements. Furthermore, the PCR experiments with Pp31 and Pg-R produced no products from these chromosomes. These analyses suggested that the unusual insertions in Hsp26 were associated with a deletion between the insertions in Hsp26 and the starting element.
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Efficient recovery of local insertions with simple genetic and molecular techniques:
The genetic screen used to isolate the local insertions in this report was facilitated by the dose effect of the mini-white marker gene and the retaining of the starting element in local transposition. The molecular strategy used to detect the local insertions was based on the efficient polymerase chain reaction that was rapid and sensitive in the screens. The frequency of recovering the local insertions is 4% (45/1147) within a genomic interval of 40 kb (-20,000–+20,000). In contrast, a previous nonselective screen showed, by using Southern hybridization, that the local insertions into a minichromosome account for 20–40% of all transpositions throughout the genome (
First, the previous screen searched for local insertions in a genomic interval that is seven times larger than the current screen (300 kb vs. 40 kb). Second, it is possible that the elevated expression of the mini-white marker gene in some of the F1 males was not due to a new insertion. We noted that the flies carrying the local insertions all displayed highly elevated eye pigmentation as illustrated in Fig 2B, (a) and (b). Roughly one-third of the examined 1554 F1 males were flies with slightly increased eye pigmentation [ Fig 2B (c)]. However, none of them was found to contain local insertions. Some of these F1 males were associated with genomic DNA rearrangements around the starting element, which were revealed by PCR experiments (data not shown). The increased mini-white expression in some of the F1 males could also be caused by DNA rearrangements internal to the starting element that were induced by the transposase activity. These DNA rearrangements, rather than new insertions, may give rise to the increased mini-white expression in a sizable fraction of the F1 males. Finally, the PCR method employed in our screen to identify the local insertions would not detect the local insertions within the starting element, since the Pp31 primer is located in the inverted terminal repeats of the P element. The local insertions transposed onto the starting element account for 44% of all the local insertions (15/34) in a study that detected the insertions by using Southern hybridization (12% of the total local insertions (4/34) was located <200 bp outside the starting element. This current screen with PCR did not isolate these insertions (0/45). It remains possible that the PCR screen failed to detect the small products amplified between two P elements that were separated by <200 bp genomic DNA.
Preferential targeting of local transposition and active promoters:
The local transposition shares similar features with the interchromosomal transposition. The preference of P-element insertions for the 5' end of genes was reported previously (
The results from our initial screen displayed a strong correlation between the local insertion sites and the active promoters in the male germline where the local transposition took place. These promoters, including Hsp27, Hsp23, Hsp26, and Hsp22, were frequent targets of the local insertions. Further screens into regions H, I, and J revealed that the 5' ends of three more active genes, CG4080, eIF-4e, and CG4452, were also targets of local transposition. Unlike the insertions in the Hsp genes, the insertions into these genes were located inside the transcription units as described in
Three insertions into region J were located 501 bp upstream of the transcription starting sites of the CG4452 gene, which is an active gene in the male germline (Table 2). However, since the genomic sequence between the transcription starting sites of CG4452 and the Klp67A gene is <500 bp, these insertions were actually located 24 bp inside the 5' end of the Klp67A transcription unit. Although the testis-specific EST sequences for Klp67A were not found, this gene was also active in the male germline as shown in Northern analysis (
Mechanism of the P-element local transposition:
P elements are thought to transpose by a nonreplicative cut-and-paste mechanism (
In conventional experiments, the P element on one chromosome is activated and transposes onto a different chromosome. The interchromosomal transposition often takes place premeiotically in the developing germline, producing a cluster of progeny derived from a single insertion event. In P-element-mediated transformation, the clusters were found in >50% of the siblings when two or more siblings of a given G0 fly (developed from an injected embryo) were tested (28% chance that it is part of a cluster of two or more siblings. The data demonstrated that the P element frequently transposes prior to the completion of DNA replication at the 16-cell stage of primary spermatocytes, resulting in the interchromosomal clusters.
The absence of the cluster events in our experiment (0/45) suggests that local transposition of P elements occurs either mostly or entirely during the meiotic cell cycle, resulting in two heterozygous sister chromatids. We propose that the difference between an interchromosomal transposition and a local transposition results from differential timing when the transposition takes place. Premeiotic transposition could lead to dissociation of an excised element from the donor site and to insertion into a new site. This often produces the observed cluster of interchromosomal transposition. In contrast, transposition during the meiotic cell cycle may predominantly lead to an aborted process in which an excised element fails to dissociate from the donor site and inserts locally. In meiosis, there might be a reduction of factors required for an excised element to dissociate from the donor site. The occurrence of local transposition in the meiotic cell cycle has been previously demonstrated by recovering both sister chromatids of a chromosome after P-element activation in a meiotic mutant background (
The local insertions 5' to the starting element showed a preferential direction (P < 0.01) in the head-to-head orientation compared with the head-to-tail orientation (75% vs. 25%). This orientational preference suggests that the excised P element is physically restricted to the donor site in local transposition. Similar preference was also seen in a previous study that recovered the local insertions in the absence of selection (
Practice of local transposition in mutagenesis:
Although local transposition occurs frequently, its success in mutagenesis has been limited. This was mainly because of technical difficulties in detecting local insertions in the presence of the starting element (
The utility of this method to isolate local insertions can now be applied to most genes in the Drosophila genome. First, a collection of 2266 unselected EP insertions has been made available recently (10–20 kb), local insertions were seen as far as 100 kb away from the starting elements (
An obstacle to the use of local transposition is the target selectivity of the local insertions. As shown in this report, P elements inserted predominantly into the promoter regions that were transcriptionally active in the male germline. Local transposition in females may provide an alternative approach to mutagenize Drosophila genes. The local insertions produced in the female germline displayed a distribution pattern different from that of the male germline (
The transpositional activity of the P element is accompanied by deficiencies around the starting element (
| ACKNOWLEDGMENTS |
|---|
We thank the Berkeley Drosophila Genome Project at the University of California for the EP(3)3583 stock and the Biotechnology Center at the University of Connecticut for primer synthesis and sequencing. Our special thanks go to Allan Spradling for sharing with us the unpublished data of the interchromosomal clusters. This work was supported in part by the U.S. National Science Foundation Grant MCB-0077817 and a grant from the University of Connecticut Research Advisory Council.
Manuscript received September 14, 2001; Accepted for publication December 10, 2001.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000 The Genome sequence of Drosophila melanogaster.. Science 287:2185-2195
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEALL, E. L. and D. C. RIO, 1997 Drosophila P-element transposase is a novel site-specific endonuclease. Genes Dev. 11:2137-2151
COOLEY, L., R. KELLEY, and A. SPRADLING, 1988 Insertional mutagenesis of the Drosophila genome with single P elements. Science 239:1121-1128
COOLEY, L., D. THOMPSON, and A. C. SPRADLING, 1990 Constructing deletion with defined endpoints in Drosophila. Proc. Natl. Acad. Sci. USA 87:3170-3173
DANIELS, S. B. and A. CHOVNICK, 1993 P element transposition in Drosophila melanogaster: an analysis of sister-chromatid pairs and the formation of intragenic secondary insertions during meiosis. Genetics 133:623-636[Abstract].
DELATTRE, M., D. ANXOLABEHERE, and D. COEN, 1995 Prevalence of localized rearrangements vs. transpositions among events induced by Drosophila P element transposase on a P transgene. Genetics 141:1407-1424[Abstract].
EGGLESTON, W. B., 1990 P element transposition and excision in Drosophila: interactions between elements. Ph.D. Thesis, University of Wisconsin, Madison.
ENGELS, W. R., 1989 P element in Drosophila melanogaster, pp. 437–484 in Mobile DNA, edited by D. BERG and M. HOWE. American Society for Microbiology, Washington, DC.
ENGELS, W. R., D. M. JOHNSON-SCHLITZ, W. B. EGGLESTON, and J. SVED, 1990 High-frequency P element loss in Drosophila is homolog dependent. Cell 62:515-525[Medline].
FLYBASE,, 1999 The FlyBase database of the Drosophila genome projects and community literature. Nucleic Acids Res. 27, available from http://flybase.bio.indiana.edu/.
FULLER, M., 1993 Spermatogenesis, pp. 71–147 in The Development of Drosophila melanogaster, edited by M. BATE and A. MARTINEZ. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
GLOOR, G. B., N. A. NASSIF, D. M. JOHNSON-SCHLITZ, C. R. PRESTON, and W. R. ENGELS, 1991 Targeted gene replacement in Drosophila via P-element-induced gap repair. Science 253:1110-1117
HAWLEY, R. S., R. A. STEUBER, C. H. MARCUS, R. SOHN, and D. M. BARONAS et al., 1988 Molecular analysis of an unstable P element insertion at the singed locus of Drosophila melanogaster: evidence for intracistronic transposition of a P element. Genetics 119:85-94
KAUFMAN, P. D., R. F. DOLL, and D. C. RIO, 1989 Drosophila P-element transposase recognizes internal P-element DNA sequences. Cell 59:359-371[Medline].
LEVIS, R., T. HAZELRIGG, and G. M. RUBIN, 1985 Separable cis-acting control elements for expression of the white gene of Drosophila. EMBO J. 4:3489-3499[Medline].
LIAO, G., E. J. REHM, and G. M. RUBIN, 2000 Insertion site preferences of the P transposable element in Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 97:3347-3351
LINDSLEY, D., and K. T. TOKUYASU, 1980 Spermatogenesis, pp. 225–294 in Genetics and Biology in Drosophila, Ed. 2, edited by M. ASHBURNER and T. WRIGHT. Academic Press, New York.
MICHAUD, S., R. MARIN, J. T. WESTWOOD, and R. M. TANGUAY, 1997 Cell-specific expression and heat-shock induction of Hsps during spermatogenesis in Drosophila melanogaster.. J. Cell Sci. 110:1989-1997[Abstract].
MULLINS, M. C., D. C. RIO, and G. M. RUBIN, 1989 Cis-acting DNA sequence requirements for P-element transposition. Genes Dev. 3:729-738
O'HARE, K. and G. M. RUBIN, 1983 Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35[Medline].
PIRROTTA, V., 1988 Vectors for P-mediated transformation in Drosophila, pp. 437–445 in Vectors: A Survey of Molecular Cloning Vectors and Their Uses, edited by R. L. RODRIGUEZ and D. T. DENHARDT. Butterworths, Boston.
PIRROTTA, V., H. STELLER, and M. P. BOZZETTI, 1985 Multiple upstream regulatory elements control the expression of the Drosophila white gene. EMBO J. 4:3501-3508[Medline].
POLARD, P., M. F. PRERE, O. FAYET, and M. CHANDLER, 1992 Transposase-induced excision and circularization of the bacterial insertion sequence IS911.. EMBO J. 11:5079-5090[Medline].
PRESTON, C. R., J. A. SVED, and W. R. ENGELS, 1996 Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144:1623-1638[Abstract].
RIO, D. C., 1990 Molecular mechanisms regulating Drosophila P-element transposition. Annu. Rev. Genet. 24:543-578[Medline].
ROBERTSON, H. M., C. R. PRESTON, R. W. PHILLIS, D. JOHNSON-SCHLITZ, and W. K. BENZ et al., 1988 A stable genomic source of P element transposase in Drosophila. Genetics 118:461-470
ROIHA, H., G. M. RUBIN, and K. O'HARE, 1988 P element insertions and rearrangements at the singed locus of Drosophila melanogaster.. Genetics 119:75-83
RONG, Y. S. and K. G. GOLIC, 2000 Gene targeting by homologous recombination in Drosophila. Science 288:2013-2018
RONG, Y. S. and K. G. GOLIC, 2001 A targeted gene knockout in Drosophila. Genetics 157:1307-1312
RORTH, P., 1996 A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. USA 93:12418-12422
RORTH, P., K. SZABO, A. BAILEY, T. LAVERTY, and J. REHM et al., 1998 Systematic gain-of-function genetics in Drosophila. Development 125:1049-1057[Abstract].
RUBIN, G. M. and A. C. SPRADLING, 1983 Vectors for P element-mediated gene transfer in Drosophila. Nucleic Acids Res. 11:6341-6351
RUBIN, G. M., L. HONG, P. BROKSTEIN, M. EVANS-HOLM, and E. FRISE, 2000 A Drosophila complementary DNA resource. Science 287:2222-2224
SALZ, H. K., T. W. CLINE, and P. SCHEDL, 1987 Functional changes associated with structural alterations induced by mobilization of a P-element inserted in the Sex-lethal gene of Drosophila. Genetics 117:221-231
SPRADLING, A., 1988 P element-mediated transformation, pp. 175–197 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Washington, DC.
SPRADLING, A. C., D. STERN, I. KISS, J. ROOTE, and T. LAVERTY et al., 1995 Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92:10824-10830
SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999 The BDGP gene disruption project: single P element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177
STEWART, R. J., P. PESAVENTO, D. N. WOERPEL, and L. S. B. GOLDSTEIN, 1991 Identification and partial characterization of six members of the kinesin superfamily in Drosophila. Proc. Natl. Acad. Sci. USA 88:8470-8474
TOWER, J., G. H. KARPEN, N. CRAIG, and A. C. SPRADLING, 1993 Preferential transposition of Drosophila P-elements to nearby chromosomal sites. Genetics 133:347-359[Abstract].
TSUBOTA, S. I. and P. SCHEDL, 1986 Hybrid dysgenesis-induced revertants of insertions at the 5' end of the rudimentary gene in Drosophila melanogaster: transposon-induced control mutations. Genetics 114:165-182
ZHANG, P. and A. C. SPRADLING, 1993 Efficient and dispersed local P-element transposition from Drosophila females. Genetics 133:361-373[Abstract].
ZHANG, P. and A. C. SPRADLING, 1994 Insertional mutagenesis of Drosophila heterochromatin with single P elements. Proc. Natl. Acad. Sci. USA 91:3539-3543
ZHANG, P. and R. L. STANKIEWICZ, 1998 Y-linked male sterile mutations induced by P element in Drosophila melanogaster.. Genetics 150:735-744
This article has been cited by other articles:
 |
|
 |
|
  J. Sudi, S. Zhang, G. Intrieri, X. Hao, and P. Zhang |