Genetics, Vol. 160, 493-507, February 2002, Copyright © 2002

Patterns of Genetic Variation at a Chromosome 4 Locus of Drosophila melanogaster and D. simulans

Mark A. Jensen1,a, Brian Charleswortha, and Martin Kreitmana
a Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637-1573

Corresponding author: Brian Charlesworth, Animal and Population Biology, University of Edinburgh, W. Mains Rd., Edinburgh EH9 3JT, United Kingdom., brian.charlesworth{at}ed.ac.uk (E-mail)

Communicating editor: W. STEPHAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

DNA sequence surveys of Drosophila melanogaster populations show a strong positive correlation between the recombination rate experienced by a locus and its level of nucleotide polymorphism. In particular, surveys of the fourth chromosome gene ciD show greatly reduced levels of nucleotide variation; this observation was originally interpreted in terms of selective sweeps occurring on the nonrecombining fourth chromosome. Subsequent theoretical work has, however, uncovered several other selective processes that can reduce variation. In this study, we revisit the Drosophila fourth chromosome, investigating variation in 5–6 kb of the gene ankyrin in D. melanogaster and D. simulans. Silent nucleotide site diversity is ~5 x 10-4 for both species, consistent with the previous observations of low variation at ciD. Given the observed frequency spectra at ankyrin, coalescent simulations indicate that reduced diversity in the region is unlikely to be due to a selective sweep alone. We find evidence for recombinational exchange at this locus, and both species appear to be fixed for an insertion of the transposable element HB in an intron of ankyrin.


THERE is a strong positive correlation between the local recombination rate experienced by a locus and its level of nucleotide polymorphism in populations of Drosophila melanogaster (AGUADE et al. 1989 Down; BEGUN and AQUADRO 1992 Down; AGUADE and LANGLEY 1994 Down; AQUADRO et al. 1994 Down; MORIYAMA and POWELL 1996 Down; ANDOLFATTO and PRZEWORSKI 2001 Down). This is one of the most striking patterns to have emerged from DNA sequence surveys. It persists after correction for possible differences in mutation rates among chromosomal regions by the use of interspecies sequence divergence data (BEGUN and AQUADRO 1992 Down; AGUADE et al. 1994 Down). This pattern was initially taken to mean that neutral variants had been hitchhiked to fixation by strongly advantageous mutations to which they were closely linked (MAYNARD SMITH and HAIGH 1974 Down; KAPLAN et al. 1989 Down; STEPHAN et al. 1992 Down; BARTON 1998 Down, BARTON 2000 Down; GILLESPIE 2000 Down). The effects of such "selective sweeps" (BERRY et al. 1991 Down) are expected to be more pronounced in regions with low rates of recombination, because linkage between a given locus and a target of selection will on average be tighter in such regions (AGUADE et al. 1989 Down; BEGUN and AQUADRO 1992 Down).

The relation between variability and recombination rate thus seemed to provide evidence for the frequent occurrence of adaptive gene substitutions throughout the Drosophila genome (WIEHE and STEPHAN 1993 Down; STEPHAN 1995 Down). But CHARLESWORTH et al. 1993 Down identified a potentially widespread, nonadaptive, process that could result in reduction of variation in low-recombining regions. Their "background selection" hypothesis proposes that purifying selection against recurrent deleterious mutations also eliminates neutral variants at nucleotide sites closely linked to such mutations. Models of the effects of deleterious mutations on neutral variability across chromosome arms provide good fits to the observed relation between local recombination rate and the level of DNA sequence variation (HUDSON and KAPLAN 1995 Down; CHARLESWORTH 1996 Down). For most regions of low diversity, therefore, background selection seems to be as likely a contributor to reduced diversity as hitchhiking due to favorable mutations. In addition, other processes are capable of reducing variation in regions of low recombination rates, including temporally fluctuating selection pressures (GILLESPIE 1994 Down, GILLESPIE 1997 Down; BARTON 2000 Down) and Hill-Robertson interference effects among tightly linked, weakly selected variants (COMERON et al. 1999 Down; MCVEAN and CHARLESWORTH 2000 Down).

It is possible to get an idea of the extent to which selective sweeps may be important in contributing to the pattern just described by examining the frequency spectrum of neutral polymorphic sites in regions of reduced recombination. While this spectrum will be strongly skewed toward rare variants following a recent selective sweep (BRAVERMAN et al. 1995 Down; SIMONSEN et al. 1995 Down; FU 1997 Down; FAY and WU 2000 Down), the frequency spectrum associated with background selection or fluctuating selection is often not much perturbed from neutral expectation (HUDSON and KAPLAN 1994 Down; CHARLESWORTH et al. 1995 Down; GILLESPIE 1997 Down). A failure to detect a skewed frequency distribution may therefore suggest that selective sweeps are not the major factor in contributing to reduced variability. Previous work indeed suggests that significant departures from neutrality are detected only infrequently in regions of reduced recombination (BRAVERMAN et al. 1995 Down; CHARLESWORTH et al. 1995 Down; LANGLEY et al. 2000 Down). However, a recent survey of published data suggests that there is usually a tendency toward a greater degree of skew toward low-frequency variants in regions of low recombination in African (but not non-African) populations of D. melanogaster (ANDOLFATTO and PRZEWORSKI 2001 Down), although individual loci do not show significant effects.

Given that there is little polymorphism in regions of low recombination, failure to detect departures from neutrality may simply reflect low power of the statistical tests. For this reason, it is important to gather more data on the properties of natural variation in regions of reduced recombination. In this study, we revisit the fourth chromosome of Drosophila. In D. melanogaster, this small (5–6 Mb) genetic element is not known to recombine under ordinary laboratory conditions (STURTEVANT 1951 Down; HOCHMAN 1976 Down) and is achiasmate at female meiosis (HAWLEY et al. 1993 Down). It is thought to contain 74 genes (ADAMS et al. 2000 Down), of which 12 have been characterized. Previous studies, performed on a relatively small scale, did not uncover enough polymorphism to be able to apply tests on the basis of the frequency spectrum. BERRY et al. 1991 Down found no polymorphism among 10 D. melanogaster chromosomes and 1 singleton site among 9 D. simulans chromosomes for 331 silent sites of the ciD gene, while HILTON et al. 1994 Down found no polymorphism over the same region among 4 D. sechellia chromosomes and a singleton site among 6 D. mauritiana chromosomes. Both of these studies interpreted the lack of polymorphism as evidence for a recent selective sweep, but the subsequent development of alternative models for explaining reduced variation casts doubt on this conclusion (see above).

We have examined 38 D. melanogaster lines and 33 D. simulans lines for ~5 kb of predominantly intronic sequence of the fourth chromosome gene ankyrin (DUBREUIL and YU 1994 Down), to obtain better estimates of the levels of variation and frequency spectra on the fourth chromosome in these two species. To conduct this larger-scale study, we used the rapid mutation detection technology, denaturing high-performance liquid chromatography (DHPLC; HUBER et al. 1993 Down), to identify homologous DNA fragments that contain nucleotide or length variants. We have found that nucleotide site diversity is approximately the same in both species, 5 x 10-4, a value similar to that found for silent sites in other regions of reduced recombination in D. melanogaster (MORIYAMA and POWELL 1996 Down; LANGLEY et al. 2000 Down). There is evidence for some recombinational exchange at this locus, based on the "four gamete test" of HUDSON and KAPLAN 1985 Down. The presence of several intermediate-frequency variants at ankyrin in both species means that it is hard to explain the data on the basis of a selective sweep alone.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila stocks:
We surveyed 38 isofemale lines of D. melanogaster, collected from three different localities. Eighteen lines were collected by M. Noor near Beltsville, Illinois, in 1991; 12 lines by C. Schloetterer near Beltsville, Illinois, in 1994; and 8 lines by M. Kreitman at Terhoon's Farm, Massachusetts, in 1989. For 32 of these lines, we extracted single fourth chromosomes using a y;bw;ciD/eyD marker stock. The extracted lines were made homozygous for either yellow or brown, to facilitate detection of contamination. No contamination was ever found in these homozygous lines. For the remaining 6, the extraction lines were lost, so that single flies from the original isofemale stocks were used in the PCR/DHPLC analyses described below. Thirty-three isofemale lines of D. simulans were surveyed from a single locality. These were originally collected by A. Berry, near Tempe, Arizona, in 1990. Single flies from each line were used for PCR/DHPLC. Stocks were maintained at 18°, on standard yeast-sucrose-cornmeal-agar medium.

Gene region:
We analyzed portions of exons 2 and 4, the whole of exon 3, and the second and third introns of the ankyrin gene in both species (Fig 1). Ankyrin was localized to chromosome 4 of D. melanogaster by DUBREUIL and YU 1994 Down, using a cDNA probe. The introns were identified during the course of PCR amplification of D. melanogaster genomic DNA, using a set of primer pairs designed from the ankyrin cDNA sequence (GenBank accession no. L35601). A primer pair (ANK+38, ANK-275; see below) near the 5' end of the cDNA did not amplify, using a typical protocol designed to amplify 1 kb; we used this pair in a long PCR reaction (Expand Long PCR; Roche Molecular Biochemicals, Indianapolis) and obtained a product of ~6 kb. Upon sequencing (see below), this proved to contain one long (5.4-kb) intron (ankin2), a 108-bp exon (exon3), and a 363-bp intron (ankin3). The complete genomic structure of ankyrin was determined by the Drosophila genome project (gene CG1651; ADAMS et al. 2000 Down) and confirms this structure, except that our annotation compared to the genome project annotation suggests an additional small intron upstream of our region. A correction has been forwarded to Flybase.



View larger version (8K):
In this window
In a new window
Download PPT slide
 
Figure 1. Predicted genomic structure of D. melanogaster ankyrin. The structure is based on Berkeley Drosophila Genome Project accession no. CG1651. Shaded boxes indicate exons; lines indicate introns. Bar indicates region examined in this study.

S. Assimacopoulos kindly verified the chromosomal location of the intron by in situ hybridization to polytene chromosomes, using a HindIII restriction fragment from the long PCR product. The same primer pair amplified the homologous region in D. simulans. This product was a 5-kb fragment, with structure similar to D. melanogaster; in particular, there is one long and one short intron, and exon2 is the same length in the two species.

DNA sequencing:
To sequence the D. melanogaster region, a shotgun sequencing protocol developed by P. Andolfatto was used. Briefly, the 6-kb D. melanogaster product was mechanically sheared, polished, and blunt-end cloned into a derivative of vector pZero (Invitrogen, San Diego). Approximately 30 positive clones were picked for colony PCR, using universal (M13-20 and M13rev) primers. The resulting products were dye-terminator cycle sequenced using a premixed reaction (PE Biosystems/ABI) and sequenced on an automated sequencer (ABI 377). All portions of the region were sequenced at least twice. The same protocol was used on the D. simulans 5-kb product. This yielded four long contigs. To finish the sequencing, the 5-kb product was cut with a six-base blunt-cutting restriction enzyme (DraI) that cut rarely among the contigs. Subcloning and sequencing the resulting fragments provided the missing D. simulans sequence. Ultimately, we obtained 6071 bp of D. melanogaster sequence and 5057 bp of D. simulans sequence (GenBank accession nos. AY054998 and AY054997, respectively). The sequence for D. melanogaster is from line B45 (Terhoon's Farm population). The sequence for D. simulans was obtained from line s52 genomic DNA for the initial shotgun sequencing, and a cloned long PCR product from line s18 was used to fill contig gaps. The nucleotide coordinates used below are such that +1 indicates the first base of intron 2 in our notation.

PCR/DHPLC:
We used DHPLC of DNA fragments (HUBER et al. 1993 Down) to identify nucleotide and length differences between homologous fragments of ankin2-3 among lines. We designed primer pairs from the intron sequence to amplify 150- to 400-bp fragments that together span the entire region (JENSEN 2000 Down). The primer pairs did not perfectly overlap, but no gap was >105 bp for either species. The pairs covered 5296 usable base pairs (i.e., excluding actual gaps between fragments and the primer sequences) in D. melanogaster and 4459 usable base pairs in D. simulans.

Template DNA for the fragment PCRs was generated as follows. Genomic DNA was extracted from a single fly for each isofemale or chromosome-extracted line. This DNA was used as template for a long PCR reaction, using a high-fidelity DNA polymerase (Expand Hi-Fidelity; Roche Molecular Biochemicals). For D. melanogaster lines, the entire ankin2-3 region was amplified using primers ANK+38 (5'-CGCTTGGTGATGTACGAGTTG-3') and ANK-275 (5'-TGTCCACATATCCGTCCTTTG-3'). For the D. simulans lines, only the ankin2 intron was amplified, using simulans-specific primers designed from exons 2 and 3 (sankin1U57, 5'-TAATGGAATGGCTTTAGACAACAA-3'; and sankin1L169, 5'-TATGTCCGATATTTCTCCACAGTC-3'), since not every line would amplify well using the melanogaster primers. This long PCR product was used directly as template for the fragment PCRs for all D. melanogaster lines and 23 of the D. simulans lines. The long PCR product for the remaining D. simulans lines was cloned into the TOPO-4 vector (Invitrogen), according to the manufacturer's protocol. For these lines, we used cloned ankin1 from a plasmid prep as template for the fragment PCRs.

Using PCR product as template for secondary PCR reactions raises the issue of "PCR error," or the occasional incorporation of noncomplementary bases by the thermostable DNA polymerase during PCR amplification, which may result in artifactual variants. This is of particular importance in the study of regions of very low variation like the fourth chromosome. For a high-fidelity polymerase, such as that used to produce ankin1 template here, there is little cause for concern if the PCR product from genomic DNA is used directly as template (for a detailed analysis, see JENSEN 2000 Down). But when cloned PCR product is used as template for a line, there is a distinct possibility that at least one base along its length has been changed by misincorporation. Such spurious variants should always appear as singletons and can thus be identified by checking two different clones derived from the same PCR product. In this study, three singleton variants were found among cloned D. simulans lines, of which two were rejected and one accepted.

DHPLC was used to survey fragments for variants as follows. For each fragment or primer pair, all lines were amplified using ordinary Taq polymerase (QIAGEN, Valencia, CA) in a 25-µl reaction, using 1 µl of 1/100 dilution of the template PCR described above (details are given in JENSEN 2000 Down). One line was chosen as a comparison standard and was amplified to provide 8 µl standard reaction per line. All fragment PCRs were performed with identical primer concentrations and were primer limited. Thus, final product concentrations were approximately equal for all lines. To prepare samples for DHPLC analysis, 8 µl of each PCR reaction was mixed with 8 µl of product from the standard line, heated to 98° for 3 min to denature, and cooled to 65° over 30 min in a thermal cycler. Five microliters of this denatured and reannealed product was passed over the DHPLC column in a solvent gradient and at a temperature determined from the melting characteristics of the fragment. These parameters were determined by using WAVEMaker software (Transgenomic Inc.). UV-absorbance chromatographs for each line were compared with a chromatograph of the unmixed standard reaction that had been subjected to denaturation/reannealing. Chromatographs reveal variants, because their shapes change with the presence of heteroduplex DNA in the sample. If a line contains a variant with respect to the standard line, the mixed PCR reaction will yield approximately one-half heteroduplex DNA, which under appropriate conditions will give a chromatograph that is different in shape from the unmixed standard. If the standard line and the tested line are identical in sequence, most of the DNA will be homoduplex, and the chromatograph will mimic the standard. As this study shows, the technique can unambiguously reveal single base pair substitutions, single base pair insertion-deletions (indels), and longer indels.

When variants appeared among the lines for a fragment, on the basis of a subjective observation of associated chromatograms, lines were assigned a DHPLC variant type number according to the chromatogram shape. When ambiguities arose in chromatogram interpretation, more types were assigned. Generally, slight differences between chromatograms, such as small changes in retention times of absorbance peaks, did not indicate an underlying mutation. Gross changes in chromatograms between fragments, which resulted in differences in numbers of peaks or marked width differences in single peaks, were reliable indicators of underlying sequence differences. In two instances, variant classes with gross chromatogram differences were nevertheless isosequential. It is likely that nonspecific amplification in the PCR reactions led to these results; we did not follow up these cases. Ultimately, only gross differences were scored as separate DHPLC variants. At least three lines were sequenced, if possible, within each DHPLC variant class, including the standard class, using the original fragment PCR reaction as template in a cycle-sequencing reaction. Unsequenced lines within a DHPLC variant class were assumed to contain the same sequence variants as the sequenced members of that class. Most of those fragments whose chromatographs appeared to be the same as the standard for every line were assumed to be monomorphic and were not analyzed further. This is justified by our preliminary data and the fact that no sequence variation was ever found within DHPLC variant classes in polymorphic fragments. Details are given in JENSEN 2000 Down.

It is possible that this survey will not have identified all polymorphisms in the region for these lines. We attempted to minimize the possibility of missing variation by performing DHPLC at multiple column temperatures, when the fragment was predicted to contain several melting regimes (i.e., heterogeneity in GC content); this has been shown to increase the chances of detecting point variation within high-melting-temperature tracts (Transgenomic Inc., personal communication). Representatives of DHPLC classes were sequenced to characterize the underlying sequence changes and to demonstrate the reproducibility of the chromatogram-sequence association within classes. However, it is unlikely that failure to identify a variant would depend on its population frequency, so that the broad conclusions from this study should be little affected by DHPLC inefficiency. On the other hand, there should be no spurious sequence variation introduced by the survey method, since DHPLC variant classes were conservatively assigned and checked by direct sequencing. In fact, this source of error should be reduced relative to direct sequencing alone, since DHPLC and direct sequencing provide independent ways of checking sequence identity.

Evolutionary parameter estimates:
Estimates of evolutionary parameters, including {theta}w [WATTERSON's (1975) estimator of the scaled mutation rate ], the nucleotide site diversity {pi} estimator of {theta} (the mean pairwise difference per base pair; TAJIMA 1983 Down), and TAJIMA's (1989) D statistic for measuring departure of the site frequency spectrum from neutrality, were calculated using either DNAsp (ROZAS and ROZAS 1997 Down) or SITES (HEY and WAKELEY 1997 Down). Estimates of the scaled recombination rate (HUDSON 1987 Down) and FST (WRIGHT 1951 Down) for the D. melanogaster data were calculated with SITES. In addition, Dr. Jeffrey Wall kindly calculated the scaled rate of gene conversion, , on the assumption that all intragenic recombination is caused by gene conversion (FRISSE et al. 2001 Down). Here, Ne is the effective population size, u is the mutation rate per nucleotide site, and c and g are the rates of crossing over and gene conversion per nucleotide, respectively, averaged over males and females.

D. melanogaster-D. simulans sequence alignment:
Relatively long regions of homology are present between the two species, but the region has been subject to many large insertion/deletion events since divergence between the species. This makes the results of typical alignment algorithms unreliable. However, we wished to avoid as much subjective alignment as possible, to get a reasonably unbiased estimate of divergence. We combined alignment by dotplot and the Needleman-Wunsch algorithm (WEIR 1996 Down, Ch. 9), as implemented in the MegAlign program (DNAStar) as follows. We started with a sliding alignment window of 50 bp (chosen to eliminate signals from microsatellite repeats). A window alignment was rejected if the percentage base identity was significantly low in the following sense. The average divergence for noncoding regions between D. melanogaster and D. simulans is 0.061 (MORIYAMA and POWELL 1996 Down), so that a 50-bp region should contain three divergent sites on average. Assuming a Poisson distribution of divergent sites, the probability of eight or more divergent sites in 50 bp is <0.025.

On the basis of this procedure, the dotplot parameters were set to accept a window alignment with 86% identity or better. This resulted in the dotplot in Fig 2; the figure changes little with changes of a few percent similarity in either direction. Each aligned diagonal was passed to the Needleman-Wunsch algorithm, to assign gaps objectively. Excluding gaps, 2195 bp were aligned by this protocol. Further subalignments were performed in the analysis of the HB element insertion (see RESULTS).



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 2. Dotplot alignment of D. melanogaster and D. simulans ankyrin region. Arrow indicates HB-like transposable element (see text for details).

Simulations:
Since it has been suggested that the fourth chromosome of D. melanogaster has undergone a recent selective sweep (BERRY et al. 1991 Down; HILTON et al. 1994 Down), we ask whether our more extensive data set is also compatible with a selective sweep model. Many scenarios involving both strong and weak selection, which include partial sweeps, multiple sweeps, or sweeps with significant recombination, can be devised to explain this or any other data set (GILLESPIE 1997 Down, GILLESPIE 2000 Down; FAY and WU 2000 Down; MCVEAN and CHARLESWORTH 2000 Down). But if we consider only a simple model, we can use simulation techniques to explore the relative likelihoods of the data in a specified context and perhaps restrict the number of possible explanations of the data (see DISCUSSION).

In these simulations, we consider only "catastrophic sweeps" (PERLITZ and STEPHAN 1997 Down) under the following implicit assumptions: (A) Selection is strong relative to mutation, such that no variant arising during the process of fixation of the selected allele is likely to be sampled; (B) selection is strong relative to recombination, such that no sampled allele is likely to have undergone a recombination event during the fixation of the selected allele. Assumption A is quite weak; assumption B is reasonable for the fourth chromosome, despite the evidence of genetic exchange in the data set, since the absence of crossing over on this chromosome suggests that this exchange results mainly from gene conversion, which causes only low levels of recombination over intervals longer than typical genes (see DISCUSSION).

Under these assumptions, a selective sweep completely eliminates variation in a given region. If it is further assumed that evolution proceeds neutrally following the sweep under an infinite-sites model, coalescent techniques could be used to simulate samples drawn from the population. Assume a given time Ts, since the last selective sweep (in units of 2Ne generations), a scaled mutation rate , and a sample of n alleles. Coalescent events can be simulated according to the standard neutral model with constant population size (HUDSON 1990 Down), until the accumulated time is >Ts, at which point the value Ts is assigned to subsequent nodes. This effectively truncates the coalescent at the time of the sweep, creating a star-shaped genealogy. Mutations are added to each branch by sampling from a Poisson distribution with mean ({theta}t/2), where t is the length of the branch in units of 2Ne generations.

The simulations can be used as follows to estimate the likelihood of the pair (S, K), the observed number of segregating sites, and average pairwise difference between alleles for a given pair of sweep parameters ({theta}, Ts). Assume that B samples are generated for each pair of sweep parameters. Write

(1)

where for the jth iteration,

Here, {delta} is a preassigned mesh size for the continuous variable K, and Sj and Kj are the simulated number of segregating sites and mean pairwise difference between alleles for the jth replicate. Following WEISS and VON HAESELER 1998 Down, the likelihood of the sample is approximated by

(2)

In this study, and , where {delta} was chosen to give a fairly smooth likelihood surface. Graphical rendering of the likelihoods was performed with Mathematica 3.0 (Wolfram Research, Champaign, IL).

While it is assumed for the purposes of simulation that recombination is unlikely to have occurred during the substitution of a strongly selected allele, recombination in the genealogy cannot be excluded altogether, on the basis of the evidence contained in the data for both species (see RESULTS). Recombination following a sweep is likely to make significance tests based on the joint distribution of S and K under the above model conservative, since recombination is known to reduce the variance of the distributions of S and K (HUDSON 1990 Down; WALL 1999 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Polymorphism data:
The estimates of the levels of nucleotide polymorphism per site, {theta}, displayed in Table 1, are significantly reduced compared to the published genome-wide averages for D. melanogaster (noncoding average, 0.01) and D. simulans (noncoding average, 0.02; MORIYAMA and POWELL 1996 Down); the significance level (P < 2 x 10-5) was established by neutral coalescent simulations. Pairwise FST values were estimated for the D. melanogaster populations using single nucleotide polymorphisms; the largest value was 0.13. We therefore treated the entire data set as a sample from a single panmictic population.


 
View this table:
In this window
In a new window

 
Table 1. Ankyrin polymorphism statistics

The identities of the polymorphic sites are displayed in Table 2 and Table 3. D. melanogaster polymorphisms were found only in intron 2. D. simulans also had polymorphic nucleotide sites in exon 3 and intron 3; one replacement variant and one silent variant were observed in exon 3, and both are low-frequency sites. D. simulans had 9 biallelic single-nucleotide variants; D. melanogaster had 9 biallelic sites and one tri-allelic site. For the purposes of the simulations, the double-hit site was treated as two singleton sites. Both species also have single-base and short indels segregating. There are 9 indel variants out of 30 total variants for both species pooled. This is not significantly different from the value of 49 indels out of 191 total polymorphisms in noncoding sequences from the su(s) and su(wa) regions in D. melanogaster (LANGLEY et al. 2000 Down) or the value of 11 indels out of 59 total differences between D. melanogaster and D. simulans for the Lcp{psi} pseudogene (PRITCHARD and SCHAEFFER 1997 Down). It therefore seems that indels in relatively unconstrained regions make up ~25% of all variants in Drosophila, which is substantially higher than the ~10% reported for humans (NACHMAN and CROWELL 2000 Down). The intron sequences are AT rich (64 and 69% AT for introns 2 and 3 in D. melanogaster, and 66 and 71% in D. simulans). Repeats were screened for, using a standard program (BENSON 1999 Down). In D. melanogaster, TGAAAAGTA is repeated five times at 1890–1936 and AAGTATGAAAAGCATTTGAA is repeated twice at 1906–1946. There are no tandem repeats in the D. simulans intron sequence, and none of the indel variants are associated with the tandem repeats.


 
View this table:
In this window
In a new window

 
Table 2. D. melanogaster polymorphic sites


 
View this table:
In this window
In a new window

 
Table 3. D. simulans polymorphic sites

No site is polymorphic in both species. Table 4 indicates polymorphic sites that have an identifiably homologous site in the sister species. For each such site, the inferred state of the rare variant is derived. These results are used in relation to the problem of analyzing a sweep with recombination (see DISCUSSION). The data are too sparse to determine whether deletions and insertions differ in their frequencies of occurrence; an excess of deletions has been reported in previous studies (COMERON and KREITMAN 2000 Down).


 
View this table:
In this window
In a new window

 
Table 4. Alignable polymorphic sites

For 3 isofemale D. simulans lines out of the 39 that were initially scanned (Tempe, Arizona lines 32, 52, and 70), long PCR using gDNA template and D. melanogaster primers ANK+38 and ANK-275 amplified a product that approached 10 kb in length. Presumably this represented a transposable element insertion. Since it was quite rare, we chose not to examine these lines further. No such insertion polymorphism was present in the D. melanogaster lines.

Between-species sequence comparisons:
Fig 2 shows the dotplot alignment between the two species of the entire sequenced region. The overall divergence in the ~2 kb of alignable sequence is 12%. However, 1.2 kb of this involves an insertion into intron 2 of both species of a transposable element with high homology to the HB element of D. melanogaster; the element is indicated on the dotplot.

HB is a little-studied member of the P (Drosophila)/Tc (Caenorhabditis elegans) family of transposons and is characterized by a single open reading frame (ORF), flanked by direct repeats and additional DNA and bounded by short terminal inverted repeats (TIRs). The insertions are inverted relative to ankyrin transcription (i.e., the ORF and ankyrin would be transcribed in opposite directions) and are relatively closer to exon 2 in D. simulans than D. melanogaster. In D. melanogaster, HB is inserted into positions 4009–5301, corresponding to positions 226–1635 of the standard sequence of HB (GenBank accession no. X01748). In D. simulans, HB is inserted into positions 182–1774, corresponding to bases 201–1867 of the standard HB sequence.

The variation surveys show that the element is fixed within both species, although it occupies different locations. Nonhomologous DNA flanks both insertions. The divergence between the two elements alone is ~13%, while divergence for homologous DNA excluding HB is ~10%. Table 5 and Table 6 give the pairwise divergence and insertion/deletion data in comparisons with the D. melanogaster HB standard GenBank sequence. The interpretation of these results is considered in the DISCUSSION.


 
View this table:
In this window
In a new window

 
Table 5. Divergences (excluding gaps) among HB-like elements


 
View this table:
In this window
In a new window

 
Table 6. HB-like element degeneration

Recombination estimates:
Using the four-gamete test of HUDSON and KAPLAN 1985 Down, we can infer that at least three recombination events have occurred in both the D. melanogaster and D. simulans lineages. Haplotype networks drawn by the method of BANDELT et al. 1999 Down for the two species are shown in Fig 3 and Fig 4, indicating the positions of homoplasies that are likely to be caused by recombination events. Because the level of polymorphism is so low, it is unlikely that any of the commonly used estimators of scaled recombination rate would give an accurate estimate of the actual parameter (WALL 2000 Down). Hudson's C estimator (HUDSON 1987 Down) is ~6.0 x 10-3/bp for both species. The ratio of C to {theta} for ankyrin is ~10, rather higher than the values typically reported for these species (ANDOLFATTO and PRZEWORSKI 2000 Down), but this may simply reflect the high error variance of the estimates of C. The corresponding estimates of the scaled rate of gene conversion for the entire region, assuming an exponential distribution of conversion tract lengths with a mean of 350 (J. WALL, personal communication), were 5.3 x 10-3/bp and 6.8 x 10-3/bp for D. melanogaster and D. simulans, respectively. The ratios of G to {theta} are ~10; with a mutation rate of ~2 x 10-9 per nucleotide (KEIGHTLEY and EYRE-WALKER 2000 Down), the rate of gene conversion per site in female meiosis is estimated to be ~4 x 10-8/bp. This is two orders of magnitude lower than the value determined experimentally for the rosy locus (HILLIKER and CHOVNICK 1981 Down), suggesting that the rate of gene conversion may be much lower for ankyrin. This should be qualified, however, by the fact that population-based estimates of rates of exchange for other loci in these species are also generally much lower than expected on the basis of laboratory measurements of recombination (ANDOLFATTO and PRZEWORSKI 2000 Down).



View larger version (20K):
In this window
In a new window
Download PPT slide
 
Figure 3. Median-joining haplotype network for the observed D. melanogaster haplotypes. Reticulations arise due to homoplasies that are likely to have been generated by genetic exchange. Nodes are labeled with a strain name possessing the haplotype; node sizes are proportional to the haplotype frequency. Mutating sites are noted along the branches. The network was calculated and rendered with Network3.015 (available at http://www.fluxus-engineering.com; BANDELT et al. 1999 Down).



View larger version (17K):
In this window
In a new window
Download PPT slide
 
Figure 4. Median-joining haplotype network for the observed D. simulans haplotypes.

Simulation results:
The results of the simulations of catastrophic sweeps (see MATERIALS AND METHODS) are summarized in Fig 5 and Fig 6. All the single nucleotide polymorphisms were used for the observed results. The shading in the log-likelihood plots indicates their differences of the log-likelihoods of the observed S and K values from the maximum log-likelihood found in the simulations. Each cell corresponds to 50,000 iterates of the modified coalescent, using the underlying {theta} and Ts indicated on the axes. It can be seen that likelihoods within 2 or 3 support units are found only for very low values of the underlying {theta} and relatively large values of the time Ts since the assumed sweep. The results show that there is a band of probable {theta} values that is relatively unchanging with possible sweep times and that the genome-wide average {theta} values of the order of 1% (see above) for noncoding sites are well outside this band for both species. In other words, the data indicate that, even under the assumption of a recent sweep, the underlying equilibrium diversity for the ankyrin region must be much lower than the standard value for silent sites, so that some other force or forces must have acted to reduce variation. In addition, the simulations allow the most recent sweep times to be rejected at the 5% level or better.



View larger version (85K):
In this window
In a new window
Download PPT slide
 
Figure 5. Likelihood plot, D. melanogaster ankyrin intron simulation. Observed data are S = 10, K = 2.75, n = 38. Contours are shaded according to log-likelihood relative to the maximum (black-shaded cell). See text for details.



View larger version (92K):
In this window
In a new window
Download PPT slide
 
Figure 6. Likelihood plot, D. simulans ankyrin intron simulation. Observed data are S = 9, K = 1.72, n = 33. Shading as in Fig 5.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Reduced variability at ankyrin:
Our results are consistent with the previous findings of low sequence variability at the chromosome 4 locus ciD in D. melanogaster and its close relatives (BERRY et al. 1991 Down; HILTON et al. 1994 Down). Our data on ankyrin suggest that per nucleotide site variability at ankyrin is reduced at least 20-fold compared to the mean value for genes in regions of normal recombination (Table 1). Chromosome 4 is achiasmate and shows little or no crossing over in D. melanogaster under normal conditions (ASHBURNER 1989 Down, Chap. 11; HAWLEY et al. 1993 Down), so that this lack of variability is in agreement with the general pattern of a correlation between the local recombination rate experienced by a gene and its level of sequence variability, observed in D. melanogaster (AGUADE and LANGLEY 1994 Down; AQUADRO et al. 1994 Down) and, increasingly, in other taxa including humans (CHARLESWORTH and CHARLESWORTH 1998 Down; NACHMAN 2001 Down). There is no evidence for an unusually low level of silent site divergence between D. melanogaster and D. simulans for ankyrin; in fact, the silent site divergence for ankyrin is about twice the mean value given by MORIYAMA and POWELL 1996 Down. This excludes the possibility that recombination is mutagenic, leading to reduced variation in regions on chromosome 4 because of lower mutational input, in agreement with previous studies (BEGUN and AQUADRO 1992 Down; AGUADE and LANGLEY 1994 Down). However, some recent results (W. WANG, K. THORNTON, A. BERRY and M. LONG, personal communication) indicate that variability in another region of chromosome 4 is much higher than that at ankyrin and ciD, possibly suggesting the action of balancing selection. Some recombination must be occurring on chromosome 4 if these observations are to be reconciled. As discussed below, we have direct evidence that this is the case.

Recombination and linkage disequilibrium:
As described in RESULTS, the sequence data displayed in Table 2 and Table 3 and Fig 3 and Fig 4 show evidence for recombination events in both D. melanogaster and D. simulans, if we assume that the variants concerned represent unique mutations (HUDSON and KAPLAN 1985 Down). This is consistent with other evidence from surveys of natural polymorphisms in Drosophila, which indicate the occurrence of recombination events even in regions where crossing over is very infrequent (ANDOLFATTO and NORDBORG 1998 Down; LANGLEY et al. 2000 Down). Given the achiasmate behavior of chromosome 4 at meiosis (HAWLEY et al. 1993 Down), these events most likely involve gene conversion rather than reciprocal exchange, although the DNA sequence data do not distinguish between the two. This is consistent with the interpretation of early recombination nodules in female meiosis as precursors of both types of recombination event and the fact that these are just as frequent in regions where crossing over is suppressed as in regions with normal frequencies of crossing over (ZICKLER and KLECKNER 1999 Down). This suggests that gene conversion may occur on the fourth chromosome and at the tips and bases of the major chromosomes.

A difficulty with this interpretation is that we find high levels of linkage disequilibrium between very distant sites, in contrast to what is found for the su(s) and su(wa) loci at the tip of the X chromosome, for which it has been suggested that gene conversion is the major factor involved in reducing linkage disequilibrium between sites within genes (LANGLEY et al. 2000 Down). Given that mean meiotic conversion tract lengths are thought to be of the order of 350 bp (HILLIKER et al. 1994 Down), sites at opposite ends of ankyrin should experience recombination due to gene conversion at maximal rates, yet inspection of Table 2 and Table 3 shows several examples of complete or nearly complete linkage disequilibrium for pairs of sites >4 kb apart. For example, the squared correlation between sites 896 and 5366 in D. melanogaster is 0.89. It is possible that this simply reflects the lower level of variation at ankyrin compared to these loci [0.5 x 10-4 as opposed to an average of >10-3 for su(s) and su(wa)]. Since the effect of gene conversion on the expected magnitude of linkage disequilibrium depends on the product of 4Ne and the associated recombination parameter (ANDOLFATTO and NORDBORG 1998 Down), the lower Ne associated with its lower level of variation may cause linkage disequilibrium to extend over a larger distance at ankyrin than at the X chromosomal loci. For example, even if the rate of recombination per base pair due to gene conversion were as high as 10-6 at ankyrin, an Ne of 50,000 (consistent with the 20-fold reduction in variability at ankyrin) would yield an expected value of the squared correlation between sites of , consistent with the observed high values.

Causes of reduced variability at ankyrin:
As discussed above, it is likely that some form of hitchhiking effect of selection on variability at linked sites has resulted in the observed pattern of reduced variation at ankyrin. One aim of this study was to attempt to discriminate between alternative versions of hitchhiking (see the Introduction). Table 1 gives no evidence for a significantly negative Tajima's D statistic (TAJIMA 1989 Down) for ankyrin (indeed, D is even positive in D. melanogaster), so that there is no evidence for the distorted nucleotide site frequency spectrum expected if there had been a sufficiently recent selective sweep to reduce variation to the observed extent (BRAVERMAN et al. 1995 Down; SIMONSEN et al. 1995 Down). In addition, the likelihood analyses described above are apparently inconsistent with a selective sweep as the explanation for the severely reduced variability that we observe (see Fig 5 and Fig 6). There are, however, some difficulties in accepting this conclusion at face value. First, this study has uncovered evidence of some genetic exchange within the ankyrin locus (see above), so that it is appropriate to examine the possibility that there was a selective sweep with some recombination during the sweep. FAY and WU 2000 Down pointed out that a selective sweep in regions with recombination can lead to a distinctive frequency spectrum of derived variants, in which a portion of the presweep variants are sent to a band of low frequencies, because of their assocation with the allele that is eliminated from the population; another portion is sent to near fixation, as a result of preexisting variants recombining onto the haplotype that is destined for fixation. This process is, however, inconsistent with the intermediate-frequency-derived variants that we observe (for a detailed analysis, see JENSEN 2000 Down).

Furthermore, if there has been a sweep with recombination, this implies that we must assume that the time since the sweep (Ts) is nonzero. Suppose that we observe a sample and assume that it is the result of a sweep with zero recombination, as in our simulations. If there was in fact some recombination, some of the low frequency variants in the sample may be presweep variants that remained on the portion of the genealogy that recombined onto the selectively favorable allele; the remaining part of the sample represents the portion of the genealogy that was swept clean of its preexisting variation by the spread of the favorable allele (see Fig 2 of FAY and WU 2000 Down) and hence is equivalent to a truncated coalescent with no recombination. From the above argument, the "extra" presweep variants must be present at low frequencies in the sample and lead to an overestimate of the number of postsweep segregating sites, for a given Ts. It is, therefore, less likely that a null model of a selective sweep would be rejected by the likelihood method assuming a truncated coalescent, on the basis of a given neutral value of {theta}, making it more difficult to obtain the results shown in Fig 5 and Fig 6. This means that the zero-recombination assumption is in fact conservative for our purposes.

The other problem with the tests for a selective sweep is our assumption of a constant postsweep population size in testing for the effects of a sweep. There is accumulating evidence that frequency spectra in non-African populations of both D. simulans and D. melanogaster may be distorted as a result of demographic effects, such as recent population bottlenecks associated with colonization events (LANGLEY et al. 2000 Down; PRZEWORSKI et al. 2001 Down). While the values of statistics such as Tajima's D when averaged over loci tend to be close to neutral expectation (PRZEWORSKI et al. 2001 Down), the stochastic nature of bottleneck effects means that different loci may be affected in different ways, which makes it difficult to conduct tests on a single locus that take account of bottlenecks. We note, however, that the absence of a strong reduction in variability at autosomal loci in non-African populations compared with African populations (ANDOLFATTO 2001 Down) suggests that any bottlenecks must have been only partial. With the approximately star-shaped phylogeny expected from a recent sweep, a partial bottleneck that occurred after the sweep, and that was then followed by almost instantaneous population expansion, could have the effect of causing some of the lineages that survived the bottleneck to be represented multiple times in the sample, so that any variants that they had acquired prior to the bottleneck would be represented at intermediate frequencies. This is qualitatively consistent with the data in Table 2 and Table 3. But it is unclear on the basis of this hypothesis why such distortions toward intermediate frequencies are not detected more often at loci in regions of normal recombination (PRZEWORSKI et al. 2001 Down). A study of a sample from an African population, which would be more likely to be close to equilibrium, would help to test the bottleneck hypothesis.

Alternatives to a selective sweep:
Overall, our analysis suggests that the reduction in diversity on chromosome 4 in D. melanogaster and D. simulans is unlikely to have been caused by a selective sweep involving strong selection, unless the sweep was followed by a recent and partial population bottleneck. It is difficult to discriminate among other alternative hypotheses that might explain the reduced variability. GILLESPIE 1994 Down, GILLESPIE 1997 Down studied several models of temporally fluctuating selection coefficients, in terms of their effects on neutral variability at closely linked sites. His results suggest that the only process capable of producing the magnitude of reduction in variability that we have observed for chromosome 4 is the TIM model (TAKAHATA et al. 1975 Down). This involves temporal variation in selection coefficients without any component of balancing selection, such that a mutation eventually becomes fixed or lost over a timescale that is substantially shorter than the coalescent time but much longer than the time assumed in the catastrophic sweep model considered above. It causes only a moderate distortion of the allele frequency spectrum at linked neutral sites (GILLESPIE 1997 Down), consistent with our observations.

The other possibilities are background selection (CHARLESWORTH et al. 1993 Down) and Hill-Robertson interference between weakly selected sites (MCVEAN and CHARLESWORTH 2000 Down). Both of these can produce substantial reductions in variation in regions where recombination is greatly reduced. However, there is evidence that selection on silent sites is currently essentially absent in D. melanogaster (AKASHI 1996 Down; MCVEAN and VIEIRA 2001 Down), so it seems unlikely that weak Hill-Robertson effects can cause reduced variability in this species.

As far as background selection is concerned, it can produce reductions in variation without significantly skewing the sample frequency spectra at neutral sites, although it may produce a spectrum skewed in favor of rare variants if selection is very weak (HUDSON and KAPLAN 1994 Down; CHARLESWORTH et al. 1995 Down). The detection of significant negative skews in regions of reduced recombination is therefore not conclusive evidence for selective sweeps, as is sometimes stated (LANGLEY et al. 2000 Down). As argued by CHARLESWORTH 1996 Down, the most important source of background selection for a small region of low recombination, like chromosome 4, is likely to be weak selection against transposable elements. The available population data on transposable elements in D. melanogaster are consistent with most element families being maintained by an approximate balance between transposition and selection (CHARLESWORTH et al. 1992A Down, CHARLESWORTH et al. 1992B Down). Under such a balance, the mean selection coefficient against an element insertion must be equal to the transposition rate, which is typically of the order of 10-4 (MASIDE et al. 2000 Down), so that the selection concerned is weak but much stronger than the reciprocal of the effective population size. This means that it is reasonable to treat the effect of transposable elements in the same way as deleterious mutations at equilibrium under mutation and selection. In the absence of recombination, this implies that neutral variability on chromosome 4 should be reduced below neutral expectation by a factor of exp(-n), where n is the mean number of elements per fourth chromosome (CHARLESWORTH 1996 Down). Data on D. melanogaster suggest a conservative estimate of at least 6.4 for n (CHARLESWORTH et al. 1992B Down), so that the observed level of variability is >10-fold greater than predicted by this formulation. Element abundances in D. simulans are generally ~3-fold lower than in D. melanogaster (BIEMONT and CIZERON 1999 Down), and preliminary data on our population sample indicate a correspondingly low copy number on chromosome 4 (M. BOULESTEIX and X. MASIDE, unpublished data). A copy number of around two to three per fourth chromosome would be, in fact, quite consistent with our observations. Since element abundances can change rather quickly over evolutionary time (MASIDE et al. 2000 Down), it is possible that the high chromosome 4 copy number in D. melanogaster represents a recent situation and that neutral variability has not yet equilibrated to the effective population size corresponding to this copy number. This is supported by data suggesting lower mean transposable element copy numbers in African compared with non-African populations of D. melanogaster (BIEMONT et al. 2001 Down).

History of the HB-related element insertion:
The results described above show that the samples from both D. melanogaster and D. simulans are fixed for a copy of the transposable element HB (BRIERLY and POTTER 1985 Down; HARRIS et al. 1988 Down; HENIKOFF 1992 Down). In addition, we detected a probable transposable element insertion at a frequency of 9.1% in D. simulans. The difference between the two species in the location of HB implies that either a single insertion of HB into intron 2 occurred in the ancestral population, followed by a short-distance transposition that shifted its location in one or the other population after isolation, or that species-specific HB-like elements inserted in each lineage independently, after isolation. The second of these possibilities seems more likely, for the following reasons.

First, note that the pairwise divergences in Table 5 (standard melanogaster HB/simulans insertion, standard HB/melanogaster insertion, and simulans/melanogaster) are approximately equal and rather large (~13%). This suggests that the most recent common ancestor of the two ankyrin insertions is a relatively distant ancestor of all three elements, since otherwise we would expect at least one of the distances of HB/simulans or HB/melanogaster to be significantly less than the divergence between the species. If this is the case, it is likely that species-specific members of the HB family were responsible for the insertions; i.e., that separate insertion events were involved. Also, the divergence between the melanogaster and simulans insertions is significantly greater than the divergence between the remaining homologous DNA in the region, which is inconsistent with a single insertion diverging at the same rate as the flanking DNA, if the mutation rate is uniform across the region.

More evidence for species-specific insertions is provided by the state of degeneration of the insertions. Table 6 shows that the D. melanogaster insertion has experienced eight deletions and an insertion with respect to the standard HB sequence, but that the D. simulans insertion has not experienced such events; three of these events involve the HB ORF. The D. melanogaster insertion also lacks any trace of the HB terminal inverted repeats. The D. simulans insertion, on the other hand, contains an entire ORF, with only a single nonsense mutation, and retains nearly intact TIRs. This may reflect much more recent fixation of the element at this location in D. simulans.

Overall, therefore, the data suggest that two independent insertions of HB occurred in the two species, into the ankyrin intron 2. Together with the relatively high frequency of another element in D. simulans, this is a very striking observation. Transposable element frequencies in D. melanogaster populations at individual chromosomal sites are almost universally low, except in proximal portions of the chromosome arms where recombination is greatly restricted (CHARLESWORTH et al. 1992A Down, CHARLESWORTH et al. 1992B Down; BIEMONT et al. 1997 Down); however, even on chromosome 4, fixation of elements is uncommon (CHARLESWORTH et al. 1992B Down). Element abundance is generally lower in D. simulans and some cases of apparent fixation (at the level of polytene chromosome bands, rather than nucleotide sites) have been reported (BIEMONT et al. 1997 Down). The fixation of HB in the ankyrin intron is consistent with the pattern of an accumulation of elements in regions where crossing over is highly suppressed (CHARLESWORTH et al. 1992A Down, CHARLESWORTH et al. 1992B Down); the large size of this intron is due in part to the presence of this insertion and conforms to the general pattern of larger than average introns in regions of reduced crossing (COMERON and KREITMAN 2000 Down), although there is no evidence that this pattern usually involves transposable element insertions (COMERON and KREITMAN 2000 Down). It is interesting to note that the large introns of the Y chromosomal male fertility genes of D. hydei also contain large numbers of transposable elements, as well as satellite sequences (HACKSTEIN and HOCHSTENBACH 1995 Down; REUGELS et al. 2000 Down). Population genetic mechanisms for the accumulation of repetitive DNA in regions of restricted crossing over have been discussed in the literature (CHARLESWORTH et al. 1994 Down). The fixation of HB in ankyrin is thus consistent with this wider pattern of genome evolution.


*  FOOTNOTES

1 Present address: Department of Microbiology, University of Washington School of Medicine, Seattle, WA 98195-8070. Back


*  ACKNOWLEDGMENTS

We thank R. R. Hudson for help with the simulation methodology; C. Bergman, J. Comerón, J. Fay, C.-I Wu, and G. Wyckoff for stimulating discussions that improved this work; D. Guttman for expert advice and training; and M. Long and K. H. Jensen for generous support. P. Oefner, P. Underhill, T. Morton, and Transgenomic, Inc. provided invaluable help with DHLPC. J. Wall kindly analyzed our data using his program for estimating gene conversion rates. We also thank two anonymous reviewers for their comments. This work was supported by a National Institutes of Health Genetics and Regulation Training Grant predoctoral fellowship and a National Science Foundation doctoral dissertation improvement grant DEB-9701114 to M.A.J. B.C. is supported by the Royal Society.

Manuscript received June 6, 2001; Accepted for publication October 23, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000  The genome sequence of Drosophila melanogaster. Science 287:2185-2195[Abstract/Free Full Text].

AGUADÉ, M., and C. H. LANGLEY, 1994 Polymorphism and divergence in regions of low recombination in Drosophila, pp. 67–76 in Non-neutral Evolution: Theories and Molecular Data, edited by B. GOLDING. Chapman & Hall, London.

AGUADÉ, M., N. MIYASHITA, and C. H. LANGLEY, 1989  Reduced variation in the yellow-achaete-scute region in natural populations of Drosophila melanogaster. Genetics 122:607-615[Abstract/Free Full Text].

AGUADÉ, M., W. MEYERS, A. D. LONG, and C. H. LANGLEY, 1994  Single-strand conformation polymorphism analysis coupled with stratified DNA sequencing reveals reduced sequence variation in the su(s) and su(wa) regions of the Drosophila melanogaster X chromosome. Proc. Natl. Acad. Sci. USA 91:4658-4662[Abstract/Free Full Text].

AKASHI, H., 1996  Molecular evolution between Drosophila melanogaster and D. simulans: reduced codon bias, faster rates of amino-acid substitution, and larger proteins in D. melanogaster.. Genetics 144:1297-1307[Abstract].

ANDOLFATTO, P., 2001  Contrasting patterns of X-linked and autosomal nucleotide variation in Drosophila melanogaster and D. simulans.. Mol. Biol. Evol. 18:279-290[Abstract/Free Full Text].

ANDOLFATTO, P. and M. NORDBORG, 1998  The effect of gene conversion on intralocus associations. Genetics 148:1397-1399[Free Full Text].

ANDOLFATTO, P. and M. PRZEWORSKI, 2000  A genome-wide departure from the standard neutral model in natural populations of Drosophila. Genetics 156:257-268[Abstract/Free Full Text].

ANDOLFATTO, P. and M. PRZEWORSKI, 2001  Regions of lower crossing over harbor more rare variants in African populations of Drosophila melanogaster. Genetics 158:657-665[Abstract/Free Full Text].

AQUADRO, C. F., D. J. BEGUN and E. C. KINDAHL, 1994 Selection, recombination and DNA polymorphism in Drosophila, pp. 46–56 in Non-neutral Evolution: Theories and Molecular Data, edited by B. GOLDING. Chapman & Hall, New York.

ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BANDELT, H. J., P. FORSTER, and A. ROHL, 1999  Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16:37-48[Abstract].

BARTON, N. H., 1998  The effect of hitch-hiking on neutral genealogies. Genet. Res. 72:123-133.

BARTON, N. H., 2000  Genetic hitchhiking. Philos. Trans. R. Soc. Lond. B 355:1553-1562[Abstract/Free Full Text].

BEGUN, D. J. and C. F. AQUADRO, 1992  Levels of naturally occurring DNA polymorphism correlate with recombination rates in D. melanogaster.. Nature 356:519-520[Medline].

BENSON, G., 1999  Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27:573-580[Abstract/Free Full Text].

BERRY, A. J., J. W. AJIOKA, and M. KREITMAN, 1991  Lack of polymorphism on the Drosophila fourth chromosome resulting from selection. Genetics 129:1111-1117[Abstract].

BIÉMONT, C. and G. CIZERON, 1999  Distribution of transposable elements in Drosophila species. Genetica 105:43-62[Medline].

BIÉMONT, C., C. VIEIRA, C. HOOGLAND, G. CIZERON, and C. LOEVENBRUCK et al., 1997  Maintenance of transposable element copy number in natural populations of Drosophila melanogaster and D. simulans. Genetica 100:161-166[Medline].

BIÉMONT, C., N. BORIE and C. VIEIRA, 2001 Transposable elements and genome evolution in Drosophila melanogaster and D. simulans. Abstract of the 17th European Drosophila Research Conference, September 2001, Edinburgh.

BRAVERMAN, J. M., R. R. HUDSON, N. L. KAPLAN, C. H. LANGLEY, and W. STEPHAN, 1995  The hitchhiking effect on the site frequency spectrum of DNA polymorphisms. Genetics 140:783-796[Abstract].

BRIERLY, H. L. and S. S. POTTER, 1985  Distinct characteristics of loop sequences of two Drosophila foldback transposable elements. Nucleic Acids Res. 13:485-500[Abstract/Free Full Text].

CHARLESWORTH, B., 1996  Background selection and patterns of genetic diversity in Drosophila melanogaster.. Genet. Res. 68:131-149[Medline].

CHARLESWORTH, B., A. LAPID, and D. CANADA, 1992a  The distribution of transposable elements within and between chromosomes in a population of Drosophila melanogaster. I. Element frequencies and distribution. Genet. Res. 60:103-114[Medline].

CHARLESWORTH, B., A. LAPID, and D. CANADA, 1992b  The distribution of transposable elements within and between chromosomes in a population of Drosophila melanogaster. II. Inferences on the nature of selection against elements. Genet. Res. 60:115-130[Medline].

CHARLESWORTH, B., M. T. MORGAN, and D. CHARLESWORTH, 1993  The effect of deleterious mutations on neutral molecular variation. Genetics 134:1289-1303[Abstract].

CHARLESWORTH, B., P. SNIEGOWSKI, and W. STEPHAN, 1994  The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371:215-220[Medline].

CHARLESWORTH, D. and B. CHARLESWORTH, 1998  Sequence variation: looking for effects of genetic linkage. Curr. Biol. 8:R658-R661[Medline].

CHARLESWORTH, D., B. CHARLESWORTH, and M. T. MORGAN, 1995  The pattern of neutral molecular variation under the background selection model. Genetics 141:1619-1632[Abstract].

COMERÓN, J. M. and M. KREITMAN, 2000  The correlation between intron length and recombination in Drosophila. Dynamic equilibrium between mutational and selective forces. Genetics 156:1175-1190[Abstract/Free Full Text].

COMERÓN, J. M., M. KREITMAN, and M. AGUADÉ, 1999  Natural selection on synonymous sites is correlated with gene length and recombination in Drosophila. Genetics 151:239-249[Abstract/Free Full Text].

DUBREUIL, R. R. and J.-Q. YU, 1994  Ankyrin and beta-spectrin accumulate independently of alpha-spectrin in Drosophila. Proc. Natl. Acad. Sci. USA 91:10285-10289[Abstract/Free Full Text].

FAY, J. C. and C.-I WU, 2000  Hitchhiking under positive Darwinian selection. Genetics 155:1405-1413[Abstract/Free Full Text].

FRISSE, L., R. R. HUDSON, A. BARTOSZEWICZ, J. D. WALL, and J. DONFACK et al., 2001  Gene conversion and different population histories may explain the contrast between polymorphism and linkage disequilibrium levels. Am. J. Hum. Genet. 69:831-843[Medline].

FU, Y. X., 1997  Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147:915-925[Abstract].

GILLESPIE, J. H., 1994 Alternatives to the neutral theory, pp. 1–17 in Non-neutral Evolution: Theories and Molecular Data, edited by B. GOLDING. Chapman & Hall, New York.

GILLESPIE, J. H., 1997  Junk ain't what junk does: neutral alleles in a selected context. Gene 205:291-299[Medline].

GILLESPIE, J. H., 2000  Genetic drift in an infinite population. The pseudohitchhiking model. Genetics 155:909-919[Abstract/Free Full Text].

HACKSTEIN, J. H. and R. HOCHSTENBACH, 1995  The elusive fertility genes of Drosophila: the ultimate haven for selfish genetic elements. Trends Genet. 11:195-200[Medline].

HARRIS, L. J., D. L. BAILLIE, and A. M. ROSE, 1988  Sequence identity between an inverted repeat family of transposable elements in Drosophila and Caenorhabditis. Nucleic Acids Res. 16:5991-5998[Abstract/Free Full Text].

HAWLEY, R. S., K. S. MCKIM, and T. ARBEL, 1993  Meiotic segregation in Drosophila melanogaster females, mechanisms and myths. Annu. Rev. Genet. 27:282-317.

HENIKOFF, S., 1992  Detection of Caenorhabditis transposon homologs in diverse organisms. New Biol. 4:382-388[Medline].

HEY, J. and J. WAKELEY, 1997  A coalescent estimator of the population recombination rate. Genetics 145:833-846[Abstract].

HILLIKER, A. J. and A. CHOVNICK, 1981  Further observations on intragenic recombination in Drosophila melanogaster.. Genet. Res. 38:281-296[Medline].

HILLIKER, A. J., G. HARAUZ, A. G. REAUME, M. GRAY, and S. H. CLARK et al., 1994  Meiotic gene conversion tract length distribution within the rosy locus of Drosophila melanogaster.. Genetics 137:1019-1026[Abstract].

HILTON, H., R. M. KLIMAN, and J. HEY, 1994  Using hitchhiking genes to study adaptation and divergence during speciation within the Drosophila melanogaster species complex. Evolution 48:1900-1913.

HOCHMAN, B., 1976 The fourth chromosome of Drosophila melanogaster, pp. 903–928 in The Genetics and Biology of Drosophila, Vol. 1b, edited by M. ASHBURNER and E. NOVITSKI. Academic Press, New York.

HUBER, C. G., P. J. OEFNER, E. PREUSS, and G. K. BONN, 1993  High-resolution liquid chromatography of DNA fragments on non-porous poly(styrene-divinylbenzene) particles. Nucleic Acids Res. 21:1061-1066[Abstract/Free Full Text].

HUDSON, R. R., 1987  Estimating the recombination parameter of a finite population model without selection. Genet. Res. 50:245-250[Medline].

HUDSON, R. R., 1990 Gene genealogies and the coalescent process, pp. 1–44 in Oxford Surveys in Evolutionary Biology, Vol. 7, edited by D. FUTUYMA and J. ANTONOVICS. Oxford University Press, New York.

HUDSON, R. R. and N. L. KAPLAN, 1985  Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164[Abstract/Free Full Text].

HUDSON, R. R., and N. L. KAPLAN, 1994 Gene trees with background selection, pp. 140–153 in Non-neutral Evolution: Theories and Molecular Data, edited by B. GOLDING. Chapman & Hall, New York.

HUDSON, R. R. and N. L. KAPLAN, 1995  Deleterious background selection with recombination. Genetics 141:1605-1617[Abstract].

JENSEN, M. A., 2000 Population genetics investigations in Drosophila and Saccharomyces. Ph.D Dissertation, University of Chicago, Chicago.

KAPLAN, N. L., R. R. HUDSON, and C. H. LANGLEY, 1989  The "hitchhiking effect" revisited. Genetics 123:887-899[Abstract/Free Full Text].

KEIGHTLEY, P. D. and A. EYRE-WALKER, 2000  Deleterious mutations and the evolution of sex. Science 290:331-333[Abstract/Free Full Text].

LANGLEY, C. H., B. P. LAZZARO, W. PHILLIPS, E. HEIKKINEN, and J. M. BRAVERMAN, 2000  Linkage disequilibria and the site frequency spectra in the su(s) and su(w(a)) regions of the Drosophila melanogaster X chromosome. Genetics 156:1837-1852[Abstract/Free Full Text].

MASIDE, X., S. ASSIMACOPOULOS, and B. CHARLESWORTH, 2000  Rates of movement of transposable elements on the second chromosome of Drosophila melanogaster. Genet. Res. 75:275-284[Medline].

MAYNARD-SMITH, J. and J. HAIGH, 1974  The hitch-hiking effect of a favourable gene. Genet. Res. 23:23-35[Medline].

MCVEAN, G. A. T. and B. CHARLESWORTH, 2000  The effects of Hill-Robertson interference between weakly selected sites on patterns of molecular evolution and variation. Genetics 155:929-944[Abstract/Free Full Text].

MCVEAN, G. A. T. and J. VIEIRA, 2001  Inferring parameters of mutation, selection and demography from patterns of synonymous site evolution in Drosophila. Genetics 157:245-257[Abstract/Free Full Text].

MORIYAMA, E. N. and J. R. POWELL, 1996  Intraspecific nuclear DNA variation in Drosophila. Mol. Biol. Evol. 13:261-277[Abstract].

NACHMAN, M. W., 2001  Single nucleotide polymorphisms and recombination rate in humans. Trends Genet. 17:481-484[Medline].

NACHMAN, M. W. and S. L. CROWELL, 2000  Estimate of the mutation rate per nucleotide in humans. Genetics 156:297-304[Abstract/Free Full Text].

PERLITZ, M. and W. STEPHAN, 1997  The mean and variance of the number of segregating sites since the last hitchhiking event. J. Math. Biol. 36:1-23[Medline].

PRITCHARD, J. K. and S. W. SCHAEFFER, 1997  Polymorphism and divergence at a Drosophila pseudogene locus. Genetics 147:199-208[Abstract].

PRZEWORSKI, M., J. D. WALL, and P. ANDOLFATTO, 2001  Recombination and the frequency spectrum in Drosophila melanogaster and D. simulans. Mol. Biol. Evol. 18:291-298[Abstract/Free Full Text].

REUGELS, A. M., R. KUREK, U. LAMMERMANN, and H. BÜNEMANN, 2000  Mega-introns in the dynein gene DhDhc7(Y) on the heterochromatic Y chromosome give rise to the giant threads loops in primary spermatocytes of Drosophila hydei. Genetics 154:759-769[Abstract/Free Full Text].

ROZAS, M. and R. ROZAS, 1997  DnaSP version 2.0: a novel software package for extensive molecular population genetics analysis. Comput. Appl. Biosci. 13:307-311.

SIMONSEN, K. L., G. A. CHURCHILL, and C. F. AQUADRO, 1995  Properties of statistical tests on neutrality of DNA polymorphism data. Genetics 141:413-429[Abstract].

STEPHAN, W., 1995  An improved method for estimating the rate of fixation of favorable mutations based on DNA polymorphism data. Mol. Biol Evol. 12:959-962[Medline].

STEPHAN, W., T. H. E. WIEHE, and M. W. LENZ, 1992  The effect of strongly selected substitutions on neutral polymorphism: analytical results based on diffusion theory. Theor. Popul. Biol. 41:237-254.

STURTEVANT, A. H., 1951  A map of the fourth chromosome of Drosophila melanogaster, based on crossing over in triploid females. Proc. Natl. Acad. Sci. USA 37:405-407[Free Full Text].

TAJIMA, F., 1983  Evolutionary relationship of DNA sequences in finite populations. Genetics 105:437-460[Abstract/Free Full Text].

TAJIMA, F., 1989  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595[Abstract/Free Full Text].

TAKAHATA, N., K. ISHII, and H. MATSUDA, 1975  Effect of temporal fluctuation of selection coefficient on gene frequency in a population. Proc. Natl. Acad. Sci. USA 72:4541-4545[Abstract/Free Full Text].

WALL, J. D., 1999  Recombination and the power of statistical tests of neutrality. Genet. Res. 74:65-80.

WALL, J. D., 2000  A comparison of estimators of the population recombination rate. Mol. Biol. Evol. 17:156-163[Abstract/Free Full Text].

WATTERSON, G. A., 1975  On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 10:256-276.

WEIR, B. S., 1996 Genetic Data Analysis II. Sinauer Associates, Sunderland, MA.

WEISS, G. and A. VON HAESELER, 1998  Inference of population history using a likelihood approach. Genetics 149:1539-1546[Abstract/Free Full Text].

WIEHE, T. H. E. and W. STEPHAN, 1993  Analysis of a genetic hitchhiking model, and its application to DNA polymorphism data from Drosophila melanogaster. Mol. Biol. Evol. 10:842-854[Abstract].

WRIGHT, S., 1951  The genetical structure of populations. Ann. Eugen. 15:323-354.

ZICKLER, D. and N. KLECKNER, 1999  Meiotic chromosomes: integrating structure and function. Annu. Rev. Genet. 33:603-754[Medline].




This article has been cited by other articles:


Home page
Biol LettHome page
P. R Haddrill, F. M Waldron, and B. Charlesworth
Elevated levels of expression associated with regions of the Drosophila genome that lack crossing over
Biol Lett, December 23, 2008; 4(6): 758 - 761.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. J. Kulathinal, S. M. Bennett, C. L. Fitzpatrick, and M. A. F. Noor
Fine-scale mapping of recombination rate in Drosophila refines its correlation to diversity and divergence
PNAS, July 22, 2008; 105(29): 10051 - 10056.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Kawabe, A. Forrest, S. I. Wright, and D. Charlesworth
High DNA Sequence Diversity in Pericentromeric Genes of the Plant Arabidopsis lyrata
Genetics, June 1, 2008; 179(2): 985 - 995.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
P. Andolfatto
Hitchhiking effects of recurrent beneficial amino acid substitutions in the Drosophila melanogaster genome
Genome Res., December 1, 2007; 17(12): 1755 - 1762.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Loewe and B. Charlesworth
Background Selection in Single Genes May Explain Patterns of Codon Bias
Genetics, March 1, 2007; 175(3): 1381 - 1393.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. I. Wright, J. P. Foxe, L. DeRose-Wilson, A. Kawabe, M. Looseley, B. S. Gaut, and D. Charlesworth
Testing for Effects of Recombination Rate on Nucleotide Diversity in Natural Populations of Arabidopsis lyrata
Genetics, November 1, 2006; 174(3): 1421 - 1430.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. Khan, U. Bohme, K. A. Kelly, E. Adlem, K. Brooks, M. Simmonds, K. Mungall, M. A. Quail, C. Arrowsmith, T. Chillingworth, et al.
Common inheritance of chromosome Ia associated with clonal expansion of Toxoplasma gondii
Genome Res., September 1, 2006; 16(9): 1119 - 1125.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Hagenblad, J. Bechsgaard, and D. Charlesworth
Linkage Disequilibrium Between Incompatibility Locus Region Genes in the Plant Arabidopsis lyrata
Genetics, June 1, 2006; 173(2): 1057 - 1073.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. M. Braverman, B. P. Lazzaro, M. Aguade, and C. H. Langley
DNA Sequence Polymorphism and Divergence at the erect wing and suppressor of sable Loci of Drosophila melanogaster and D. simulans
Genetics, July 1, 2005; 170(3): 1153 - 1165.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
S. I. Wright and B. S. Gaut
Molecular Population Genetics and the Search for Adaptive Evolution in Plants
Mol. Biol. Evol., March 1, 2005; 22(3): 506 - 519.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
G. Schofl and C. Schlotterer
Patterns of Microsatellite Variability Among X Chromosomes and Autosomes Indicate a High Frequency of Beneficial Mutations in Non-African D. simulans
Mol. Biol. Evol., July 1, 2004; 21(7): 1384 - 1390.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. Charlesworth, H. Borthwick, C. Bartolome, and P. Pignatelli
Estimates of the Genomic Mutation Rate for Detrimental Alleles in Drosophila melanogaster
Genetics, June 1, 2004; 167(2): 815 - 826.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
W. Wang, K. Thornton, J. J. Emerson, and M. Long
Nucleotide Variation and Recombination Along the Fourth Chromosome in Drosophila simulans
Genetics, April 1, 2004; 166(4): 1783 - 1794.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
N. D. Singh and D. A. Petrov
Rapid Sequence Turnover at an Intergenic Locus in Drosophila
Mol. Biol. Evol., April 1, 2004; 21(4): 670 - 680.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. D. Dean, K. J. Ballard, A. Glass, and J. W. O. Ballard
Influence of Two Wolbachia Strains on Population Structure of East African Drosophila simulans
Genetics, December 1, 2003; 165(4): 1959 - 1969.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. A. Sheldahl, D. M. Weinreich, and D. M. Rand
Recombination, Dominance and Selection on Amino Acid Polymorphism in the Drosophila Genome: Contrasting Patterns on the X and Fourth Chromosomes
Genetics, November 1, 2003; 165(3): 1195 - 1208.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Andolfatto and J. D. Wall
Linkage Disequilibrium Patterns Across a Recombination Gradient in African Drosophila melanogaster
Genetics, November 1, 2003; 165(3): 1289 - 1305.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. Charlesworth, C. Bartolome, M. H. Schierup, and B. K. Mable
Haplotype Structure of the Stigmatic Self-Incompatibility Gene in Natural Populations of Arabidopsis lyrata
Mol. Biol. Evol., November 1, 2003; 20(11): 1741 - 1753.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Przeworski
Estimating the Time Since the Fixation of a Beneficial Allele
Genetics, August 1, 2003; 164(4): 1667 - 1676.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
X. Maside, C. Bartolome, and B. Charlesworth
Inferences on the Evolutionary History of the S-Element Family of Drosophila melanogaster
Mol. Biol. Evol., August 1, 2003; 20(8): 1183 - 1187.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. C. Nickle, M. A. Jensen, D. Shriner, S. J. Brodie, L. M. Frenkel, J. E. Mittler, and J. I. Mullins
Evolutionary Indicators of Human Immunodeficiency Virus Type 1 Reservoirs and Compartments
J. Virol., May 1, 2003; 77(9): 5540 - 5546.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. D. Cutter and B. A. Payseur
Selection at Linked Sites in the Partial Selfer Caenorhabditis elegans
Mol. Biol. Evol., May 1, 2003; 20(5): 665 - 673.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
C. Bartolome, X. Maside, and B. Charlesworth
On the Abundance and Distribution of Transposable Elements in the Genome of Drosophila melanogaster
Mol. Biol. Evol., June 1, 2002; 19(6): 926 - 937.
[Abstract] [Full Text] [PDF]