- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lewis, L. K.
- Articles by Resnick, M. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lewis, L. K.
- Articles by Resnick, M. A.
Differential Suppression of DNA Repair Deficiencies of Yeast rad50, mre11 and xrs2 Mutants by EXO1 and TLC1 (the RNA Component of Telomerase)
L. Kevin Lewis1,a, G. Karthikeyana, James W. Westmorelanda, and Michael A. Resnickaa Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709
Corresponding author: Michael A. Resnick, National Institutes of Health, National Institute of Environmental Health Sciences, 111 Alexander Dr., Research Triangle Park, NC 27709., resnick{at}niehs.nih.gov (E-mail)
Communicating editor: A. NICOLAS
| ABSTRACT |
|---|
Rad50, Mre11, and Xrs2 form a nuclease complex that functions in both nonhomologous end-joining (NHEJ) and recombinational repair of DNA double-strand breaks (DSBs). A search for highly expressed cDNAs that suppress the DNA repair deficiency of rad50 mutants yielded multiple isolates of two genes: EXO1 and TLC1. Overexpression of EXO1 or TLC1 increased the resistance of rad50, mre11, and xrs2 mutants to ionizing radiation and MMS, but did not increase resistance in strains defective in recombination (rad51, rad52, rad54, rad59) or NHEJ only (yku70, sir4). Increased Exo1 or TLC1 RNA did not alter checkpoint responses or restore NHEJ proficiency, but DNA repair defects of yku70 and rad27 (fen) mutants were differentially suppressed by the two genes. Overexpression of Exo1, but not mutant proteins containing substitutions in the conserved nuclease domain, increased recombination and suppressed HO and EcoRI endonuclease-induced killing of rad50 strains. exo1 rad50 mutants lacking both nuclease activities exhibited a high proportion of enlarged, G2-arrested cells and displayed a synergistic decrease in DSB-induced plasmid:chromosome recombination. These results support a model in which the nuclease activity of the Rad50/Mre11/Xrs2 complex is required for recombinational repair, but not NHEJ. We suggest that the 5'3' exo activity of Exo1 is able to substitute for Rad50/Mre11/Xrs2 in rescission of specific classes of DSB end structures. Gene-specific suppression by TLC1, which encodes the RNA subunit of the yeast telomerase complex, demonstrates that components of telomerase can also impact on DSB repair pathways.
DNA double-strand breaks (DSBs) in eukaryotic chromosomes are repaired primarily by two pathways, homologous recombination and nonhomologous end-joining (NHEJ). Additional, nonconservative mechanisms of DSB repair have been described for selected DNA substrates, e.g., within segments of DNA containing multiple repeat sequences (![]()
![]()
![]()
![]()
![]()
Recombinational repair mechanisms are highly efficient in the yeast Saccharomyces cerevisiae and DSB ends containing modified bases or sugars, such as those produced by ionizing radiation, are almost exclusively repaired by this process. Genes specifically associated with the homologous recombination pathway in mitotic cells include RAD51, RAD52, RAD54, RAD55, RAD57, RAD59, and RPA (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
NHEJ in yeast can be precise or error prone and requires the functions of several genes. These include YKU70 and YKU80 (encoding subunits of the Ku heterodimer); DNL4 (LIG4) and LIF1 (yeast homologs of human DNA ligase IV and XRCC4, respectively); SIR2, SIR3, and SIR4 (mediating transcriptional silencing at yeast mating type loci and telomeres); as well as RAD50, MRE11, and XRS2 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
rad50, mre11, and xrs2 strains are defective in both recombination and NHEJ. These mutants are highly sensitive to damage induced by ionizing radiation, methyl methanesulfonate (MMS), or EcoRI endonuclease, exhibit elevated levels of spontaneous interchromosomal recombination during mitotic growth, and are deficient in the formation and processing of DSBs in meiosis (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The Rad50, Mre11, and Xrs2 proteins associate in vivo and in vitro and constitute a nuclease complex with manganese-dependent 3'5' exonuclease and single-stranded DNA endonuclease activities (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Stable maintenance of the lengths of yeast telomeres involves multiple genes. These include components of the telomerase complex such as EST1, EST2, EST3, TLC1 (encoding the RNA template subunit of telomerase), and CDC13, as well as many genes within the NHEJ pathway of DSB repair (YKU70, YKU80, RAD50, MRE11, XRS2, SIR2, SIR3, and SIR4, but not DNL4 or LIF1; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The precise functions of the Rad50/Mre11/Xrs2 complex (and its human cell counterpart) in recombination, NHEJ, and telomere maintenance are unknown. In an attempt to clarify its roles in DSB repair we have identified genes that, when expressed at elevated levels, suppress the severe DSB repair defects of rad50, mre11, and xrs2 mutants. Clones identified in the screen contained cDNAs encoding Exo1 (a 5'3' exonuclease implicated in DNA replication, mismatch repair, and homologous recombination) and TLC1, the RNA subunit of the yeast telomerase complex. Results obtained in subsequent analyses were consistent with a model in which elevated levels of the 5'3' exo activity of Exo1 substitute for the Rad50/Mre11/Xrs2 nuclease complex in recombinational DNA repair, but not in NHEJ or in maintenance of telomere ends. Several lines of evidence suggested that the mechanism of suppression by TLC1 RNA is different from that of EXO1 and revealed additional connections between DSB repair and telomere length maintenance pathways.
| MATERIALS AND METHODS |
|---|
Yeast strains and media:
S. cerevisiae strains used in the study are displayed in Table 1. VL6 and derivatives are descended from the S288c strain YPH857 (![]()
![]()
![]()
![]()
yku70 mutants, which were propagated at 25°. Treatment of cells with ionizing radiation was accomplished using a 137Cesium source emitting at a dose rate of 2.75 krad/min.
|
Strains containing rad50::hisG, rad51::hisG, rad52::hisG, and rad54::hisG deletion disruptions were created as previously described (![]()
![]()
rad50::G418,
mre11::G418,
rad59::G418, and
xrs2::G418 deletions were created using PCR fragment-mediated gene disruption in conjunction with the G418-resistance plasmid pFA6MX4 (![]()
mre11::HygB involved amplification of the gene for Hygromycin B resistance within pAG32 (![]()
yku70::TRP1 alleles were created after PCR amplification of pRS304 (![]()
grad50C, GCATGAGCGCTATCTATAAATTATCTATTCAGGGCATACGGTCTTCGTACGCTGCAGGTCGAC; grad50D, CGCAGTCTTATAGGAGAGCTCCGTTTCTTCCAGGACATCATTATAATCGATGAATTCGAGCTCG; gmre11A, GGACTATCCTGATCCAGACACAATAAGGATTTTAATTACTACAGACGTACGCTGCAGGTCGAC; gmre11B, GGAAGGAATCTAGCCCATTACCATTGAATGCGAAATTTGTCTCATATCGATGAATTCGAGCTCG; GxrsE, GGTGATAACTATAAATTTATGTGGGTAGTACGATACCAGAATACATTGGAAGATGCGTACGCTGCAGGTCGAC; GxrsF, AAAAGAGCCACGTGATCTACTAGTTGCGCTTCTACTGTGTCTACTTTGCTTGGAAATCGATGAATTCGAGCTCG; grad59A, ATGACGATACAAGCGAAGCCCAGTTCGAGCATATCGTATGATTCGCGTACGCTGCAGGTCGAC; grad59B, TTATTTGATATGCGTGCCTTTAGCATCCTCCAATTTGATAAAAGTATCGATGAATTCGAGCTCG; prsku70a, GGCCAGTCACTAATGCATTTGGCAATAGTGGAGAACTTAACGATCAAGTGGATCAGAGCAGATTGTACTGAGAGTGCACC; prsku70b2, AGATTACTGTCGTGCATAAATATCTTGCTAATAGTTGTACAGTACAACGTCGCATCTGTGCGGTATTTCACACCGC; 5'rad27-G418, AAAATTAACAACAAGAACATTATTATTCGATAGGAATGGGCGTACGCTGCAGGTCGAC; 3'rad27-G418, ACCTTCGAACATATATATACACCACTTAGAAAATTGATGGATCGATGAATTCGAGCTCG; DHS1-KanMX-5', AGGTATGAAGGAGAAGTGTTAGCCATTGATGGCTATGCATCGTACGCTGCAGGTCGAC;DHS1-KanMX-3', TTGGCTTGACTTAGTAGTTTCGATGTCCCTTTTCTTACTTATCGATGAATTCGAGCTCG.
cDNA library screening and DNA sequence analysis:
Strain YLKL440 (
rad50::G418 reg1-501) was transformed with plasmid DNA prepared from an amplified stock of a library containing haploid mitotic cell cDNAs under the control of the GAL1 promoter (![]()
![]()
![]()
![]()
70,000 initial transformants resulted in identification of >200 apparent MMS-resistant colonies after 45 days growth at 30°. Twelve of the clones remained resistant upon subsequent testing and were designated pCDNA50.1pCDNA50.2 (pGAL1::EXO1 clones) and pCDNA50.3pCDNA 50.12 (pGAL1::TLC1). Approximately 500 bp at the 5' and 3' ends of each plasmid insert were sequenced using the M13 Universal primer and primer Gal740 (CAACATTTTCGGTTTGTATTACTTC). The PRISM cycle sequencing system was employed in conjunction with an Applied Biosystems (Foster City, CA) model 373A DNA sequencer. Insert sequences were manipulated using DNA Strider 1.2 and homology searches were performed using the BLAST program (![]()
|
Nonhomologous end-joining and homologous recombination assays:
T334-derived cells (reg1-501) containing pRS316Gal (![]()
![]()
![]()
DNA damage-induced changes in cell cycling after treatment with MMS were analyzed as previously described (![]()
![]()
![]()
Plasmid:chromosome recombination assays were performed by transforming wild-type, exo1, rad50, and exo1 rad50 strains with pLKL37Y (HIS3 URA3) that was cut at the NcoI site within URA3 and selecting for Ura+ integrant colonies. pLKL37Y was created by cloning the HindIII-HindIII URA3 gene fragment from YEP24 into the integrating vector pRS303. Replica plating and PCR analysis of wild-type transformants demonstrated that all Ura+ recombinants were also His+ with the plasmid integrated at the ura3-52 locus. The host strain, VL6
, contains a deletion of the HIS3 gene (his3-
200). The chromosomal ura3-52 allele has a Ty insertion 121 nucleotides (nt) downstream of the URA3 start codon and the NcoI breakage site is 210 nt downstream, resulting in 89 bp of homology on one side of the DSB and >600 bp homology on the other. The same competent cell preparations were transformed separately with pRS313 (CEN/ARS, HIS3) and recombination frequencies were normalized for transformation efficiency. Each linear or supercoiled DNA transformation was performed three times and results were averaged.
The effects of EXO1 on HO endonuclease-induced growth inhibition were assessed after transformation of YLKL391 (rad52::LEU2
his3::[GAL::HO, TRP1] reg1-501) and YLKL574 (rad50::hisG
his3::[GAL::HO, TRP1] reg1-501) with either the control plasmid pRS425 (2µ LEU2) or pRDK480 (2µ LEU2 EXO1; ![]()
![]()
![]()
| RESULTS |
|---|
Repair of DNA damage in rad50 mutants is enhanced by overexpression of EXO1 and TLC1:
The functions of the Rad50/Mre11/Xrs2 nuclease complex in DSB repair are complex. To gain insight into the repair function(s) that is absent in such strains a screen was performed to identify genes that suppress the repair defects of rad50 mutants when expressed at high levels. Plasmid DNA prepared from a library containing yeast mitotic cDNAs under the control of the galactose-inducible GAL1 promoter (![]()
![]()
![]()
![]()
70,000 transformants resulted in the identification of 12 clones that could form colonies on plates containing 2% glucose + 1% galactose + 0.3 mM (0.003%) MMS. Two clones (pCDNA50.1 and pCDNA50.2) provided much stronger resistance to MMS than the others and also improved the plating efficiency of rad50 strains on synthetic galactose media without mutagen (Fig 1). The other 10 clones (pCDNA50.3pCDNA50.12) provided weaker resistance to MMS and did not significantly affect plating efficiency.
Sequence analysis revealed that the two clones that provided the strongest resistance to MMS contained the complete coding sequence of the EXO1 gene. This gene encodes a 5'3' exonuclease previously implicated in multiple pathways including recombination, mismatch repair, and processing of Okazaki fragments during DNA replication (![]()
![]()
![]()
![]()
![]()
![]()
![]()
4000 bp) and the cDNA library was unlikely to contain full-length RAD50 clones.
Cells containing deletions of RAD52 epistasis group genes (RAD50-RAD59, MRE11, or XRS2) are hypersensitive to ionizing radiation, but mutants specifically deficient in end-joining (i.e., yku70, yku80, sir2, sir3, sir4, dnl4) are resistant (![]()
![]()
![]()
100-fold by EXO1, suggesting a role for the exonuclease activity in recombinational repair of the damaged DSB ends. Interestingly, TLC1 overexpression produced a modest increase (
9-fold) in resistance (Fig 2).
|
EXO1- and TLC1-mediated suppression is specific for rad50, mre11, and xrs2 strains:
In accord with past observations of phenotypic similarities between strains defective in RAD50, MRE11, and XRS2, we observed that EXO1 and TLC1 overexpression also suppressed the DNA repair defects of mre11 and xrs2 mutants (Fig 3). Complementation by EXO1 was similar in each of the three mutants, but a three- to fivefold greater MMS resistance was consistently observed in mre11 strains when pGAL:: TLC1 was induced (Fig 3). The enhanced repair of MMS-induced lesions did not correlate with a change in checkpoint responses in the mutant strains. As shown in Fig 4, rad50 and mre11 cells rapidly arrest cycling at the G2/M checkpoint in the presence of DNA damage produced by low levels of MMS (scored as distended, large-budded cells; ![]()
![]()
|
|
MMS and radiation sensitivities of rad51, rad52, rad54, and rad59 mutants, which are specifically deficient in the recombinational pathway of DSB repair, were not rescued by EXO1 or TLC1 overexpression. Overexpression of EXO1 (but not TLC1) in rad51 and rad54 mutants reduced plating efficiency (
5- to 25-fold) in the absence of damage and modestly impaired cell recovery after exposure to low doses of ultraviolet light and ionizing radiation (Fig 5A). These effects were greater in rad51 and rad54 mutants than in rad52 strains. We also observed that recovery of cells after exposure to DNA damage induced by MMS and ultraviolet light (but not ionizing radiation) was impaired in rad59 mutants synthesizing elevated levels of Exo1 (Fig 5B). One interpretation of these results follows from past observations that, unlike rad52 strains, rad51, rad54, and rad59 mutants are only partially defective in spontaneous or DSB-induced recombination. Inappropriate processing of the ends of damaged DNA by elevated levels of Exo1 may reduce the recombinational capability of the partial function mutants closer to that of rad52 cells. In addition, we observed that killing of two MMS-sensitive, NHEJ-deficient yku70 and sir4 strains (GA911 and GA429; ![]()
|
Disparate impacts of TLC1 and EXO1 on DNA repair and telomere instability defects of yku70 and rad27 mutants:
Mutations in 8 of the 10 genes required for NHEJ exhibit telomere shortening at normal growth temperatures. In ku mutants telomere destabilization is exacerbated at elevated temperatures and cells eventually stop dividing at 37° (![]()
![]()
![]()
![]()
|
In previous studies, EXO1 overexpression was found to suppress the spontaneous mutator and temperature sensitivity phenotypes of rad27 strains (![]()
![]()
![]()
![]()
EXO1 stimulates repair by the recombination pathway:
Additional experiments were performed to assess whether increased levels of Exo1 protein influenced recombinational repair, NHEJ, or both pathways. The effects of EXO1 on recombination proficiency were analyzed directly using an intrachromosomal recombination assay (![]()
![]()
|
All NHEJ-deficient mutants have a reduced ability to recircularize linear plasmids containing complementary overhangs after transformation into haploid cells. The impact of EXO1 overexpression on the end-joining pathway of DSB repair was examined by performing plasmid end-joining assays (see MATERIALS AND METHODS). Linearized pRS314 DNA yielded transformants as efficiently as supercoiled DNA in wild-type cells (152,400 ± 31,700 and 192,300 ± 34,200 transformants per microgram of DNA for supercoiled and linear plasmid DNA, respectively). However, recovery of transformants using broken plasmids was >50-fold lower than with supercoiled plasmids in rad50 and mre11 mutants (Fig 7C). These deficiencies were not rescued by overexpression of either EXO1 or TLC1 RNA, suggesting that the increased DNA repair proficiency is not due to direct or indirect effects on NHEJ.
rad50, mre11, and xrs2 mutants are able to accomplish HO endonuclease-induced mating type switching, an intrachromosomal gene conversion event, but do so with retarded kinetics (![]()
his3::GALHO reg1-501) on plates containing 2% glucose supplemented with small amounts of galactose (0.02 or 0.05%) was alleviated by the presence of a high-copy 2µ plasmid containing EXO1 (pRDK480; Fig 8C). This rescue of cell growth was not observed at high levels of HO expression (e.g., with 2% galactose) and did not occur in an isogenic rad52 strain at any concentration of galactose (data not shown). These results suggest that the exonuclease can process the ends of the DSB at MAT to facilitate mating type switching in cells lacking the Rad50/Mre11/Xrs2 nuclease complex. The dependence on low intracellular levels of HO endonuclease activity suggests that processing by Exo1 is relatively inefficient. Overexpression of EXO1 also rescued lethality in rad50 and mre11 strains expressing EcoRI endonuclease (Fig 8B), which generates multiple chromosomal DSBs containing 5' single-stranded DNA overhangs (![]()
|
Role of the 5'3' exo activity in cells overexpressing EXO1 and in cells that lack the Rad50/Mre11/Xrs2 nuclease complex:
Formally, the DSB repair-enhancing effects of Exo1 might be a result of increased 5'3' exonuclease processing of DSB ends or might be achieved by an alternative mechanism such as titration of Exo1-associated proteins (e.g., Msh2 or other DNA end-binding proteins; ![]()
![]()
![]()
The possibility that the basal levels of Exo1 protein present in cells lacking the Rad50/Mre11/Xrs2 complex might provide a "backup" end-processing system for repair of spontaneous or induced DSBs was investigated. As shown in Fig 9, exo1 mutants were not more sensitive to ionizing radiation than wild-type cells and exo1 rad50 double mutants consistently exhibited only slightly more killing than rad50 mutants or severely Rec- rad52 strains. These data suggest that the "dirty-ended" DSBs produced by radiation, which frequently contain damaged or missing bases and sugars, have a strong dependence on processing by the Rad50/Mre11/Xrs2 complex and basal levels of Exo1 contribute very little to repair of such lesions.
|
Interestingly, the exo1 rad50 double mutants exhibited reduced plating efficiency, slower growth rates, increased cell volume, and an elevated fraction of distended, large-budded cells (arrested at G2/M) when propagated on synthetic or rich media (Fig 9B and data not shown). The latter phenotypes suggested that exo1 rad50 strains have elevated levels of unrepaired DNA damage and that Exo1 does serve a backup function for repair of some types of lesions. We investigated the possibility that recombinational repair of DSBs with undamaged ends (unlike radiation-induced DSBs) might exhibit a greater dependence on basal levels of Exo1 in rad50 mutants. An integrating plasmid (pLKL37Y; HIS3, URA3) was cleaved at a unique NcoI site within URA3 and transformed into wild-type and mutant cells along with a control, centromeric vector for normalization of transformation efficiencies (pRS313). The linearized plasmid containing complementary DSB ends efficiently recombined with the ura3-52 heteroallele on chromosome V to produce HIS3+ URA3+ integrants in wild-type cells (Fig 10). Integration into ura3-52 was reduced 4-fold in rad50 strains, but was reduced
50-fold in exo1 rad50 double mutants (similar to Rec- rad51 cells), demonstrating that basal levels of Exo1 can substitute for the Rad50/Mre11/Xrs2 complex for processing of complementary-ended DSBs.
|
| DISCUSSION |
|---|
EXO1 overexpression elevates recombination rates, but does not rescue telomere instability or NHEJ repair defects:
Overexpression of EXO1 from a GAL1 promoter enhanced resistance to MMS and ionizing radiation in rad50, mre11, and xrs2 strains, but did not mitigate the damage-induced cell cycle arrest response of the cells. In addition, we observed that EXO1 overexpression restored growth to rad50 strains after cleavage of chromosomal DNA by HO endonuclease. This result suggests an increased efficiency of gene conversion (mating type switching) due to the actions of the exonuclease. Overexpression of the enzyme also rescued EcoRI-induced cell killing in rad50 and mre11 mutants and increased spontaneous recombination rates in wild-type cells, as well as in rad50, mre11, and xrs2 strains. In contrast, overexpression of the exonuclease did not suppress the severe defect in NHEJ in these mutants and did not suppress the MMS sensitivities of NHEJ-deficient yku70 or sir4 strains. These latter results are consistent with recent observations that EXO1 overexpression does not affect telomere shortening, thought to be an NHEJ-associated defect, in rad50, mre11, and xrs2 mutants (![]()
![]()
Spontaneous intrachromosomal recombination rates are moderately decreased in exo1 mutants (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Interestingly, Exo1 did not provide increased resistance to MMS or radiation in rad51, rad52, rad54, or rad59 strains, which are primarily defective in the recombinational repair pathway. Instead, recovery of rad51, rad54, and rad59 cells exposed to DNA damage was impaired by EXO1 overexpression. Although increased Exo1 activity did inhibit recovery in rad52 cells, the effects were not as pronounced as in the other mutants. Previous studies have demonstrated that rad51, rad54, and rad59 mutants are not as deficient as rad52 strains in several classes of mitotic recombination events (e.g., ![]()
![]()
![]()
![]()
![]()
![]()
exo1 rad50 double mutants were only slightly more sensitive to ionizing radiation than rad50 or rad52 strains, but grew slowly, displayed reduced viability, and had an increased fraction of distended, G2-arrested cells (
60% of total cells). These data suggest that cells lacking both nuclease enzymes have elevated levels of unrepaired DNA damage, which produce chronic activation of the damage-responsive checkpoint system and extended time in G2. In agreement with the idea that Exo1 is functionally redundant with the Rad50/Mre11/Xrs2 complex for repair of some types of lesions, we found that targeted recombination between cohesive-ended, linear plasmid DNA and yeast chromosomal DNA was synergistically decreased in exo1 rad50 double mutants relative to either single mutant.
The Rad50/Mre11/Xrs2 complex of yeast (and its human cell counterpart consisting of hRAD50, hMRE11, and hNBS1) exhibits ssDNA endonuclease and 3'5' exonuclease activities in vitro (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Recent analyses of mre11 mutants (containing substitutions within conserved sequence motifs thought to be important for nuclease function) have implied that the nuclease activities are not essential for many repair functions of the complex in vivo (![]()
![]()
![]()
![]()
![]()
![]()
TLC1 RNA overexpression selectively suppresses defects in DSB repair and telomere maintenance:
Ten independent galactose-regulated TLC1 cDNAs were isolated as suppressors of MMS-induced cell killing in rad50 mutants. Only one of the clones contained the complete 1301 bp of the gene, though the remaining clones were only slightly less than full length. All isolates retained the centrally located 16-nucleotide region postulated to act as template for extension of the 3' ends of chromosomal DNA during S phase (![]()
![]()
Like Ku-deficient strains, rad50, mre11, and xrs2 mutants display telomere shortening and senescence at normal growth temperatures (![]()
![]()
![]()
Interestingly, TLC1 RNA overexpression did not rescue the 37° growth impairment of rad27 mutants. Cells lacking Rad27 (the yeast homolog of the human flap endonuclease FEN1) are not deficient in standard assays for NHEJ (e.g., recircularization of linear plasmid DNA, EcoRI sensitivity), but do feature aberrant processing of noncomplementary DSB ends in plasmid NHEJ repair (![]()
![]()
![]()
![]()
Formation of new telomeres at sites of chromosomal DSBs has been observed previously in yeast cells (![]()
![]()
![]()
![]()
DNA at the ends of yeast chromosomes forms complex local and higher order structures within the nucleus. For example, telomeres on different chromosomes appear to cluster in specific foci and form T-loops, whereby the DNA at the end of a chromosome loops back and anneals to internal repeat sequences (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Department of Chemistry and Biochemistry, Southwest Texas State University, San Marcos, TX 78666. ![]()
| ACKNOWLEDGMENTS |
|---|
We are grateful to Eric Alani, Alan Goldstein, Jakob Kirchner, Victoria Lundblad, and John McCusker for plasmids used in the study. The authors also thank Kirill Lobachev, Jim Mason, and Doug Thrower for providing comments on the manuscript.
Manuscript received April 18, 2001; Accepted for publication October 17, 2001.
| LITERATURE CITED |
|---|
ADAMS, A. K. and C. HOLM, 1996 Specific DNA replication mutations affect telomere length in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:4614-4620
AGUILERA, A., 1995 Genetic evidence for different RAD52-dependent intrachromosomal recombination pathways in Saccharomyces cerevisiae. Curr. Genet. 27:298-305[Medline].
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1995 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
ASTROM, S. U., S. M. OKAMURA, and J. RINE, 1999 Yeast cell-type regulation of DNA repair. Nature 397:310[Medline].
BAI, Y. and L. S. SYMINGTON, 1996 A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 15:2025-2037.
BARNES, G. and D. RIO, 1997 DNA double-strand-break sensitivity, DNA replication, and cell cycle arrest phenotypes of Ku-deficient Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 94:867-872
BAUMANN, P. and S. C. WEST, 1998 DNA end-joining catalyzed by human cell-free extracts. Proc. Natl. Acad. Sci. USA 95:14066-14070
BENSON, F. E., P. BAUMANN, and S. C. WEST, 1998 Synergistic actions of Rad51 and Rad52 in recombination and DNA repair. Nature 391:401-404[Medline].
BOULTON, S. J. and S. P. JACKSON, 1998 Components of the Ku-dependent non-homologous end-joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J. 17:1819-1828[Medline].
BRESSAN, D. A., H. A. OLIVARES, B. E. NELMS, and J. H. PETRINI, 1998 Alteration of N-terminal phosphoesterase signature motifs inactivates Saccharomyces cerevisiae Mre11. Genetics 150:591-600
BRESSAN, D. A., B. K. BAXTER, and J. H. PETRINI, 1999 The Mre11-Rad50-Xrs2 protein complex facilitates homologous recombination-based double-strand break repair in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:7681-7687
CHAMANKHAH, M., T. FONTANIE, and W. XIAO, 2000 The Saccharomyces cerevisiae mre11(ts) allele confers a separation of DNA repair and telomere maintenance functions. Genetics 155:569-576
CHAPON, C., T. R. CECH, and A. J. ZAUG, 1997 Polyadenylation of telomerase RNA in budding yeast. RNA 3:1337-1351[Abstract].
CHEN, C. and R. D. KOLODNER, 1999 Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination defective mutants. Nat. Genet. 23:81-85[Medline].
CLEVER, B., G. INTERTHAL, J. SCHMUCKLI-MAURER, J. KING, and M. SIGRIST et al., 1997 Recombinational repair in yeast: functional interactions between Rad51 and Rad54 proteins. EMBO J. 16:2535-2544[Medline].
CRITCHLOW, S. E. and S. P. JACKSON, 1998 DNA end-joining: from yeast to man. Trends Biochem. Sci. 23:394-398[Medline].
ELIAS-ARNANZ, M., A. A. FIRMENICH, and P. BERG, 1996 Saccharomyces cerevisiae mutants defective in plasmid-chromosome recombination. Mol. Gen. Genet. 252:530-538[Medline].
FELDMANN, H. and E. L. WINNACKER, 1993 A putative homologue of the human autoantigen Ku from Saccharomyces cerevisiae. J. Biol. Chem. 268:12895-12900
FIORENTINI, P., K. N. HUANG, D. X. TISHKOFF, R. D. KOLODNER, and L. S. SYMINGTON, 1997 Exonuclease I of Saccharomyces cerevisiae functions in mitotic recombination in vivo and in vitro. Mol. Cell. Biol. 17:2764-2773
FURUSE, M., Y. NAGASE, H. TSUBOUCHI, K. MURAKAMI-MUROFUSHI, and T. SHIBATA et al., 1998 Distinct roles of two separable in vitro activities of yeast Mre11 in mitotic and meiotic recombination. EMBO J. 17:6412-6425[Medline].
GALY, V., J. OLIVO-MARIN, H. SCHERTHAN, V. DOYE, and N. RASCALOU et al., 2000 Nuclear pore complexes in the organization of silent telomeric chromatin. Nature 403:108-112[Medline].
GAME, J. C, 1993 DNA double-strand breaks and the RAD50RAD57 genes in Saccharomyces. Cancer Biol. 4:73-83.
GARY, R., M. S. PARK, J. P. NOLAN, H. L. CORNELIUS, and O. G. KOZYREVA et al., 1999 A novel role in DNA metabolism for the binding of Fen1/Rad27 to PCNA and implications for genetic risk. Mol. Cell. Biol. 19:5373-5382
GASIOR, S. L., A. K. WONG, Y. KORA, A. SHINOHARA, and D. K. BISHOP, 1998 Rad52 associates with RPA and functions with Rad55 and Rad57 to assemble meiotic recombination complexes. Genes Dev. 12:2208-2221
GIETZ, R. D., R. H. SCHIESTL, A. R. WILLEMS, and R. A. WOODS, 1995 Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360[Medline].
GOLDSTEIN, A. L. and J. H. MCCUSKER, 1999 Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15:1541-1553[Medline].
GOTTA, M., T. LAROCHE, A. FORMENTON, L. MAILLET, and H. SCHERTHAN et al., 1996 The clustering of telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces cerevisiae. J. Cell Biol. 134:1349-1363
GRIFFITH, J. D., L. COMEAU, S. ROSENFIELD, R. M. STANSEL, and A. BIANCHI et al., 1999 Mammalian telomeres end in a large duplex loop. Cell 97:503-514[Medline].
HABER, J. E., 1998 The many interfaces of Mre11. Cell 95:583-586[Medline].
HAYNES, R. H., and B. A. KUNZ, 1981 DNA repair and mutagenesis in yeast, p. 371414 in The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, edited by J. N. STRATHERN, E. W. JONES and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HOPFNER, K. P., A. KARCHER, D. S. SHIN, L. CRAIG, and L. M. ARTHUR et al., 2000 Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily. Cell. 101:789-800[Medline].
HOVLAND, P., J. FLICK, M. JOHNSTON, and R. A. SCLAFANI, 1989 Galactose as a gratuitous inducer of GAL gene expression in yeasts growing on glucose. Gene 83:57-64[Medline].
IMAI, S., C. M. ARMSTRONG, M. KAEBERLEIN, and L. GUARENTE, 2000 Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403:795-800[Medline].
IVANOV, E. L., N. SUGAWARA, C. I. WHITE, F. FABRE, and J. E. HABER, 1994 Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae. Mol. Cell. Biol. 14:3414-3425
JOHZUKA, K. and H. OGAWA, 1995 Interaction of Mre11 and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae.. Genetics 139:1521-1532[Abstract].
KIRONMAI, K. M. and K. MUNIYAPPA, 1997 Alteration of telomeric sequences and senescence caused by mutations in RAD50 of Saccharomyces cerevisiae. Genes Cells 2:443-455[Abstract].
KLEIN, H. L., 1995 Genetic control of intrachromosomal recombination. BioEssays 17:147-159[Medline].
KOUPRINA, N., N. NIKOLAISHVILI, J. GRAVES, M. KORIABINE, and M. A. RESNICK et al., 1999 Integrity of human YACs during propagation in recombination-deficient yeast strains. Genomics 56:262-273[Medline].
KRAMER, K. M. and J. E. HABER, 1993 New telomeres in yeast are initiated with a highly selected subset of TG13 repeats. Genes Dev. 7:2345-2356
KUNKEL, T. A., M. A. RESNICK, and D. A. GORDENIN, 1997 Mutator specificity and disease: looking over the FENce. Cell 88:155-158[Medline].
LANDRY, J., A. SUTTON, S. T. TAFROV, R. C. HELLER, and J. STEBBINS et al., 2000 The silencing protein Sir2 and its homologs are NAD-dependent protein deacetylases. Proc. Natl. Acad. Sci. USA 97:5807-5811
LARIONOV, V., N. KOUPRINA, N. NIKOLAISHVILI, and M. A. RESNICK, 1994 Recombination during transformation as a source of chimeric mammalian artificial chromosomes in yeast (YACs). Nucleic Acids Res. 22:4154-4162
LE, S., J. K. MOORE, J. E. HABER, and C. W. GREIDER, 1999 RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics 152:143-152
LEE, S. E., J. K. MOORE, A. HOLMES, K. UMEZU, and R. D. KOLODNER et al., 1998 Saccharomyces Ku70, Mre11/Rad50 and Rpa proteins regulate adaptation to G2/M arrest after DNA damage. Cell 94:399-409[Medline].
LEWIS, L. K. and M. A. RESNICK, 2000 Tying up loose ends: nonhomologous end-joining in Saccharomyces cerevisiae. Mutat. Res. 451:71-89[Medline].
LEWIS, L. K., J. M. KIRCHNER, and M. A. RESNICK, 1998 Requirement for end-joining and checkpoint functions, but not RAD52-mediated recombination after EcoRI endonuclease cleavage of Saccharomyces cerevisiae DNA. Mol. Cell. Biol. 18:1891-1902
LEWIS, L. K., J. W. WESTMORELAND, and M. A. RESNICK, 1999 Repair of endonuclease-induced double-strand breaks in Saccharomyces cerevisiae: essential role for genes associated with nonhomologous end-joining. Genetics 152:1513-1529
LIANG, F., M. HAN, P. J. ROMANIENKO, and M. JASIN, 1998 Homology-directed repair is a major double-strand break repair pathway in mammalian cells. Proc. Natl. Acad. Sci. USA 95:5172-5177
LIU, H., J. KRIZEK, and A. BRETSCHER, 1992 Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673[Abstract].
LOWELL, J. E. and L. PILLUS, 1998 Telomere tales: chromatin, telomerase and telomere function in Saccharomyces cerevisiae. Cell Mol. Life Sci. 54:32-49[Medline].
LUE, N. F., 1999 Sequence-specific and conformation-dependent binding of yeast telomerase RNA to single-stranded telomeric DNA. Nucleic Acids Res. 27:2560-2567
LUSTIG, A. J., 1998 Mechanisms of silencing in Saccharomyces cerevisiae. Curr. Opin. Genet. Dev. 8:233-239[Medline].
MARTIN, S. G., T. LAROCHE, N. SUKA, M. GRUNSTEIN, and S. M. GASSER, 1999 Relocalization of telomeric Ku and Sir proteins in response to DNA strand breaks in yeast. Cell 97:621-633[Medline].
MCCREADY, S. J., F. OSMAN, and A. YASUI, 2000 Repair of UV damage in the fission yeast Schizosaccharomyces pombe. Mutat. Res. 451:197-210[Medline].
MILLS, K. D., D. A. SINCLAIR, and L. GUARENTE, 1999 MEC1-dependent redistribution of the Sir3 silencing protein from telomeres to DNA double-strand breaks. Cell 97:609-620[Medline].
MOORE, J. K. and J. E. HABER, 1996 Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:2164-2173
MOREAU, S., J. R. FERGUSON, and L. S. SYMINGTON, 1999 The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol. Cell. Biol. 19:556-566
NEW, J. H., T. SUGIYAMA, E. ZAITSEVA, and S. C. KOWALCZYKOWSKI, 1998 Rad52 protein stimulates DNA strand exchange by Rad51 and replication protein A. Nature 391:407-410[Medline].
NUGENT, C. I., G. BOSCO, L. O. ROSS, S. K. EVANS, and A. P. SALINGER et al., 1998 Telomere maintenance is dependent on activities required for end repair of double-strand breaks. Curr. Biol. 8:657-660[Medline].
OSMAN, F. and S. SUBRAMANI, 1998 Double-strand break-induced recombination in eukaryotes. Prog. Nucleic Acid Res. Mol. Biol. 58:263-299[Medline].
PALLADINO, F., T. LAROCHE, E. GILSON, A. AXELROD, and L. PILLUS et al., 1993 Sir3 and Sir4 proteins are required for the positioning and integrity of yeast telomeres. Cell 75:543-555[Medline].
PANG, D., S. YOO, W. S. DYNAN, M. JUNG, and A. DRITSCHILO, 1997 Ku proteins join DNA fragments as shown by atomic force microscopy. Cancer Res. 57:1412-1415
PAQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404
PARENTEAU, J. and R. J. WELLINGER, 1999 Accumulation of single-stranded DNA and destabilization of telomeric repeats in yeast mutant strains carrying a deletion of RAD27. Mol. Cell. Biol. 19:4143-4152
PARK, P. U., P. A. DEFOSSEZ, and L. GUARENTE, 1999 Effects of mutations in DNA repair genes on formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:3848-3856
PAULL, T. T. and M. GELLERT, 1999 Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13:1276-1288
PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407521 in The Molecular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
PETRINI, J. H., 1999 The mammalian Mre11-Rad50-Nbs1 protein complex: integration of functions in the cellular DNA-damage response. Am. J. Hum. Genet. 64:1264-1269[Medline].
PORTER, S. E., P. W. GREENWELL, K. B. RITCHIE, and T. PETES, 1996 The DNA-binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae. Nucleic Acids Res. 24:582-585
PRESCOTT, J. and E. H. BLACKBURN, 1997 Telomerase RNA mutations in Saccharomyces cerevisiae alter telomerase action and reveal nonprocessivity in vivo and in vitro. Genes Dev. 11:528-540
RATTRAY, A. J. and L. S. SYMINGTON, 1995 Multiple pathways for homologous recombination in Saccharomyces cerevisiae. Genetics 139:45-56[Abstract].
RESNICK, M. A., 1976 The repair of double-strand breaks in DNA: a model involving recombination. J. Theor. Biol. 59:97-106[Medline].
SARGENT, R. G., M. A. BRENNEMAN, and J. H. WILSON, 1997 Repair of site-specific double-strand breaks in a mammalian chromosome by homologous and illegitimate recombination. Mol. Cell. Biol. 17:267-277
SCHULZ, V. P. and V. A. ZAKIAN, 1994 The Saccharomyces PIF1 DNA helicase inhibits telomere elongation and de novo telomere formation. Cell 76:145-155[Medline].
SHINOHARA, A. and T. OGAWA, 1998 Stimulation by Rad52 of yeast Rad51-mediated recombination. Nature 391:404-407[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27
SINGER, M. S. and D. E. GOTTSCHLING, 1994 TLC1: template RNA component of Saccharomyces cerevisiae telomerase. Science 266:404-409
SINGER, M. S., A. KAHANA, A. J. WOLF, L. L. MEISINGER, and S. E. PETERSON et al., 1998 Identification of high-copy disruptors of telomeric silencing in Saccharomyces cerevisiae. Genetics 150:613-632
SOKOLSKY, T. and E. ALANI, 2000 EXO1 and MSH6 are high-copy suppressors of conditional mutations in the MSH2 mismatch repair gene of Saccharomyces cerevisiae. Genetics 155:589-599
STEWART, G. S., R. S. MASER, T. STANKOVIC, D. A. BRESSAN, and M. I. KAPLAN et al., 1999 The DNA double-strand break repair gene hMRE11 is mutated in individuals with an Ataxia-Telangiectasia-like disorder. Cell 99:577-587[Medline].
SUGAWARA, N., E. L. IVANOV, J. FISHMAN-LOBELL, B. L. RAY, and X. WU et al., 1995 DNA structure-dependent requirements for yeast RAD genes in gene conversion. Nature 373:84-86[Medline].
SZOSTAK, J. W., T. L. ORR-WEAVER, R. J. ROTHSTEIN, and F. W. STAHL, 1983 The double-strand break repair model for recombination. Cell 33:25-35[Medline].
TAKATA, M., M. S. SASAKI, E. SONODA, C. MORRISON, and M. HASHIMOTO et al., 1998 Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J. 17:5497-5508[Medline].
TENG, S. C. and V. A. ZAKIAN, 1999 Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:8083-8093
THALER, D. S. and F. W. STAHL, 1988 DNA double-chain breaks in recombination of phage lambda and of yeast. Annu. Rev. Genet. 22:1969-1997.
TISHKOFF, D. X., A. L. BOERGER, P. BERTRAND, N. FILOSI, and G. M. GAIDA et al., 1997 Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MSH2. Proc. Natl. Acad. Sci. USA 94:7487-7492
TRAN, H. T., N. P. DEGTYAREVA, N. N. KOLOTEVA, A. SUGINO, and H. MASUMOTO et al., 1995 Replication slippage between distant short repeats in Saccharomyces cerevisiae depends on the direction of replication and the RAD50 and RAD52 genes. Mol. Cell. Biol. 15:5607-5617
TRAN, H. T., D. A. GORDENIN, and M. A. RESNICK, 1999 The 3'
5' exonucleases of DNA polymerases delta and epsilon and the 5'
3' exonuclease Exo1 have major roles in postreplication mutation avoidance in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:2000-2007
TSUBOUCHI, H. and H. OGAWA, 2000 Exo1 roles for repair of DNA double-strand breaks and meiotic crossing over in Saccharomyces cerevisiae. Mol. Biol. Cell 11:2221-2233
TSUKAMOTO, Y., J. KATO, and H. IKEDA, 1997 Silencing factors participate in DNA repair and recombination in Saccharomyces cerevisiae.. Nature 388:900-903[Medline].
USUI, T., T. OHTA, H. OSHIUMI, J. TOMIZAWA, and H. OGAWA et al., 1998 Complex formation and functional versatility of Mre11 of budding yeast in recombination. Cell 95:705-716[Medline].
WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[Medline].
WU, X., T. E. WILSON, and M. R. LIEBER, 1999 A role for FEN-1 in nonhomologous DNA end joining: the order of strand annealing and nucleolytic processing events. Proc. Natl. Acad. Sci. USA 96:1303-1308
XIAO, W., B. L. CHOW, and L. RATHGEBER, 1996 The repair of DNA methylation damage in Saccharomyces cerevisiae. Curr. Genet. 30:461-468[Medline].
ZOU, H. and R. ROTHSTEIN, 1997 Holliday junctions accumulate in replication mutants via a RecA homology-independent mechanism. Cell 90:87-96[Medline].
This article has been cited by other articles:
![]() |
S. Raynard, H. Niu, and P. Sung DNA double-strand break processing: the beginning of the end Genes & Dev., November 1, 2008; 22(21): 2903 - 2907. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kish and J. DiRuggiero Rad50 Is Not Essential for the Mre11-Dependent Repair of DNA Double-Strand Breaks in Halobacterium sp. Strain NRC-1 J. Bacteriol., August 1, 2008; 190(15): 5210 - 5216. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Smith, S. Banerjee, R. Rilo, and K. Myung Dynamic Regulation of Single-Stranded Telomeres in Saccharomyces cerevisiae Genetics, February 1, 2008; 178(2): 693 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lee and S. E. Lee Saccharomyces cerevisiae Sae2- and Tel1-Dependent Single-Strand DNA Formation at DNA Break Promotes Microhomology-Mediated End Joining Genetics, August 1, 2007; 176(4): 2003 - 2014. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kikuchi, Y. Taniguchi, A. Hatanaka, E. Sonoda, H. Hochegger, N. Adachi, Y. Matsuzaki, H. Koyama, D. C. van Gent, M. Jasin, et al. Fen-1 Facilitates Homologous Recombination by Removing Divergent Sequences at DNA Break Ends Mol. Cell. Biol., August 15, 2005; 25(16): 6948 - 6955. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Doherty, S. Sharma, L. A. Uzdilla, T. M. Wilson, S. Cui, A. Vindigni, and R. M. Brosh Jr. RECQ1 Helicase Interacts with Human Mismatch Repair Factors That Regulate Genetic Recombination J. Biol. Chem., July 29, 2005; 280(30): 28085 - 28094. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, K. M. Trujillo, S. Van Komen, D. H. Roh, L. Krejci, L. K. Lewis, M. A. Resnick, P. Sung, and A. E. Tomkinson Effect of Amino Acid Substitutions in the Rad50 ATP Binding Domain on DNA Double Strand Break Repair in Yeast J. Biol. Chem., January 28, 2005; 280(4): 2620 - 2627. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Llorente and L. S. Symington The Mre11 Nuclease Is Not Required for 5' to 3' Resection at Multiple HO-Induced Double-Strand Breaks Mol. Cell. Biol., November 1, 2004; 24(21): 9682 - 9694. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Maringele and D. Lydall Telomerase- and recombination-independent immortalization of budding yeast Genes & Dev., November 1, 2004; 18(21): 2663 - 2675. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Zubko, S. Guillard, and D. Lydall Exo1 and Rad24 Differentially Regulate Generation of ssDNA at Telomeres of Saccharomyces cerevisiae cdc13-1 Mutants Genetics, September 1, 2004; 168(1): 103 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Liberti and L. J. Rasmussen Is hEXO1 a Cancer Predisposing Gene? Mol. Cancer Res., August 1, 2004; 2(8): 427 - 432. [Full Text] [PDF] |
||||
![]() |
L. K. Lewis, F. Storici, S. Van Komen, S. Calero, P. Sung, and M. A. Resnick Role of the Nuclease Activity of Saccharomyces cerevisiae Mre11 in Repair of DNA Double-Strand Breaks in Mitotic Cells Genetics, April 1, 2004; 166(4): 1701 - 1713. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Grandin and M. Charbonneau Mitotic Cyclins Regulate Telomeric Recombination in Telomerase-Deficient Yeast Cells Mol. Cell. Biol., December 15, 2003; 23(24): 9162 - 9177. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hackett and C. W. Greider End Resection Initiates Genomic Instability in the Absence of Telomerase Mol. Cell. Biol., December 1, 2003; 23(23): 8450 - 8461. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lydall Hiding at the ends of yeast chromosomes: telomeres, nucleases and checkpoint pathways J. Cell Sci., October 15, 2003; 116(20): 4057 - 4065. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tomita, A. Matsuura, T. Caspari, A. M. Carr, Y. Akamatsu, H. Iwasaki, K.-i. Mizuno, K. Ohta, M. Uritani, T. Ushimaru, et al. Competition between the Rad50 Complex and the Ku Heterodimer Reveals a Role for Exo1 in Processing Double-Strand Breaks but Not Telomeres Mol. Cell. Biol., August 1, 2003; 23(15): 5186 - 5197. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, J. A. Sommers, H. C. Driscoll, L. Uzdilla, T. M. Wilson, and R. M. Brosh Jr. The Exonucleolytic and Endonucleolytic Cleavage Activities of Human Exonuclease 1 Are Stimulated by an Interaction with the Carboxyl-terminal Region of the Werner Syndrome Protein J. Biol. Chem., June 20, 2003; 278(26): 23487 - 23496. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wei, A. B. Clark, E. Wong, M. F. Kane, D. J. Mazur, T. Parris, N. K. Kolas, R. Russell, H. Hou Jr., B. Kneitz, et al. Inactivation of Exonuclease 1 in mice results in DNA mismatch repair defects, increased cancer susceptibility, and male and female sterility Genes & Dev., March 1, 2003; 17(5): 603 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Symington Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 630 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Wilson A Genomics-Based Screen for Yeast Mutants With an Altered Recombination/End-Joining Repair Ratio Genetics, October 1, 2002; 162(2): 677 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Maringele and D. Lydall EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants Genes & Dev., August 1, 2002; 16(15): 1919 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wei, R. Skopp, M. Takata, S. Takeda, and C. M. Price Effects of double-strand break repair proteins on vertebrate telomere structure Nucleic Acids Res., July 1, 2002; 30(13): 2862 - 2870. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lewis, L. K.
- Articles by Resnick, M. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lewis, L. K.
- Articles by Resnick, M. A.


) Rad+. rad50: (
) pGAL::EXO1, (
) pGAL::TLC1, (
) pRS316.

) pGAL::EXO1, (
) pGAL::TLC1.




) rad50, () rad52, (
) exo1 rad50.








