- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Borevitz, J. O.
- Articles by Chory, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Borevitz, J. O.
- Articles by Chory, J.
Quantitative Trait Loci Controlling Light and Hormone Response in Two Accessions of Arabidopsis thaliana
Justin O. Borevitz1,a,b, Julin N. Maloof1,a, Jason Lutesa,c, Tsegaye Dabia, Joanna L. Redferna, Gabriel T. Trainera,c, Jonathan D. Wernera,b, Tadao Asamid, Charles C. Berrye, Detlef Weigela,f, and Joanne Chorya,ca Plant Biology Laboratory, The Salk Institute for Biological Studies, La Jolla, California 92037,
b Department of Biology, University of California, La Jolla, California 92037,
c Howard Hughes Medical Institute, The Salk Institute for Biological Studies, La Jolla, California 92037,
d The Institute of Physical and Chemical Research (RIKEN), Wako-shi, Saitama 351-0198, Japan,
e Department of Family/Preventive Medicine, University of California, La Jolla, California 92093
f Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tübingen, Germany
Corresponding author: Joanne Chory, The Salk Institute for Biological Studies, 10010 N. Torrey Pines Rd., La Jolla, CA 92037., chory{at}salk.edu (E-mail)
Communicating editor: T. F. C. MACKAY
| ABSTRACT |
|---|
We have mapped quantitative trait loci (QTL) responsible for natural variation in light and hormone response between the Cape Verde Islands (Cvi) and Landsberg erecta (Ler) accessions of Arabidopsis thaliana using recombinant inbred lines (RILs). Hypocotyl length was measured in four light environments: white, blue, red, and far-red light and in the dark. In addition, white light plus gibberellin (GA) and dark plus the brassinosteroid biosynthesis inhibitor brassinazole (BRZ) were used to detect hormone effects. Twelve QTL were identified that map to loci not previously known to affect light response, as well as loci where candidate genes have been identified from known mutations. Some QTL act in all environments while others show genotype-by-environment interaction. A global threshold was established to identify a significant epistatic interaction between two loci that have few main effects of their own. LIGHT1, a major QTL, has been confirmed in a near isogenic line (NIL) and maps to a new locus with effects in all light environments. The erecta mutation can explain the effect of the HYP2 QTL in the blue, BRZ, and dark environments, but not in far-red. LIGHT2, also confirmed in an NIL, has effects in white and red light and shows interaction with GA. The phenotype and map position of LIGHT2 suggest the photoreceptor PHYB as a candidate gene. Natural variation in light and hormone response thus defines both new genes and known genes that control light response in wild accessions.
PLANT development is coordinated to optimize the amount of light available for photosynthesis. There is an elaborate control of plant responses to light, with a variety of photoreceptors at the top of different light response signaling hierarchies (![]()
![]()
![]()
![]()
![]()
![]()
Traditional genetics and other molecular approaches in Arabidopsis have provided a signal transduction framework (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Understanding the cross talk between these signaling pathways has been challenging since it requires careful observation in many specific light and hormone conditions. Dissecting light signals away from internal hormone control is difficult using traditional genetics. Mutants identified in screens for seedlings altered in hypocotyl length, a common measure of light sensitivity, often show pleiotropic phenotypes due to defects in hormone production or response (![]()
![]()
![]()
![]()
![]()
There are several advantages to using natural populations to discover genes affecting light response (![]()
![]()
![]()
![]()
Methods for detecting QTL depend on the size and type of population analyzed, the number of markers, and the statistical method. RILs allow the inherent environmental error to be reduced by replication, providing a powerful system of QTL analysis. Currently, the statistical methods of composite interval mapping (CIM; ![]()
![]()
The Arabidopsis RIL population derived from a cross between the Cape Verde Islands accession and the Landsberg erecta laboratory strain has been an important tool for the analysis of complex traits (![]()
![]()
![]()
![]()
![]()
![]()
Here we used the Ler/Cvi RIL set to map QTL in seven light and hormone environments. Multiple QTL were identified, some of which act across different light environments, whereas others showed genotype-by-environment interaction. Three QTL were confirmed in near isogenic lines, which define new loci, as well as loci with candidate genes. Moreover, this multienvironment analysis allows QTL to be organized into a genetic framework that can explain natural variation in different photoreceptor pathways.
| MATERIALS AND METHODS |
|---|
Plant material:
The RIL set derived from a cross between Cvi and Ler accessions was used for these studies (![]()
Growth conditions:
Seeds were sterilized in 1.5-ml microcentrifuge tubes for 10 min in 70% ethanol, 0.01% Triton X-100, followed by a 10-min wash with 95% ethanol, and then resuspended in 1 ml sterile water. After imbibition overnight at 4° in the dark, seeds were placed individually onto 0.7% phytagar plates containing 1/2 Murashige and Skoog salts using a Pipetman. Seedlings were spaced at a uniform density so that they did not shade each other. Plates were kept at 4° in the dark for another 3 days, followed by 4 hr of 120 µE m-2 sec-1 white light to induce germination. Further incubation was at 23°. Preliminary experiments in six conditions (all except dark) with Cvi, Ler, and most of the CvL RILs revealed substantial variation in hypocotyl lengths among lines and slight variation from week to week and from plate to plate (data not shown). For the results reported here, all light environments and all RILs were done in the same week to minimize week-to-week and week-to-plate variation. Furthermore the number of RILs per plate was increased to 12, providing better statistical control of plate-to-plate variation. Plates were rotated within each incubation chamber every 12 hr for the duration of the experiment to reduce variation among plates within each incubator. Ideally, the entire experiment would be replicated several times over to reduce the contribution of uncontrolled variation in the observed differences between RILs and light environments and to provide precise estimates of the magnitudes of the components of variation. Without such replication, differences due to uncontrolled variation between growth conditions in different incubators could be attributed to light environments and lead to spurious genotype-by-light environment associations. However, a single run of 162 RILs under seven light environments requires
240 person-hours to perform. From the preliminary studies we believed that extraneous variation could be controlled sufficiently to obtain useful results from a single-week experiment alone. In all, 1530 seedlings of each of 162 CvL RILs, Cvi, Ler, reciprocal F1 hybrids, and photoreceptor mutants were arrayed in groups of 12 lines per plate across 15 plates. This was replicated for the seven environmental conditions.
Light/hormone conditions:
Incubators used for all environments were Percival model E30B (Percival Scientific, Boone, IA). One incubator (Percival E30LED) was equipped with LED lights and used for the far-red environment. Neutral density screens were used to vary light fluence rate. Light measurements were made with a LI-1800 instrument (Li-Cor, Lincoln, Nebraska). We wanted to identify a fluence rate that would maximize the subtle variation in light sensitivity seen in natural populations. Pilot experiments showed that at high light fluence rates CvL RILs had relatively uniform, short hypocotyls and at low light fluence rates CvL lines were much longer but more variable. We chose intermediate light fluence rates, from a fluence response curve, for each light condition, where the broad-sense heritability was maximized for subsequent experiments. White light was provided by three 35-W cool white fluorescent bulbs and two 25-W incandescent bulbs. The photosynthetic active radiation (PAR, 400700 nm) was 35 µE m-2 sec-1, the Pfr/P ratio was 0.72 (![]()
was provided by three 20-W cool-white fluorescent bulbs and a filter that blocked light above 550 nm. Red light
was provided by three 20-W Gro-Lux fluorescent bulbs (Osram Sylvania, Danvers, MA) and a red filter that blocked light below 600 nm. Far-red light (0.5 µE m-2 sec-1; 700730 nm) was provided by LED lights. The same incubator was used for the dark and BRZ environments, and plates were wrapped in aluminum foil and received no further light after the 4-hr germination light pulse. A dose response curve, using different concentrations of the brassinosteroid biosynthetic inhibitor BRZ 91, identified 0.75 µM as the optimum concentration to maximize the heritability. A total of 0.75 µM BRZ (synthesized at RIKEN) was used unless otherwise indicated.
Hypocotyl length measurements:
On day 2, poor germination was scored in white light as 1 or 0. Most lines had already germinated (and were scored as "0"), but 14 lines (CvL nos. 1, 3, 8, 15, 16, 22, 24, 27, 38, 39, 152, 185, 186, and 188) had not (and were scored as "1"). All lines except CvL 3 germinated by day 3 and were measured on day 7. The germination state seen in white light was representative of all conditions and likely reflected both environmental and genetic variation in the state of the seeds rather than light response. Therefore, germination was used as a covariate in subsequent analyses. Seedlings were transferred to acetate sheets containing moist tissue paper and scanned on a flat bed scanner. Hypocotyl lengths were measured in millimeters using National Institutes of Health (NIH) image version 1.62 (http://rsb.info.nih.gov/nih-image). The effect of the covariate germination on hypocotyl length and the average number of seedlings measured in each environment are shown in Table 1.
|
Statistical analysis:
Data analysis was performed using the statistical package R (![]()
![]()
L1
L2), where cov12 is the covariance in line means, corrected for germination and plate effect, and
L1 and
L2 are square roots of among-line variances from the linear mixed-effects model (![]()
L1 by the grand mean of line means and multiplying by 100. Confidence intervals for rGE and CVG were calculated, using a "leave one out" jackknife procedure on 161 lines (![]()
|
The model for the dependence of hypocotyl length on germination status, RIL identity, and plate effects was
![]() |
(1) |
where yij are the measurements of hypocotyl length under a single light environment with i = 1, ... , 161 indexing the 161 RILs and j = 1, ... , ni indexing the seedlings of the ith RIL. Xi = (1, germi), where germi = 1 if germination was poor and 0 otherwise. ß = (ß0, ß1)' is a column vector of two unknown coefficients; ß0 is the mean under good germination and ß1 is the increment due to poor germination. Zi is a row vector of 161 elements all of which are zero except for the ith, which is 1.
RIL
N(0,
2RILI161x161) is a column vector of 161 elements. Wi is a row vector of 14 elements, all of which are zero except for the kth, which is 1 when RIL i was incubated on plate k such that
(i.e., lines "nest" within plates).
plate
N(0,
2plateI14x14) is a column vector of 14 elements and
ij
N(0,
2) is the residual and independent of other model terms. The phenotypic means are taken as
and estimates are obtained by replacing the respective parameters with restricted maximum-likelihood (REML) estimates. These estimators are best linear unbiased, so phenotypic means based on
i are the BLUPs under this model.
QTL analysis:
The CvL RILs had been previously genotyped (![]()
![]()
![]()
![]()
![]()
2.8 would correspond to P = 0.05. We used a window size of 1 cM because hypocotyl length has high heritability, many QTL were in tight linkage, and many lines and many markers were used in this experiment. QTL maps with larger window sizes (110 cM) gave broader QTL peaks; however, the two LOD support intervals were equivalent to the 1-cM window size map. Generally the width of QTL peak was defined by the flanking markers, at various window sizes.
|
|
|
Recombinant inbred line-by-environment testing:
The RILs are nested within plates in each light environment, so there is no "RIL-by-light environment-by-replicate" term to use as the error term for the "RIL-by-light environment" interaction. To test this interaction, two approaches were used. One was the sequential F-test of the RIL-by-light environment interaction term in a model including terms for line, light environment, plate, germination, and the germination-by-light environment interaction. In the absence of spatial or other effects on plates that increase between-RIL variation on a plate without also increasing "within RIL" variation, this is a powerful and appropriate test. The other test refers Tukey's "1 d.f. for interaction" statistic to its distribution under permutation of RIL interaction terms within plates; this yields a correct P value even in the presence of uncontrolled variation within RIL on a plate, but generally has limited power. For the first approach, Equation 1 and definitions above are extended as
![]() |
(2) |
where k indexes the light environment,
, and
with Lk being a 1 x 7 vector with a 1 in the kth element and zeroes elsewhere.
ijk
N(0,
2k) are independent residuals. Other terms on the right-hand side are suitably sized vectors of coefficients following the normalizations
, summing i over 1, ... , 161 and k over 1, ... , 7. The mean square for the RIL-by-light environment interaction,
ik
RIL·light, has 876 d.f. after accounting for the other terms and the F-statistic takes the residual mean square to be the error. The Tukey 1 d.f. for interaction statistic (![]()


where
|
(3) |
The statistic is F = SSG/(SSres/d.f.), taking d.f. as 875. A permutation test can be constructed by permuting (
RIL·light)7(j-1)+i with respect to the index j and calculating F under each permutation. Possible plate effects should be preserved in the reference distribution, so permutations of j must respect the assignment of RILs to plates. This type of permutation honors the normalizations above.
Multienvironment QTL mapping:
The multitrait CIM (mCIM) program JZmapqtl in QTL Cartographer was used (![]()
![]()
|
|
Tests of epistasis:
We tested interactions between QTL and then performed an exhaustive search for pairwise marker interactions using BQTL. Each environment was analyzed separately and included main effect QTL as background markers (Fig 3, Table 4) and the covariate germination. A total of 43,956 pairwise tests were done between 296 loci. These included 163 actual markers and 133 pseudomarkers, at marker intervals <2 cM, creating an
2-cM walking speed. The test statistic is the LOD score difference between a model with only additive effects and one that included an epistatic term. Thresholds for statistical tests used a sequential permutation procedure (![]()
4.6 corresponded to an experiment-wise threshold of P = 0.05 and was similar across light environments. The effect of the epistatic interaction is shown as 4i (Table 4), which represents the difference between the homotypic and heterotypic means (![]()
The maximum-likelihood method provides good power for detecting epistasis (![]()
![]()
![]()
![]()
![]()
![]() |
(4) |
where
![]() |
(5) |
yi =
i,
is the intercept, xi is zero if the ith line had good germination and one otherwise with ß as the coefficient for germination, j and k index the parental lines of the alleles at loci l1 and l2 being tested for epistasis, zj = 2(j - 1.5), zk = 2(k - 1.5),
1 and
2 are the main effects at those alleles and
12 is the epistatic effect, EZ|M(zl3, ... , zln|mi) is the expectation of a vector of z's corresponding to n - 2 other loci given the marker information for subject i and
is a vector of coefficients,
Z|M(Z = (zj, zk)|M = mi) is the probability that the two loci are in states j and k given the marker information for subject i,
2 is the residual variance, and
(y; µ,
2) is the normal density function. The maximum-likelihood solution of (4) and (5) with respect to all of the coefficients is carried out. In addition, the maximum-likelihood solution under
12 = 0 (no epistasis) is found. The log-likelihood ratio statistic X2(l1, l2) = 2(sup
L(
; y, x, l1, l2) - sup
0 L(
0; y, x, l1, l2)) is formed for all pairwise combinations of loci, l1 = 1, ... , 295, l2 = l1 + 1, ... , 296, taking
as the vector of free parameters and
0 as that vector with
12 fixed at zero. Statistical significance is ascertained via permutation testing using the "residual empirical threshold" method (![]()
; i.e., only the germination effect and the effects of the n - 2 loci used in all models are included. A new vector of trait values is formed by adding the fitted values to a permutation of the residuals from that model. The log-likelihood ratio statistic is found as above for every combination of loci, and the maximum of these is found for each permutation. Attained P values are found as the fraction of permuted maxima that equals or exceeds X2(l1, l2). This produces genome-wide P values that are nominally correct under the null hypothesis of no epistasis anywhere on the genome. However, the randomness in the procedure is considered objectionable especially when claiming to have attained a fixed significance level. This can be overcome by following the recommendations of ![]()
QTL effect estimation:
QTL effects were estimated by applying the method of maximum likelihood to the QTL model (![]()
where j1, ... , jK index K loci included in the QTL model, L epistatic terms are included with rl and sl indexing the main effects upon which they depend. Obvious modifications are made to the summation and to
Z|M, the joint allele state probabilities, in (4). These calculations were also performed by the function bqtl available in the R package. The additive effect is shown as 2a, the difference between homozygous classes. The percentage of change caused by a single QTL is the effect in millimeters (2a) divided by the average RIL hypocotyl length for that environment (Table 4) multiplied by 100. The percentage of variance explained for each QTL was determined by squaring the coefficient (a) and by dividing the residual variance in a null model without genetic loci (
2rN). Total variance explained was determined as
, where (
2rG) is the residual variance in the model with all genetic terms.
Near isogenic lines:
The LIGHT1 near isogenic line (NIL) was derived from line N42 created to map EDI (![]()
![]()
Genotyping:
Genotyping was done using CAPS markers. GPA1, g2395, and m235 information was from TAIR (http://www.arabidopsis.org). PHYB oligonucleotide primers were 5' CTGCTGACGAGAACACG 3' and 5' GAAAGTTGGCTTAAATGG 3'; Ler has a PstI restriction site absent from Cvi. BAS1 oligonucleotide primers were 5' ATATAATAGGCGTTCATCTAATG 3' and 5' CTCGGAGTTCGTACATG 3'; Cvi has an AccI restriction site absent in Ler. The BAS1 marker is 170 kb from the ERECTA gene, on the same bacterial artificial chromosome (BAC) T9J22.
Data and statistical routines are available on our web page (http://naturalvariation.org).
| RESULTS |
|---|
Genetic variation in CvL RILs:
Light quality (wavelength) and light quantity (fluence rate) affect hypocotyl length. We chose wavelengths of light that corresponded to the absorption maximum for the red and far-red absorbing forms of phytochrome and blue for cryptochrome to dissect the light responses controlled by individual photoreceptor pathways.
We then measured hypocotyl length of Cvi and Ler parental lines, reciprocal F1 hybrids, 162 Cvi/Ler RILs, and phytochrome mutants in seven different environments. The results are summarized in Table 1. In total, 17,787 hypocotyl length measurements made up the data set. Fig 1 shows the phenotype of the parental lines after 7 days of growth under the different experimental conditions. Cvi was generally less sensitive to light with a longer hypocotyl than the common lab strain Ler (t-test P < 0.05 all environments). Hypocotyl length differences were dramatic in white, blue, red, GA, and BRZ environments, but less so in the far-red and dark environments. F1 hybrids had long hypocotyls and were generally similar to the Cvi parent (Table 1). The difference between reciprocal crosses is likely due to the maternal effect of the erecta mutation (![]()
The genetic coefficient of variation (CVG), a unitless measure of genetic variability (![]()
20% of the mean for each environment except dark, where it was only 10% of the mean. The variance explained by RILs is an estimate of broad-sense heritability (Table 2). This ranged from 65 to 77% across environments except dark, which was lower (38%) due to a relatively large environmental component. This low level of background variation in the dark environment indicates that the variation seen in other environments was due largely to the specific effects of light and hormone treatments. Tests for RIL-by-environment interactions (see MATERIALS AND METHODS) were highly significant (Table 2).
Response is correlated across environments:
We estimated the cross-environment genetic correlation (rGE) between environments and found significant correlations between responses in all light and hormone conditions (Table 3). This indicates that much of the genetic control is shared among environments but that it is not identical. The highest correlation was between white and GA,
. In contrast, the correlation between dark and BRZ is 0.69. Differences in genetic correlations between the hormone environments may be due to true differences in the hormone response. Alternatively, differences in genetic correlations between these environments may reflect differences caused by adding additional GA hormone in one environment and using an inhibitor to remove BR hormone in another. Furthermore differences may reflect variation in endogenous levels of GA and BR levels.
Quantitative trait loci:
We first mapped QTL for each environment independently, using different background markers for each trait. The LOD score map is shown for each chromosome in Fig 3. QTL with LOD scores >3.6 (P < 0.01 threshold set by permutations) were considered significant. We chose a higher threshold because the many more QTL detected at P < 0.05 had rather small effects. A summary of the significant QTL including their effects is shown in Table 4. The effects were estimated by including significant markers and germination as covariates, using a maximum-likelihood approach that included main and epistatic terms (BQTL, see MATERIALS AND METHODS).
We named the QTL according to the environment in which they were detected and the chromosome to which they mapped (Fig 3). Three QTL mapped to chromosome 1. DARK1 maps to the top (07 cM) and was detected only in the dark environment. LIGHT1 was detected in all light environments and is one of the major QTL, explaining 22% of the phenotypic variance (
p) in white light. LIGHT1 had the highest LOD score of all the QTL in the white, blue, and red environments. The effect of LIGHT1 was similar in white, blue, and red environments but was weaker in the far-red environment (Table 4). HYPOCOTYL1 (HYP1) contributes to rGE since it was detected in all environments; however, the LOD score was below the threshold in the dark environment (Fig 3). The Ler allele of the HYP1 QTL increased hypocotyl length and may explain the transgression seen in many environments. LIGHT2, a major QTL on chromosome 2 (3240 cM), was detected in white, red, and GA environments. The largest effect of LIGHT2 was seen in the GA environment where homozygous allele substitutions caused 1.3 mm change in length and explained 22% of the phenotypic variance. Another QTL on chromosome 2, HYPOCOTYL2 (HYP2), mapped to the ERECTA locus and was detected in the blue, far-red, BRZ, and dark environments. A third QTL, FARRED2, was detected only in the far-red environment. On chromosome 3 we detected only one QTL, RED3, where again the Ler allele increases hypocotyl length. Chromosome 4 contained four significant QTL that were specific to single environments, BRZ4, WHITE4, BLUE4, and FARRED4. Last, chromosome 5 contained one QTL that was specific to the blue environment, BLUE5 (03 cM). Taken together, multiple QTL were detected across the seven environments that explain up to 61% of the variation in light response (Table 4). A surprisingly large amount of linkage was seen between QTL (Fig 3). The high genetic correlations among environments can be explained in part by QTL detected in multiple environments as well as linked QTL whose effects are specific to certain environments.
Genotype-by-environment interaction:
To understand how the natural variation seen at these light response QTL is controlled across different environments we used mCIM (![]()
To assess the effects of the hormone GA, a multitrait analysis was conducted, including the white and GA environments. The only QTL that showed significant G x E was LIGHT2, due to the difference in effects at this locus between the GA and white environments. In the GA environment Cvi alleles increased the phenotype by 1.3 mm, whereas in white light, they caused only a 0.7 mm increase (Table 4). However, the effect of LIGHT2, expressed as percentage of change in length, is similar between the GA and white environments. The effect of the BR inhibitor BRZ was investigated in the same way using mCIM by including dark and BRZ environments as traits. As expected the unique loci DARK1 and BRZ4 showed significant G x E as they were only detected in a single environment. HYP2 did not show G x E as it has a similar additive effect in dark and BRZ environments, 1.3 and 1.5 mm respectively. However, the difference in effects expressed as percentage of change in length is dramatic, 8% in dark and 20% in the BRZ environment (Table 4).
Epistatic interactions:
We performed a genome scan for pairwise interactions. Each environment was analyzed separately using models that included specific background markers (see MATERIALS AND METHODS). Again an appropriate significance threshold was set by permutations to account for the type of population, any segregation distortion, and the large number of tests. A single epistatic pair was identified in the white light environment that was significant under this stringent criterion (-1.4 mm in white light, Table 4). In all other environments, this pair had an effect (-0.81.5 mm) similar to that seen in white light and was point-wise significant (P < 0.007). These epistatic loci are linked on chromosome 5, separated by
15 cM. Forty-four of 162 RILs fall into this recombinant class. The negative interaction coefficient indicates that Ler and Cvi allele classes act cooperatively in this case. Fig 4 depicts a genetic model that illustrates the statistical epistatic interaction. Apparently, one of these markers acts as a "controller locus." There is an allele-specific interaction that is the basis for the significant epistatic term in the statistical model. When BF.269C is Ler, allele changes at GH.117C have no effect, but when BF.269C is Cvi, allele changes at GH.117C have a large effect. Thus, BF.269C could act as a controller locus and GH.117C as the "effector locus." By reversing the order of the middle genotypes in Fig 4, GH.117C could be the controller locus governing the direction of the effect of BF.269C. These two genetic models (Fig 4) are equally plausible interpretations of the statistical interaction.
|
Near isogenic lines:
To confirm and better characterize the major QTL, we introgressed them into an isogenic Ler background. NIL-QTL effects were measured in segregating progeny of a single line to minimize seed variation between different mother plants (Fig 5). The LIGHT1 NIL is heterozygous and segregates the LIGHT1 QTL. The effect of LIGHT1 in an isogenic background confirms the prediction by QTL analysis in the RIL population and also shows that the gene is unlikely to act dominantly
. The effects of LIGHT2 and HYP2 QTL were investigated in an isogenic Ler background (see MATERIALS AND METHODS). Surprisingly, the less sensitive Cvi allele of LIGHT2 was dominant
. The effect of the HYP2 QTL was confirmed in two environments using CvL125 x Ler F2 seedlings. In the far-red environment HYP2 showed no evidence of a dominant effect
, whereas in the BRZ environment the Cvi allele of HYP2 was clearly dominant
.
|
ERECTA and HYP2:
The erecta mutation segregating in these lines has been shown to have many pleiotropic effects in Ler (![]()
![]()
|
PHYTOCHROME B is a candidate for LIGHT2:
Arabidopsis phyB mutants have elongated hypocotyls in the white and red environments but not in the blue or far-red environments (Table 1). phyB mutants are also hypersensitive to GA (![]()
200 other genes are in the 8-cM LIGHT2 QTL interval.
| DISCUSSION |
|---|
We have identified 12 QTL that correspond to both candidate and unknown genes. Several QTL map to positions where no published candidate genes or photomorphogenic mutations map, such as HYP1, RED3, WHITE4, BLUE4, FARRED4, and BLUE5. The major QTL BRZ4 also describes a novel locus and has an effect that is large enough to make positional cloning a possibility. If the molecular nature of BRZ4 can be identified it will uncover a new gene involved in brassinosteroid signaling and may help explain variation in hormone response among Arabidopsis accessions. In contrast, the confidence limits of the DARK1 QTL overlap that of a Cvi/Ler QTL affecting seed quality (![]()
![]()
![]()
![]()
LIGHT1 represents a major locus responsible for light response variation between Ler and Cvi across multiple light environments. Confidence limits of a major QTL affecting circadian rhythm, ESPRESSO, overlap with LIGHT1 (![]()
![]()
![]()
![]()
Both the phenotype and map position of the LIGHT2 QTL indicate PHYB as a candidate gene. We have sequenced PHYB from Cvi and Ler and found considerable nucleotide variation in the promoter as well as synonymous and replacement changes in the coding region (J. N. MALOOF, J. LUTES, J. O. BOREVITZ, D. WEIGEL and J. CHORY, unpublished data). It is surprising that a photoreceptor may be a major light QTL, as loss-of-function phyB mutations have dramatic, deleterious effects throughout development. phyB null mutations also have a large effect on flowering time (![]()
![]()
The HYP2 locus exemplifies the difficulty in distinguishing between a single gene with effects in multiple environments and multiple genes in tight linkage with effects in specific environments. HYP2 has effects in blue, far-red, BRZ, and dark and contributes to the high correlation between these environments (Table 3). The effect of HYP2 in the blue and BRZ and dark environments is due to erecta (Fig 6A and Fig B). The far-red phenotype of HYP2, however, is likely not due to erecta (Fig 5 and Fig 6B) and thus represents variation at another tightly linked gene. QTL analysis of the VLFR in the Ler/Col RILs identified two QTL, VLF1 and VLF2 (![]()
Identifying epistatic interactions is a powerful advantage of QTL mapping over traditional approaches. The interacting loci on chromosome 5 together have an effect equal to that of the major light response QTL (Table 4), indicating that epistasis does account for some of the variation in hypocotyl length. Flowering time experiments have identified epistasis as an important factor in quantitative variation, with one interaction explaining up to 31% of the phenotypic variance (![]()
![]()
![]()
![]()
In conclusion, we have mapped 12 highly significant hypocotyl length light and hormone response QTL from the Ler/Cvi RIL population. Some QTL are unique to specific environments and have genotype-by-environment interactions, while others have effects in multiple environments. Fig 7 depicts a model in which QTL are placed into a genetic framework according to the environments in which they have phenotypes. Individual QTL can be crossed to other Arabidopsis photomorphogenic and hormone mutants and be integrated with the known signal transduction network (![]()
|
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Ben Sadrian for help with hypocotyl measurements; Chris Basten and R. Doerge for help with QTL Cartographer; Josh Kohn, Jennifer Nemhauser, Marcelo Yanovsky, Pablo Cerdan, and José Dinneny for discussion and advice on the manuscript; Ming Ji for discussion on the experimental design and analysis; and Carlos Alonso-Blanco and Maarten Koornneef for seeds and discussion. Seeds were obtained from the Arabidopsis Biological Resource Center at Ohio State University, which is funded by the National Science Foundation (NSF). The joint program in quantitative genetics in the Weigel and Chory laboratories is supported by National Institutes of Health (NIH) training grant GM08666 (J.O.B.), by a Helen Hay Whitney Fellowship (J.M.N.), an NSF Predoctoral Fellowship (J.D.W.), funds from the Howard Hughes Medical Institute (HHMI) and NIH (GM52413) to J.C., by an REU supplement to NSF grant IBN-9723818 to D.W., and by a grant from Torrey Mesa Research Institute/Syngenta to D.W. J.C. is an Associate Investigator of the HHMI. Charles Berry is funded by NIH grant AR40770 and Tadao Asami by a Bio-architect Research Program. D.W. is a director of the Max Planck Institute.
Manuscript received March 9, 2001; Accepted for publication November 8, 2001.
| LITERATURE CITED |
|---|
ALONSO-BLANCO, C. and M. KOORNNEEF, 2000 Naturally occurring variation in Arabidopsis: an underexploited resource for plant genetics. Trends Plant Sci. 5:22-29[Medline].
ALONSO-BLANCO, C., S. E.-D. EL-ASSAL, G. COUPLAND, and M. KOORNNEEF, 1998a Analysis of natural allelic variation at flowering time loci in the Landsberg erecta and Cape Verde Islands ecotypes of Arabidopsis thaliana.. Genetics 149:749-764
ALONSO-BLANCO, C., A. J. M. PEETERS, M. KOORNNEEF, C. LISTER, and C. DEAN et al., 1998b Development of an AFLP based linkage map of Ler, Col and Cvi Arabidopsis thaliana ecotypes and construction of a Ler/Cvi recombinant inbred line population. Plant J. 14:259-271[Medline].
ALONSO-BLANCO, C., H. BLANKESTIJN-DE VRIES, C. J. HANHART, and M. KOORNNEEF, 1999 Natural allelic variation at seed size loci in relation to other life history traits of Arabidopsis thaliana.. Proc. Natl. Acad. Sci. USA 96:4710-4717
Analysis of the genome sequence of the flowering plant Arabidopsis thaliana.. (2000) Nature 408:796-815[Medline].
ASAMI, T. and S. YOSHIDA, 1999 Brassinosteroid biosynthesis inhibitors. Trends Plant Sci. 4:348-353[Medline].
ASAMI, T., Y. K. MIN, N. NAGATA, K. YAMAGISHI, and S. TAKATSUTO et al., 2000 Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123:93-99
BENTSINK, L., C. ALONSO-BLANCO, D. VREUGDENHIL, K. TESNIER, and S. P. GROOT et al., 2000 Genetic analysis of seed-soluble oligosaccharides in relation to seed storability of Arabidopsis. Plant Physiol. 124:1595-1604
CASAL, J. J. and H. SMITH, 1989 The function action and adaptive significance of phytochrome in light-grown plants. Plant Cell Environ. 12:855-862.
CHORY, J. and J. LI, 1997 Gibberellins, brassinosteroids and light-regulated development. Plant Cell Environ. 20:801-806.
DOERGE, R. W. and G. A. CHURCHILL, 1996 Permutation tests for multiple loci affecting a quantitative character. Genetics 142:285-294[Abstract].
EFRON, B., and R. TIBSHIRANI, 1993 An Introduction to the Bootstrap. Chapman & Hall, New York.
HALEY, C. S. and S. A. KNOTT, 1992 A simple regression method for mapping quantitative trait loci in line crosses using flanking markers. Heredity 69:315-324[Medline].
HOECKER, U., Y. XU, and P. H. QUAIL, 1998 SPA1: a new genetic locus involved in phytochrome A-specific signal transduction. Plant Cell 10:19-33
HOECKER, U., J. M. TEPPERMAN, and P. H. QUAIL, 1999 SPA1, a WD-repeat protein specific to phytochrome A signal transduction. Science 284:496-499
HOULE, D., 1992 Comparing evolvability and variability of quantitative traits. Genetics 130:195-204[Abstract].
HSIEH, H. L., H. OKAMOTO, M. WANG, L. H. ANG, and M. MATSUI et al., 2000 FIN219, an auxin-regulated gene, defines a link between phytochrome A and the downstream regulator COP1 in light control of Arabidopsis development. Genes Dev. 14:1958-1970
IHAKA, R. and R. GENTLEMAN, 1996 R: a language for data analysis and graphics. J. Comput. Graph. Stat. 5:299-314.
JANSEN, R. C., 1993 Interval mapping of multiple quantitative trait loci. Genetics 135:205-211[Abstract].
JANSEN, R. C. and P. STAM, 1994 High resolution of quantitative traits into multiple loci via interval mapping. Genetics 136:1447-1455[Abstract].
JIANG, C. and Z-B. ZENG, 1995 Multiple trait analysis of genetic mapping for quantitative trait loci. Genetics 140:1111-1127[Abstract].
JUENGER, T., M. PURUGGANAN, and T. F. MACKAY, 2000 Quantitative trait loci for floral morphology in Arabidopsis thaliana.. Genetics 156:1379-1392
KAO, C.-H., 2000 On the differences between maximum likelihood and regression interval mapping in the analysis of quantitative trait loci. Genetics 156:855-865
KENDRICK, R. E., and G. H. M. KRONENBERG, 1994 Photomorphogenesis in Plants. Kluwer Academic, Dordrecht The Netherlands/Boston.
KNAPP, S. J., W. C. BRIDGES, JR., and D. BIRKES, 1990 Mapping quantitative trait loci using molecular marker linkage maps. Theor. Appl. Genet. 79:583-592.
KONIECZNY, A. and F. M. AUSUBEL, 1993 A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4:403-410[Medline].
KRYSAN, P. J., J. C. YOUNG, and M. R. SUSSMAN, 1999 T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11:2283-2290
LEE, I. and R. M. AMASINO, 1995 Effect of vernalization, photoperiod, and light quality on the flowering phenotype of Arabidopsis plants containing the FRIGIDA gene. Plant Physiol. 108:157-162[Abstract].
LI, J. and J. CHORY, 1997 A putative leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. Cell 90:929-938[Medline].
LI, J., P. NAGPAL, V. VITART, T. C. MCMORRIS, and J. CHORY, 1996 A role for brassinosteroids in light-dependent development of Arabidopsis. Science 272:398-401[Abstract].
MALOOF, J. N., J. O. BOREVITZ, D. WEIGEL, and J. CHORY, 2000 Natural variation in phytochrome signaling. Semin. Cell Dev. Biol. 11:523-530[Medline].
MALOOF, J. N., J. O. BOREVITZ, T. DABI, J. LUTES, and R. B. NEHRING et al., 2001 Natural variation in light sensitivity of Arabidopsis. Nat. Genet. 29:441-446[Medline].
NEFF, M. M., S. M. NGUYEN, E. J. MALANCHARUVIL, S. FUJIOKA, and T. NOGUCHI et al., 1999 BAS1: a gene regulating brassinosteroid levels and light responsiveness in Arabidopsis. Proc. Natl. Acad. Sci. USA 96:15316-15323
NEFF, M. M., C. FANKHAUSER, and J. CHORY, 2000 Light: an indicator of time and place. Genes Dev. 14:257-271
NETTLETON, D. and R. W. DOERGE, 2000 Accounting for variability in the use of permutation testing to detect quantitative trait loci. Biometrics 56:52-58[Medline].
PARINOV, S., M. SEVUGAN, Y. DE, W. C. YANG, and M. KUMARAN et al., 1999 Analysis of flanking sequences from Dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell 11:2263-2270
PINHEIRO, J. C., and D. M. BATES, 2000 Mixed-Effects Models in S and S-Plus. Springer-Verlag, New York.
REED, J. W., P. NAGPAL, D. S. POOLE, M. FURUYA, and J. CHORY, 1993 Mutations in the gene for the red/far-red light receptor phytochrome B alter cell elongation and physiological responses throughout Arabidopsis development. Plant Cell 5:147-157[Abstract].
REED, J. W., K. R. FOSTER, P. W. MORGAN, and J. CHORY, 1996 Phytochrome B affects responsiveness to gibberellins in Arabidopsis. Plant Physiol. 112:337-342[Abstract].
ROBERTSON, A., 1959 The sampling variance of the genetic correlation coefficient. Biometrics 15:469-485.
SCHAFFER, R., N. RAMSAY, A. SAMACH, S. CORDEN, and J. PUTTERILL et al., 1998 The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell 93:1219-1229[Medline].
SCHEFFÉ, H., 1959 The Analysis of Variance. John Wiley & Sons, New York.
SCHMITT, J., S. A. DUDLEY, and M. PIGLIUCCI, 1999 Manipulative approaches to testing adaptive plasticity: phytochrome-mediated shade-avoidance responses in plants. Am. Nat. 154:S43-S54.
SHIMOMURA, K., S. S. LOW-ZEDDIES, D. P. KING, T. D. STEEVES, and A. WHITELEY et al., 2001 Genome-wide epistatic interaction analysis reveals complex genetic determinants of circadian behavior in mice. Genome Res. 11:959-980
SHOOK, D. R. and T. E. JOHNSON, 1999 Quantitative trait loci affecting survival and fertility-related traits in Caenorhabditis elegans show genotype-environment interactions, pleiotropy and epistasis. Genetics 153:1233-1243
SMITH, H., 1995 Physiological and ecological function within the phytochrome family. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:289-315.
SWARUP, K., C. ALONSO-BLANCO, J. R. LYNN, S. D. MICHAELS, and R. M. AMASINO et al., 1999 Natural allelic variation identifies new genes in the Arabidopsis circadian system. Plant J. 20:67-77[Medline].
TIAN, Q. and J. W. REED, 1999 Control of auxin-regulated root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126:711-721[Abstract].
TORII, K. U., N. MITSUKAWA, T. OOSUMI, Y. MATSUURA, and R. YOKOYAMA et al., 1996 The Arabidopsis ERECTA gene encodes a putative receptor protein kinase with extracellular leucine-rich repeats. Plant Cell 8:735-746[Abstract].
VOS, P., R. HOGERS, M. BLEEKER, M. REIJANS, and T. VAN DE LEE et al., 1995 AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23:4407-4414
WANG, Z. Y. and E. M. TOBIN, 1998 Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 93:1207-1217[Medline].
YAMAMURO, C., Y. IHARA, X. WU, T. NOGUCHI, and S. FUJIOKA et al., 2000 Loss of function of a Rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12:1591-1606
YANOVSKY, M. J., J. J. CASAL, and J. P. LUPPI, 1997 The VLF loci, polymorphic between ecotypes Landsberg erecta and Columbia, dissect two branches of phytochrome A signal transduction that correspond to very-low-fluence and high-irradiance responses. Plant J. 12:659-667[Medline].
ZENG, Z-B., 1994 Precision mapping of quantitative trait loci. Genetics 136:1457-1468[Abstract].
ZHAO, Y., S. K. CHRISTENSEN, C. FANKHAUSER, J. R. CASHMAN, and J. D. COHEN et al., 2001 A role for flavin-containing monooxygenases in auxin biosynthesis. Science 291:306-309
This article has been cited by other articles:
![]() |
O. Loudet, T. P. Michael, B. T. Burger, C. Le Mette, T. C. Mockler, D. Weigel, and J. Chory A zinc knuckle protein that negatively controls morning-specific growth in Arabidopsis thaliana PNAS, November 4, 2008; 105(44): 17193 - 17198. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Filiault, C. A. Wessinger, J. R. Dinneny, J. Lutes, J. O. Borevitz, D. Weigel, J. Chory, and J. N. Maloof Amino acid polymorphisms in Arabidopsis phytochrome B cause differential responses to light PNAS, February 26, 2008; 105(8): 3157 - 3162. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Sangster, N. Salathia, S. Undurraga, R. Milo, K. Schellenberg, S. Lindquist, and C. Queitsch HSP90 affects the expression of genetic variation and developmental stability in quantitative traits PNAS, February 26, 2008; 105(8): 2963 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Warpeha, S. Upadhyay, J. Yeh, J. Adamiak, S. I. Hawkins, Y. R. Lapik, M. B. Anderson, and L. S. Kaufman The GCR1, GPA1, PRN1, NF-Y Signal Chain Mediates Both Blue Light and Abscisic Acid Responses in Arabidopsis Plant Physiology, April 1, 2007; 143(4): 1590 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Nichols, K. W. Broman, K. Sundin, J. M. Young, P. A. Wheeler, and G. H. Thorgaard Quantitative Trait Loci x Maternal Cytoplasmic Environment Interaction for Development Rate in Oncorhynchus mykiss Genetics, January 1, 2007; 175(1): 335 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mouille, H. Witucka-Wall, M.-P. Bruyant, O. Loudet, S. Pelletier, C. Rihouey, O. Lerouxel, P. Lerouge, H. Hofte, and M. Pauly Quantitative Trait Loci Analysis of Primary Cell Wall Composition in Arabidopsis Plant Physiology, July 1, 2006; 141(3): 1035 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. C. Luquez, Y. Sasal, M. Medrano, M. I. Martin, M. Mujica, and J. J. Guiamet Quantitative trait loci analysis of leaf and plant longevity in Arabidopsis thaliana J. Exp. Bot., March 1, 2006; 57(6): 1363 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. I. Sergeeva, J. J. B. Keurentjes, L. Bentsink, J. Vonk, L. H. W. van der Plas, M. Koornneef, and D. Vreugdenhil Vacuolar invertase regulates elongation of Arabidopsis thaliana roots as revealed by QTL and mutant analysis PNAS, February 21, 2006; 103(8): 2994 - 2999. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Malmberg, S. Held, A. Waits, and R. Mauricio Epistasis for Fitness-Related Quantitative Traits in Arabidopsis thaliana Grown in the Field and in the Greenhouse Genetics, December 1, 2005; 171(4): 2013 - 2027. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Werner, J. O. Borevitz, N. H. Uhlenhaut, J. R. Ecker, J. Chory, and D. Weigel FRIGIDA-Independent Variation in Flowering Time of Natural Arabidopsis thaliana Accessions Genetics, July 1, 2005; 170(3): 1197 - 1207. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Callahan Using Artificial Selection to Understand Plastic Plant Phenotypes Integr. Comp. Biol., June 1, 2005; 45(3): 475 - 485. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. A. Magliano, J. F. Botto, A. V. Godoy, V. V. Symonds, A. M. Lloyd, and J. J. Casal New Arabidopsis Recombinant Inbred Lines (Landsberg erecta x Nossen) Reveal Natural Variation in Phytochrome-Mediated Responses Plant Physiology, June 1, 2005; 138(2): 1126 - 1135. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mathews Phytochrome Evolution in Green and Nongreen Plants J. Hered., May 1, 2005; 96(3): 197 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Edwards, J. R. Lynn, P. Gyula, F. Nagy, and A. J. Millar Natural Allelic Variation in the Temperature-Compensation Mechanisms of the Arabidopsis thaliana Circadian Clock Genetics, May 1, 2005; 170(1): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Werner, J. O. Borevitz, N. Warthmann, G. T. Trainer, J. R. Ecker, J. Chory, and D. Weigel Quantitative trait locus mapping and DNA array hybridization identify an FLM deletion as a cause for natural flowering-time variation PNAS, February 15, 2005; 102(7): 2460 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Dolan and J. A. Langdale New insights into plant development in New England Development, November 1, 2004; 131(21): 5215 - 5220. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Hobbs, J. E. Flintham, and M. J. Hills Genetic Control of Storage Oil Synthesis in Seeds of Arabidopsis Plant Physiology, October 1, 2004; 136(2): 3341 - 3349. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Wolyn, J. O. Borevitz, O. Loudet, C. Schwartz, J. Maloof, J. R. Ecker, C. C. Berry, and J. Chory Light-Response Quantitative Trait Loci Identified with Composite Interval and eXtreme Array Mapping in Arabidopsis thaliana Genetics, June 1, 2004; 167(2): 907 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. El-Lithy, E. J.M. Clerkx, G. J. Ruys, M. Koornneef, and D. Vreugdenhil Quantitative Trait Locus Analysis of Growth-Related Traits in a New Arabidopsis Recombinant Inbred Population Plant Physiology, May 1, 2004; 135(1): 444 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hake and T. Rocheford Exploiting quantitative trait loci in gene discovery Genes & Dev., March 15, 2004; 18(6): 597 - 601. [Full Text] [PDF] |
||||
![]() |
J. F. Botto, C. Alonso-Blanco, I. Garzaron, R. A. Sanchez, and J. J. Casal The Cape Verde Islands Allele of Cryptochrome 2 Enhances Cotyledon Unfolding in the Absence of Blue Light in Arabidopsis Plant Physiology, December 1, 2003; 133(4): 1547 - 1556. [Abstract] [Full Text] |
||||
![]() |
T. P. Michael, P. A. Salome, H. J. Yu, T. R. Spencer, E. L. Sharp, M. A. McPeek, J. M. Alonso, J. R. Ecker, and C. R. McClung Enhanced Fitness Conferred by Naturally Occurring Variation in the Circadian Clock Science, November 7, 2003; 302(5647): 1049 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Jermstad, D. L. Bassoni, K. S. Jech, G. A. Ritchie, N. C. Wheeler, and D. B. Neale Mapping of Quantitative Trait Loci Controlling Adaptive Traits in Coastal Douglas Fir. III. Quantitative Trait Loci-by-Environment Interactions Genetics, November 1, 2003; 165(3): 1489 - 1506. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kim, H. Yi, G. Choi, B. Shin, P.-S. Song, and G. Choi Functional Characterization of Phytochrome Interacting Factor 3 in Phytochrome-Mediated Light Signal Transduction PLANT CELL, October 1, 2003; 15(10): 2399 - 2407. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weinig, L. A. Dorn, N. C. Kane, Z. M. German, S. S. Halldorsdottir, M. C. Ungerer, Y. Toyonaga, T. F. C. Mackay, M. D. Purugganan, and J. Schmitt Heterogeneous Selection at Specific Loci in Natural Environments in Arabidopsis thaliana Genetics, September 1, 2003; 165(1): 321 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Ungerer, S. S. Halldorsdottir, M. D. Purugganan, and T. F. C. Mackay Genotype-Environment Interactions at Quantitative Trait Loci Affecting Inflorescence Development in Arabidopsis thaliana Genetics, September 1, 2003; 165(1): 353 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Schmitt, J. R. Stinchcombe, M. S. Heschel, and H. Huber The Adaptive Evolution of Plasticity: Phytochrome-Mediated Shade Avoidance Responses Integr. Comp. Biol., July 1, 2003; 43(3): 459 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alonso-Blanco, L. Bentsink, C. J. Hanhart, H. Blankestijn-de Vries, and M. Koornneef Analysis of Natural Allelic Variation at Seed Dormancy Loci of Arabidopsis thaliana Genetics, June 1, 2003; 164(2): 711 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. O. Borevitz and M. Nordborg The Impact of Genomics on the Study of Natural Variation in Arabidopsis Plant Physiology, June 1, 2003; 132(2): 718 - 725. [Full Text] [PDF] |
||||
![]() |
O. Loudet, S. Chaillou, A. Krapp, and F. Daniel-Vedele Quantitative Trait Loci Analysis of Water and Anion Contents in Interaction With Nitrogen Availability in Arabidopsis thaliana Genetics, February 1, 2003; 163(2): 711 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Loudet, S. Chaillou, P. Merigout, J. Talbotec, and F. Daniel-Vedele Quantitative Trait Loci Analysis of Nitrogen Use Efficiency in Arabidopsis Plant Physiology, January 1, 2003; 131(1): 345 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weinig, M. C. Ungerer, L. A. Dorn, N. C. Kane, Y. Toyonaga, S. S. Halldorsdottir, T. F. C. Mackay, M. D. Purugganan, and J. Schmitt Novel Loci Control Variation in Reproductive Timing in Arabidopsis thaliana in Natural Environments Genetics, December 1, 2002; 162(4): 1875 - 1884. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Perez-Perez, J. Serrano-Cartagena, and J. L. Micol Genetic Analysis of Natural Variations in the Architecture of Arabidopsis thaliana Vegetative Leaves Genetics, October 1, 2002; 162(2): 893 - 915. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Borevitz, J. O.
- Articles by Chory, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Borevitz, J. O.
- Articles by Chory, J.





















