Genetics, Vol. 160, 225-234, January 2002, Copyright © 2002

Cloning and Characterization of the Tribolium castaneum Eye-Color Genes Encoding Tryptophan Oxygenase and Kynurenine 3-Monooxygenase

Marcé D. Lorenzena, Susan J. Browna, Robin E. Denella, and Richard W. Beemanb
a Division of Biology, Kansas State University, Manhattan, Kansas 66506
b United States Department of Agriculture-ARS-GMPRC, Manhattan, Kansas 66502

Corresponding author: Richard W. Beeman, 1515 College Ave., Manhattan, KS 66502., beeman{at}gmprc.ksu.edu (E-mail)

Communicating editor: K. V. ANDERSON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The use of eye-color mutants and their corresponding genes as scorable marker systems has facilitated the development of transformation technology in Drosophila and other insects. In the red flour beetle, Tribolium castaneum, the only currently available system for germline transformation employs the exogenous marker gene, EGFP, driven by an eye-specific promoter. To exploit the advantages offered by eye-pigmentation markers, we decided to develop a transformant selection system for Tribolium on the basis of mutant rescue. The Tribolium orthologs of the Drosophila eye-color genes vermilion (tryptophan oxygenase) and cinnabar (kynurenine 3-monooxygenase) were cloned and characterized. Conceptual translations of Tc vermilion (Tcv) and Tc cinnabar (Tccn) are 71 and 51% identical to their respective Drosophila orthologs. We used RNA interference (RNAi) to show that T. castaneum larvae lacking functional Tcv or Tccn gene products also lack the pigmented eyespots observed in wild-type larvae. Five available eye-color mutations were tested for linkage to Tcv or Tccn via recombinational mapping. No linkage was found between candidate mutations and Tccn. However, tight linkage was found between Tcv and the white-eye mutation white, here renamed vermilionwhite (vw). Molecular analysis indicates that 80% of the Tcv coding region is deleted in vw beetles. These observations suggest that the Tribolium eye is pigmented only by ommochromes, not pteridines, and indicate that Tcv is potentially useful as a germline transformation marker.


RECENT advances in genomics and bioinformatics promise to hasten the discovery and analysis of genes that regulate important biological phenomena. Such efforts will be aided by continued development of transposon-based systems for the experimental manipulation of target genomes. The red flour beetle, Tribolium castaneum, is an excellent candidate in which to develop such technology because of its long history as an experimental subject for genetic analyses, its ease of genetic manipulation, its prominence as a pest species, and its potential as a model for other Coleopteran pest species. To further improve the utility of the Tribolium genetic system, transposon-based procedures analogous to those based on the P-transposable element in Drosophila are needed. The P element has been harnessed and tailored for germline transformation applications such as mutagenesis by transposon tagging and enhancer trapping. However, useful P-element function is restricted to the genus Drosophila (O'BROCHTA and HANDLER 1988 Down). A summary of recent nondrosophilid insect transformation efforts can be found in ATKINSON et al. 2001 Down.

Recently BERGHAMMER et al. 1999 Down achieved germline transformation in T. castaneum. The authors utilized both the Hermes and piggyBac transposable elements marked with a gene encoding an enhanced green fluorescent protein (EGFP) driven by the eye-specific promoter 3xP3. This system (HORN et al. 2000 Down) shows great promise, but is limited by the cell autonomy of EGFP expression, the technical demands of EGFP detection, and the tissue specificity of the 3xP3 promoter. To overcome these potential limitations, we are exploring the use of eye-color genes as transformation markers. Eye-color markers have been used successfully in Drosophila since the advent of P-mediated germline transformation (RUBIN and SPRADLING 1982 Down). These genes generate an easily scored visible phenotype when introduced into the appropriate mutant background. The use of such genes eliminates the need for specialized detection systems, thus making transformation-based protocols more widely accessible. In addition, the availability of several different transformant selection systems allows greater flexibility in the design of sophisticated protocols.

A large number of mutations are known to affect the pigmentation of the compound eye of Drosophila, including those that affect the biosynthesis or transport of ommochrome (brown) and pteridine (red) pigments. While some insects lack pteridine pigments (e.g., Anopheles gambiae, BEARD et al. 1995 Down), ommochrome pigments have been found in all insects examined to date. Early work with Drosophila eye-color mutants revealed that vermilion (v) and cinnabar (cn) are involved in ommochrome production (BEADLE and EPHRUSSI 1937 Down). The vermilion gene encodes tryptophan oxygenase (TO; BAGLIONI 1959 Down; BALLIE and CHOVNICK 1971 Down; WALKER et al. 1986 Down), an enzyme that converts tryptophan to formylkynurenine (see reviews by LINZEN 1974 Down; PHILLIPS and FORREST 1980 Down), whereas cinnabar encodes kynurenine 3-monooxygenase (KM; GHOSH and FORREST 1967 Down; WARREN et al. 1996 Down), which converts kynurenine to 3-hydroxykynurenine (GHOSH and FORREST 1967 Down). Mutations in v or cn rarely cause a decrease in fitness, and overexpression of these genes is not deleterious.

Such eye-color genes offer another important advantage. Unlike EGFP, the v and cn genes are not limited by cell autonomy. The importance of this is realized when transgene insertion occurs in or near a heterochromatic region. Transposition into such chromosomal sites often leads to position-effect variegation (random gene silencing), evidenced by a characteristic mosaic pattern of expression in the case of cell-autonomous genes. However, since TO and KM and their pigment products are transported across cell membranes their effects can be manifest even in the absence of expression in the target tissue. For example, rosy mutant flies, mosaic for cells bearing a rosy-marked P element, have wild-type eye color even in the absence of rosy gene expression in the cells of the eye (REAUME et al. 1989 Down). Although these flies were true somatic mosaics rather than germline transformants showing variegation, the result (global effect from local expression) is the same. In contrast, in the cell-autonomous 3xP3-EGFP system, transgene expression in the eye is required for transformant selection.

A transformant selection system of this type requires a cloned functional eye-color gene and a corresponding loss-of-function mutant strain. Here we report the cloning and characterization of the Tribolium orthologs of vermilion (Tcv) and cinnabar (Tccn). We also report the identification of a white-eyed strain carrying a Tcv null mutation.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains:
The wild-type strains used in this work were as follows: (1) GA-1, a North American strain described by HALISCAK and BEEMAN 1983 Down; (2) GA-2, a near-homozygous inbred derivative of GA-1 (S. THOMPSON, J. STUART and S. BROWN, unpublished data); and (3) T-1, an Indian strain described by THOMPSON et al. 1995 Down. Wild-type flour beetles have pitch-black eye color. The recessive white-eyed mutation, white (w, EDDLEMAN and BELL 1963 Down), is shown in this work to be an allele of Tcv and is hereafter referred to as vermilionwhite (vw). Other eye-color mutant strains used in this work are shown in Table 1. Beetles were reared in yeast-fortified wheat flour under standard conditions (BEEMAN et al. 1986 Down).


 
View this table:
In this window
In a new window

 
Table 1. List of Tribolium eye-color mutants

Degenerate PCR:
Nested, degenerate primers were designed on the basis of highly conserved regions of the TO/Vermilion proteins (underlined in Fig 3). First-round PCR was performed using 6 ng of GA-1 genomic DNA with CAYGAYGARCAY and CCARAARTTRAANCC (all primer sequences are shown 5'–3'). Using 1 µl of first-round product as template, a second round of PCR was performed with the nested primers TAYGARYTNTGGTTYAARCA and CCNGGNGTNCKYTCNARCC to generate the pGv1 fragment.



View larger version (9K):
In this window
In a new window
Download PPT slide
 
Figure 1. Tc vermilion gene structure. This schematic indicates the location of the original Tc vermilion (Tcv) genomic clone (pGv1), as well as the Tcv cDNA clones (pC5'v, pC3'v, and pCv) and Tcv genomic clone (pGv2) in relationship to the Tcv locus. Arrows indicate the positions of the translational start sites, while asterisks mark the locations of the stop codons. Exons are represented as thick lines on cDNA clones. GenBank accession nos. are as follows: AYO52625 (pGv1), AYO52395 (pC5'v), AYO52394 (pC3'v), AYO52390 (pCv), and AYO52392 (pGv2).



View larger version (55K):
In this window
In a new window
Download PPT slide
 
Figure 2. Nucleotide sequence of the wild-type Tc vermilion locus. +1 indicates the start of the longest Tcv transcript detected. Proposed initiator sequences are underlined in the putative Tcv promoter (-200 to +20). Boldface type denotes a consensus downstream promoter element. Start and stop codons are boxed. The polyadenylation signal is double underlined and introns are shown in lowercase italics. All nucleotides upstream of the double-underlined base (in boldface type), following the last intron, are deleted in the vermilionwhite allele. GenBank accession nos. are AYO52392 (pGv2) and AF419847 (putative Tcv promoter).



View larger version (82K):
In this window
In a new window
Download PPT slide
 
Figure 3. Multiple alignment of tryptophan oxygenase sequences from Tribolium castaneum (Tc; GenBank accession no. AYO52390), Drosophila melanogaster (Dm; GenBank accession no. A34780), Anopheles gambiae (Ag; GenBank accession no. AAC27659), and Homo sapiens (Hs; GenBank accession no. P48775). Residues that are identical in all four species are in boldface type. Regions used for designing degenerate primers are underlined.

A similar strategy was used to amplify a portion of the Tribolium cinnabar ortholog. Nested degenerate primers were designed on the basis of highly conserved regions of the KM/Cinnabar proteins (underlined in Fig 6). First-round primers were AAYTAYYTNCAYATHTGGCC and RTARTTRTACATNGC, while the nested primers ACNTTYATGATGATHGC and CCNGCRTTCATNCCYTGNCC were used for a second round of PCR to generate the pGcn1 fragment.



View larger version (9K):
In this window
In a new window
Download PPT slide
 
Figure 4. Tc cinnabar gene structure. This schematic indicates the location of the original Tc cinnabar (Tccn) genomic clone (pGcn1), as well as the Tccn cDNA clones (pC5'cn, pC3'cn, and pCcn) and Tccn genomic clone (pGcn2) in relationship to the Tccn locus. Arrows indicate the positions of the translational start sites, while asterisks mark the locations of the stop codons. Exons are represented as thick lines on cDNA clones. GenBank accession nos. are as follows: AYO52623 (pGcn1), AYO52622 (pC5'cn), AYO52624 (pC3'cn), AYO52391 (pCcn), and AYO52393 (pGcn2).



View larger version (69K):
In this window
In a new window
Download PPT slide
 
Figure 5. Nucleotide sequence of the wild-type Tc cinnabar locus. +1 indicates the start of the longest Tccn transcript detected. In the putative Tccn promoter (-885 to +1) consensus TATA and CAAT boxes are in boldface type, while possible initiator sequences are underlined. Start and stop codons are boxed. Introns are shown in lowercase italics. The polyadenylation signal is double underlined. GenBank accession nos. are AYO52393 (pGcn2) and AF422805 (putative Tccn promoter).



View larger version (97K):
In this window
In a new window
Download PPT slide
 
Figure 6. Multiple alignment of kynurenine 3-monooxygenase sequences from Tribolium castaneum (Tc; GenBank accession no. AYO52391), Drosophila melanogaster (Dm; GenBank accession no. U56245), Bombyx mori (Bm; GenBank accession no. BAB62419), and Homo sapiens (Hs; GenBank accession no. AF056032). Residues that are identical in all four species are in boldface type, and regions used for designing degenerate primers are underlined.

Isolation of cDNA and genomic clones:
Approximately 3.6 ng of purified DNA from a T. castaneum embryonic cDNA library (see SHIPPY et al. 2000 Down) was used as template for rapid amplification of cDNA ends (RACE) using Tcv or Tccn gene-specific primers paired with pCMVSPORT4 vector primers. Nested, gene-specific primers were designed from the sequences of the pGv1 and pGcn1 clones. To obtain the 5' region of each cDNA, nested, gene-specific primers were used in conjunction with the SP6 vector primer. Similarly, the 3' ends of the Tcv and Tccn cDNAs were amplified using nested, gene-specific primers in conjunction with the T7 vector primer. Inserts of resulting clones were sequenced. Primers from the 5' and 3' untranslated regions (UTRs) were used to amplify Tcv (pCv) and Tccn (pCcn) cDNAs that included complete coding regions.

A GA-2 T. castaneum bacterial artificial chromosome (BAC) library constructed in pBACe3.6 (a gift from the Exelixis Pharmaceutical Co., South San Francisco) was screened to obtain full-length genomic clones of Tcv and Tccn. The Tcv and Tccn degenerate PCR products, pGv1 and pGcn1, were individually radiolabeled (Prime-It; Stratagene, La Jolla, CA). See Fig 1A and Fig 4A for the size and location of probes. After prehybridization for 3 hr at 65° in 5x Denhardt's buffer (0.5% SDS, 5x SSC, and 20 µg/µl herring sperm DNA) the filter was hybridized overnight at 65° with a mixture of the two 32P-labeled probes in fresh hybridization buffer and washed in 2x SSC, 0.1% SDS at 65°. Full-length Tcv and Tccn clones were subsequently identified by PCR using gene-specific primers.

Northern analysis:
Northern analysis of Tcv was performed as previously described by SHIPPY et al. 2000 Down, but using pupal rather than embryonic mRNA. The Tcv cDNA (pCv) was used as probe.

DNA sequencing and analysis:
BAC DNA templates were sequenced using the ThermoSequenase kit (Amersham Life Sciences, Cleveland). PCR products were gel purified (Prep-A-Gene DNA purification systems; Bio-Rad Laboratories, Hercules, CA) and cloned using the pCRII-TOPO kit (Invitrogen, Carlsbad, CA). Sequences from plasmid clones were obtained using an ABI 373A DNA sequencer (DNA Sequencing Core Facility, College of Veterinary Medicine, Kansas State University) or an ABI 3700 DNA sequencer (Sequencing and Genotyping Facility, Plant Pathology, Kansas State University). Data were analyzed using the MacVector sequence analysis program (Eastman Kodak Company, New Haven, CT).

RNA interference:
The MEGAscript SP6 and T7 in vitro transcription kits (Ambion, Austin, TX) were used to generate sense and anti-sense RNA from the Tcv cDNA, pCv. The combined RNAs were heated to 100° and allowed to slowly cool to room temperature (BROWN et al. 1999 Down). The same procedure was performed using the 1.66-kb Tccn genomic clone, pGcn. Double-stranded RNA from Tcv (1 µg/µl) or Tccn (0.5 µg/µl) was injected into wild-type (GA-1), 0- to 4-hr embryos (injection volume ~100 pl/embryo) in injection buffer (5 mM KCl, 1 mM KPO4, and 1% v/v green food coloring, pH 6.8). Injected embryos were incubated at room temperature for 1 week in a humidified, oxygenated chamber (Billups-Rothenberg, Del Mar, CA). Late-stage embryos and first instar larvae were screened for larval eyespot pigmentation.

Recombinational mapping:
Single-pair crosses were set up between GA-1 or T-1 virgin females and chestnut, hazel, platinum, ruby, or vw males. A single F1 virgin female from each line was backcrossed to the homozygous recessive male parent. The progeny from each backcross were sorted by eye-color phenotype as late-stage pupae, and single-beetle DNA isolations were performed using the Wizard Genomic DNA isolation kit (Promega, Madison, WI) according to the manufacturer's protocol. PCR products obtained using the Tcv-specific, exon 1 primer GACAGGTCGTAATGAGTTGCCCAC and the exon 3 primer ACGTCGCTGAAAATGTTG were analyzed on 2% agarose gels (for the vw backcross) or Novex precast 4–20% polyacrylamide TBE gels (for all others; Invitrogen). PCR products obtained using Tccn BAC-specific primers (ACGGGGTGGTCCATGAGTAATAA and TGAGGCGGCACAGAGAT) were analyzed on Novex precast 4–20% polyacrylamide TBE gels (Invitrogen). Dimorphic markers were scored, and recombination frequencies were calculated.

Southern analysis:
Two micrograms of genomic DNA was digested with EcoRI and electrophoresed overnight by field inversion gel electrophoresis (FIGE) on a 0.7% agarose gel. The DNA was transferred to a GeneScreen membrane (New England Nuclear Life Sciences, Boston), using a Turboblotter rapid downward transfer system (Schleicher & Schuell, Keene, NH). A 32P-labeled, 1.6-kb Tcv fragment (pGv2) was hybridized to the membrane overnight in PerfectHybPlus (Sigma, St. Louis) at 68°. The membrane was stripped at 65° and hybridized with a 32P-labeled, ~900-bp fragment containing the Tcv promoter and 5' coding region. The membrane was stripped again and another hybridization was performed with a 32P-labeled fragment containing the 3' end of the Tcv coding region. All hybridizations were performed as described above.

Deletion breakpoint analysis:
Eight nanograms of vw genomic DNA served as template for the first round of universal PCR, using a mixture of five universal primers (Uni-4, Uni-5, Uni-7, Uni-8, and Uni-9) and GSP1, the Tcv exon 6 primer TAGACAAGGGGGGGATGTAG. The primary PCR reaction (1 µl) was used as template for a second round of PCR with M13 (-40) (the linker sequence at the 5' ends of all five universal primers) and GSP2, the nested exon 6 primer CCGTGGTATCAAAAACGTC. The resulting PCR product was cloned and sequenced. For a complete list of the universal primer sequences and PCR conditions see BEEMAN and STAUTH 1997 Down.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Homology-based cloning of Tcv:
Analysis of Tcv genomic and cDNA clones is shown in Fig 1 and Fig 2. Degenerate primers based on conserved regions of vermilion orthologs amplified a 457-bp fragment from Tribolium genomic DNA (pGv1). On the basis of this genomic sequence, primers were designed for 5' and 3' RACE. The 5' clone (pC5'v) yielded 220 bp of additional upstream sequence, encompassing an apparent translational start site and 20 bp of 5' UTR. The 3' cDNA fragment (pC3'v) provided 774 bp of downstream sequence and a poly(A) tail. Primers designed in the 5' and 3' UTRs were used to amplify a cDNA containing the entire coding sequence. This cDNA (pCv) is 1343 bp in length and includes 11 bp of 5' UTR, 1164 bp of open reading frame (ORF), and 168 bp of 3' UTR. Alignment (PEARSON and LIPMAN 1988 Down) of mammalian and insect TO proteins (Fig 3) shows that the conceptual translation of pCv is 71% identical to Drosophila Vermilion and 56% identical to human TO. Conserved motifs previously identified by alignment of TO/Vermilion orthologs are also present in the Tribolium protein.

Tcv gene structure:
Northern analysis showed that a Tcv fragment (pCv) hybridized to a 1.55-kb transcript (pupal mRNA, data not shown), which corresponds to the length of the pCv cDNA (1343 bp), assuming a 200-bp poly(A) tail. Primers from the 5' and 3' UTRs of Tcv were used to amplify a genomic fragment (pGv2). Gene structure was determined by comparison of cDNA and genomic sequences (Fig 1 and Fig 2). Both the number and location of introns are highly conserved between the Drosophila (SEARLES et al. 1990 Down) and Tribolium vermilion genes. Both genes have five short introns that occur at identical or nearly identical positions. Both genes also appear to have very short 5' UTRs. The longest Tcv 5' UTR we could detect in Tribolium is 20 bp, while that of Drosophila is only 57 bp (FRIDELL and SEARLES 1992 Down).

Since the 5'-most cDNA fragment contained only 20 bp of 5' UTR, we sought to more accurately define the 5' end of Tcv by identifying the promoter. A T. castaneum genomic BAC library was probed with pGv1, and one positive clone was selected for analysis. A sequencing primer from the 5' UTR of Tcv was used to obtain 700 bp of upstream genomic sequence. This sequence was analyzed for the presence of promoter elements (Fig 2). No consensus TATA box was found, but several arthropod initiator sequences (Inrs; CHERBAS and CHERBAS 1993 Down) were identified. Ten Inrs are located within -140 to +1 (+1 corresponds to the 5'-most nucleotide of pC5'v), and a consensus downstream promoter element (DPE) is located at +14 (SMALE 1997 Down; Fig 2). FRIDELL and SEARLES 1992 Down used a series of deletion constructs to demonstrate that Drosophila v possesses important sequence motifs in the 5' UTR (between +19 and +36 and between +47 and +57 downstream of the transcription start site), without which transcription of the fly gene is silenced. Comparison of the 5' UTR of v to that of Tcv reveals similar motifs (data not shown). The presence in the Tcv 5' UTR of a putative DPE of (A/G)G(A/T)CGT (SMALE 1997 Down) and the lack of a TATA box within 700 bp upstream of the putative transcription start site suggest similarities between the promoters of fly and beetle vermilion genes (Fig 2). Taken together, the data suggest that pC5'v is derived from a full-length or nearly full-length transcript, and that, like Drosophila v (SEARLES et al. 1990 Down), Tcv is transcribed from a TATA-less promoter.

Homology-based cloning of Tccn:
Analysis of Tccn genomic and cDNA clones is shown in Fig 4 and Fig 5. PCR with degenerate primers based on conserved regions of cinnabar orthologs produced a 302-bp genomic fragment (pGcn1). Primers for 5' and 3' RACE were designed on the basis of this genomic sequence. The 5' clone (pC5'cn) provided an additional 721 bp of upstream sequence, including an apparent translational start site and 50 bp of 5' UTR. The 3' cDNA fragment (pC3'cn) provided 468 bp of downstream sequence and a poly(A) tail. Primers from the 5' and 3' UTRs were used to amplify a cDNA containing the entire coding sequence. This cDNA (pCcn) is 1421 bp in length and includes 50 bp of 5' UTR, a 1335-bp ORF, and 36 bp of 3' UTR. Alignment (PEARSON and LIPMAN 1988 Down) of mammalian and insect KM proteins (Fig 6) shows that the conceptual translation of pCcn is 53% identical to Bombyx KM, 51% identical to Drosophila KM, and 49% identical to human KM. All conserved motifs previously identified by alignment of KM/Cinnabar orthologs are present in the Tribolium protein.

Tccn gene structure:
A Tccn genomic fragment (pGcn2) was amplified and cloned using a method similar to that described above for Tcv. Gene structure was determined by comparison of cDNA and genomic sequences (Fig 4 and Fig 5). Unlike v, the number and locations of introns are not well conserved between the Drosophila and Tribolium cn genes. Tccn contains five small introns (Fig 4) while Drosophila cn has only two (WARREN et al. 1996 Down), with the location of only the first intron being conserved.

The longest ORF includes a methionine 11 residues downstream from a stop codon. However, it was possible that this clone did not represent the complete Tccn coding region, since the protein it encodes lacks ~81 amino acids present in the Drosophila protein. To determine whether the Tccn ORF contained a complete coding region a T. castaneum genomic BAC library was probed with pGcn1, and a sequencing primer from the 5' UTR of Tccn was used to obtain 1 kb of upstream genomic sequence from one of the positive clones. This sequence was analyzed for the presence of promoter elements (Fig 5). The Drosophila cinnabar (cn) gene is known to possess consensus CAAT and TATA boxes (WARREN et al. 1996 Down), the latter being located 134 bp upstream of the translation start site. While consensus CAAT and TATA boxes were found 1 kb upstream of the 5' end of the Tccn cDNA (Fig 5), analysis of the downstream sequence failed to reveal similarity to the amino-terminal extension observed in the Drosophila protein. No promoter motifs were detected in the intervening sequence. However, nine consensus Inrs (CHERBAS and CHERBAS 1993 Down) were identified between -170 and +1 (+1 is the 5'-most nucleotide of pC5'cn; Fig 5). These observations and the similarity in length, N-terminal to a region of sequence alignment, between the deduced amino acid sequences of Tccn and human and silkworm KM proteins suggest that the Tccn cDNA includes the complete coding region.

Correlation between larval eyespot pigmentation and adult eye color:
Tribolium larvae lack compound eyes. However, pigmented eyespots are visible in wild-type larvae and late-stage embryos. Mutants such as vw, pearl, and platinum, which exhibit white-eyed adult phenotypes, also lack larval eyespot pigmentation (see Table 1). The same is true for mutants with very light adult eye-color phenotypes, such as peach, pink, and ivory. Conversely, mutants such as hazel, ruby, and chestnut that have a less severe effect on adult eye color also retain detectable pigmentation in the larval eyespots. Thus, larval eyespot pigmentation is well correlated with adult eye color, and lack of larval eyespot pigmentation predicts a drastic reduction or complete loss of adult eye color. In the experiments described below, we use larval eyespot pigmentation to assess the effects of RNA interference (RNAi) and identify candidate mutants that might correspond to cloned eye-color genes.

RNA interference:
Either Tcv or Tccn dsRNA was injected into wild-type embryos to determine their loss-of-function phenotypes. After Tcv injection, 11of 22 late-stage embryos and newly hatched larvae lacked eyespot pigmentation (Fig 7A and Fig B). Injection of Tccn dsRNA resulted in complete loss of eyespot pigmentation in 6 of 19 newly hatched larvae (Fig 7C) and dramatically reduced pigmentation in 11 others. In both cases, the effect was transient, since wild-type eye color developed during pupation. Eyespot pigmentation was never affected by injection of dsRNA from genes not involved in eye-color pigmentation (>500 hatchlings examined) or mock injections with buffer alone (>1000 hatchlings examined). These results demonstrate that the Tcv and Tccn orthologs affect eye pigmentation in Tribolium and predict a null mutant phenotype with little or no adult eye color.



View larger version (65K):
In this window
In a new window
Download PPT slide
 
Figure 7. Effect of Tcv and Tccn RNA interference on eyespot pigmentation in Tribolium castaneum. (A–C) Lateral views of late-stage GA-1 embryos illustrate the effect of Tcv or Tccn dsRNA. (A) Wild-type eyespot pigmentation observed in late-stage GA-1 embryo. (B) A GA-1 embryo of the same age, but previousy injected with Tcv dsRNA. (C) A GA-1 embryo of the same age, but previously injected with Tccn dsRNA. Asterisks indicate the sites of injection (B, posterior; C, midline). Arrows indicate the locations of larval eyespots on the dorsal, lateral side of the head.

Tcv is tightly linked to white:
Tcv-related dimorphisms between eye-color mutant and wild-type (T-1) strains were identified by agarose gel or single-strand conformation polymorphism (SSCP) analysis of PCR products. These dimorphisms were used to assess linkage between Tcv and candidate eye-color mutations. Several eye-color mutations assorted independently of the Tcv-related dimorphism and are therefore eliminated as candidate alleles of the Tcv gene (data not shown). However, the h and vw mutations showed linkage to Tcv. Recombination occurred between Tcv and h in 3.4% (3/87) of the backcross progeny. No recombination (0/72) occurred between Tcv and the vw mutation. Thus, recombinational mapping identifies vw as the best candidate Tcv mutant.

Most of the Tcv locus is deleted in vw beetles:
Genomic DNA from the vw strain was analyzed by Southern hybridization for polymorphisms associated with the Tcv locus. A probe consisting of the 1.8-kb genomic fragment pGv2, which contains the entire Tcv coding region, identified a single, 8-kb EcoRI fragment in the wild-type GA-1 strain and the p and h mutant strains. However, the EcoRI fragment identified in vw DNA was >12 kb (Fig 8A). A second probe, complementary to the 3' end of the Tcv coding region, produced results identical to those seen with the full-length fragment (data not shown). However, a 900-bp fragment containing only the Tcv promoter and 5' coding region (exons 1–2 and part of 3), hybridized to wild-type, h, and p DNAs, but failed to hybridize to vw DNA (Fig 8B). These results suggest that vw beetles are homozygous for a deletion that removes the 5' end of Tcv.



View larger version (67K):
In this window
In a new window
Download PPT slide
 
Figure 8. Southern hybridization analysis of the Tc vermilion (Tcv) locus in strains of Tribolium castaneum. (A) Autoradiogram of blot after hybridization to the full-length Tcv probe pGv2. (B) Autoradiogram of the same blot after hybridization to a Tcv probe (VP461) containing the Tcv promoter and 5' coding region only (exons 1–2 and part of 3). Wild-type DNA (WT), vermilionwhite DNA (vw), hazel DNA (h), and pearl (p) DNA are shown. (C) Amplification of the vermilionwhite deletion breakpoint by universal PCR. GSP1 and GSP2 indicate the nested Tcv-specific primers complementary to a region near the 5' end of exon 6 and with their 3' ends facing upstream toward the deletion breakpoint. While the highly degenerate universal primer [uni-7, GGGTTTTCCAGTCACGAC(N)8GGATCC] can anneal to numerous sites within the genome, only those that anneal within ~1 kb upstream of the GSP primers will lead to amplification of the vw breakpoint. Slash marks indicate that the exact size of the deletion is unknown. The positions of the probes used for Southern analysis are indicated above the WT allele.

To confirm this, the putative Tcv deletion breakpoint was amplified from vw genomic DNA via universal PCR (Fig 8C). Sequence analysis of the PCR product (pGvw; GenBank accession no. AF419848) confirmed the presence of a rearrangement breakpoint in exon 6 (see Fig 2). The sequence immediately flanking the upstream side of the breakpoint is not derived from the Tcv locus. As expected, PCR primer pairs targeted to regions of the Tcv transcription unit upstream of the vw breakpoint amplify the expected fragment sizes from several wild-type strains but failed to produce a product from the vw strain (data not shown). Thus, ~80% of the Tcv coding region as well as the putative promoter, transcription start site, and translation start site are deleted in vw beetles.

Tccn is unlinked to known eye-color mutants:
Linkage between Tccn and candidate eye-color mutations was assessed by using Tccn-related dimorphisms between eye-color mutant and wild-type (T-1) strains identified by PCR or SSCP analysis. All eye-color mutations tested assorted independently of the dimorphisms (data not shown). Moreover, further mapping demonstrated that Tccn is located on linkage group 2 (R. W. BEEMAN, unpublished results) for which there is no known eye-color mutant (see Table 1).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Eye pigmentation in Tribolium:
Orthologs of the Drosophila eye-color genes vermilion and cinnabar were initially identified by degenerate PCR and further characterized by analysis of genomic and cDNA clones. In addition, a molecular lesion at the Tcv locus was identified in the white-eyed mutant vw. Tcv encodes Tryptophan oxygenase, the first enzyme in the ommochrome pathway.

Both pteridine and ommochrome pigments span a wide color spectrum in different insect species (LINZEN 1974 Down). In Drosophila melanogaster, both the brown ommochrome pigments and the reddish pteridine pigments are required to confer the red-brown color of the wild-type eye of this species. The loss of vermilion and concomitant knockout of the ommochrome pathway result in red-eyed flies. In contrast, the loss of ommochrome pigments via Tcv knockout in T. castaneum results in a complete loss of eye pigmentation, suggesting the presence of a single pigmentation pathway in this species. Several lines of evidence suggest that red ommochrome pigments are the principal contributors to the black eye color of wild-type T. castaneum. First, the available mutants display various shades of red eye color (see Table 1). Second, rescue of vw beetles by transient expression of Tcv results in pink to red adult eye color (M. D. LORENZEN, unpublished results). Finally, in independent transgenic lines, Tcv transgene expression in white-eyed vw recipients results in pink, red, or black adult eye color (M. D. LORENZEN, unpublished results).

Taken together, the phenotypes produced by Tcv RNAi, Tcv rescue, and the vw and other eye-color mutations suggest that the Tribolium larval eyespot and adult eye are pigmented only by red ommochromes, and that pteridine pigments do not contribute to eye color. This conclusion is not unprecedented, since the compound eyes of at least one other insect species (A. gambiae) are colored by ommochrome pigments only (BEARD et al. 1995 Down).

Eye-color genes as transformation markers:
Despite much effort, reliable and versatile methods for germline transformation in nondrosophilid insects have remained elusive. One obstacle has been the lack of efficient phenotypic markers for transformant identification. Most reports of nondrosophilid insect transformation have employed either white (ABC transporter) or GFP markers (ATKINSON et al. 2001 Down). EGFP is functional in all species tested and obviates the need for mutant recipient strains, but requires specialized detection systems. While dipteran white (w), cinnabar (cn), and vermilion (v) genes have not been demonstrated to function outside their taxonomic order of origin, they do show some ability to function in different dipteran families (WHITE et al. 1996 Down; CORNEL et al. 1997 Down; COATES et al. 1998 Down; JASINSKIENE et al. 1998 Down; ATKINSON et al. 2001 Down). This observation raises the hope that T. castaneum eye-color genes might function as broad-spectrum transformation markers in the order Coleoptera. With the cloning of the Tribolium ortholog of vermilion and the identification of a molecular lesion that eliminates most of the Tcv locus, we now have the components necessary to construct a transformation marker system on the basis of eye-color rescue. A separate report will summarize our recent efforts to develop piggyBac and Hermes-based transformation systems that utilize Tcv for transformant identification in Tribolium.


*  ACKNOWLEDGMENTS

We thank Exelixis Pharmaceutical Co. for preparing the T. castaneum genomic BAC library. We also thank Sue Haas, Beth Stone-Smith, Sara Brown, and Jeri Dickinson for their technical assistance. We thank Teresa Shippy for helpful discussions and critical reading of the manuscript. Funding for this work was provided by grants from the National Science Foundation (MCB-9630179), the National Institutes of Health (R01-HD29594), and the Kansas State Agricultural Experiment Station and was further supported by the Agricultural Research Service. This article is contribution no. 02-6-J from the Kansas Agricultural Experiment Station. All programs and services of the U.S. Department of Agriculture are offered on a nondiscriminatory basis, without regard to race, color, national origin, religion, sex, age, marital status, or handicap.

Manuscript received July 19, 2001; Accepted for publication October 22, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ATKINSON, P. W., A. C. PINKERTON, and D. A. O'BROCHTA, 2001  Genetic transformation systems in insects. Annu. Rev. Entomol. 46:317-346[Medline].

BAGLIONI, C., 1959  Genetic control of tryptophan peroxidase-oxidase in Drosophila melanogaster. Nature 184:1084-1085.

BALLIE, D. L. and A. CHOVNICK, 1971  Studies on the genetic control of tryptophan pyrrolase in Drosophila melanogaster. Mol. Gen. Genet. 112:341-353[Medline].

BARTLETT, A. C. and A. E. BELL, 1966  Ivory, an eye-color mutation in Tribolium castaneum. Ann. Entomol. Soc. Am. 59:865-866.

BEADLE, G. W. and B. EPHRUSSI, 1937  Development of eye colors in Drosophila: diffusible substances and their interrelations. Genetics 22:76-86[Free Full Text].

BEARD, C. B., M. Q. BENEDICT, J. P. PRIMUS, V. FINNERTY, and F. H. COLLINS, 1995  Eye pigments in wild-type and eye-color mutant strains of the African malaria vector Anopheles gambiae. J. Hered. 86:375-380[Abstract/Free Full Text].

BEEMAN, R. W. and D. M. STAUTH, 1997  Rapid cloning of insect transposon insertion junctions using ‘universal’ PCR. Insect Mol. Biol. 6:83-88[Medline].

BEEMAN, R. W., T. R. JOHNSON, and S. M. NANIS, 1986  Chromosome rearrangements in Tribolium castaneum. J. Hered. 77:451-456[Abstract/Free Full Text].

BERGHAMMER, A. J., M. KLINGLER, and E. A. WIMMER, 1999  A universal marker for transgenic insects. Nature 402:370[Medline].

BROWN, S. J., J. P. MAHAFFEY, M. D. LORENZEN, R. E. DENELL, and J. M. MAHAFFEY, 1999  Using RNAi to investigate orthologous homeotic gene function during development of distantly related insects. Evol. Dev. 1:11-15[Medline].

CHERBAS, L. and P. CHERBAS, 1993  The arthropod initiator: the capsite consensus plays an important role in transcription. Insect Biochem. Mol. Biol. 23:81-90[Medline].

COATES, C. J., N. JASINSKIENE, L. MIYASHIRO, and A. A. JAMES, 1998  Mariner transposition and transformation of the yellow fever mosquito, Aedes aegypti. Proc. Natl. Acad. Sci. USA 95:3742-3751.

CORNEL, A. J., M. Q. BENEDICT, C. SALAZAR RAFFERTY, A. J. HOWELLS, and F. H. COLLINS, 1997  Transient expression of the Drosophila melanogaster cinnabar gene rescues eye-color in the white eye (WE) strain of Aedes aegypti. Insect Biochem. Mol. Biol. 27:993-997[Medline].

DAWSON, P. S., 1967  A balanced lethal system in Tribolium castaneum. Heredity 22:435-438.

DEWEES, A. A., 1963 Frequency and relative fitness of some mutants involving the eye and body color in a natural population of Tribolium castaneum. M.A. Thesis, Southern Illinois University, Carbondale, Illinois.

EDDLEMAN, H. L. and A. E. BELL, 1963  Four new eye-color mutants in Tribolium castaneum (Abstr.). Genetics 48:888.

FRIDELL, Y. C. and L. L. SEARLES, 1992  In vivo transcriptional analysis of the TATA-less promoter of the Drosophila melanogaster vermilion gene. Mol. Cell. Biol. 12:4571-4577[Abstract/Free Full Text].

GHOSH, D. and H. S. FORREST, 1967  Enzymatic studies on the hydroxylation of kynurenine in Drosophila melanogaster. Genetics 55:423-431[Free Full Text].

HALISCAK, J. P. and R. W. BEEMAN, 1983  Status of malathion resistance in five genera of beetles infesting farm-stored corn, wheat, and oats in the United States. J. Econ. Entomol. 76:717-722.

HORN, C., B. JAUNICH, and E. A. WIMMER, 2000  Highly sensitive, fluorescent transformation marker for Drosophila transgenesis. Dev. Genes Evol. 210:623-629[Medline].

JASINSKIENE, N., C. J. COATES, M. Q. BENEDICT, A. J. CORNEL, and C. S. RAFFERTY et al., 1998  Stable transformation of the yellow fever mosquito, Aedes aegypti, with the Hermes element from the housefly. Proc. Natl. Acad. Sci. USA 95:3743-3747[Abstract/Free Full Text].

LINZEN, B., 1974  The tryptophan to ommochrome pathway in insects. Adv. Insect Physiol. 10:117-246.

O'BROCHTA, D. A. and A. M. HANDLER, 1988  Mobility of P elements in drosophilids and non-drosophilids. Proc. Natl. Acad. Sci. USA 85:6052-6056[Abstract/Free Full Text].

PARK, T., 1937  The inheritance of the mutation "pearl" in the flour beetle, Tribolium castaneum Herbst. Am. Nat. 71:143-157.

PEARSON, W. R. and D. J. LIPMAN, 1988  Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448[Abstract/Free Full Text].

PHILLIPS, J. P., and H. S. FORREST, 1980 Ommochromes and pteridines, pp. 542–623 in The Genetics and Biology of Drosophila, edited by M. ASHBURNER and T. R. F. WRIGHT. Academic Press, London.

REAUME, A. G., S. H. CLARK, and A. CHOVNICK, 1989  Xanthine dehydrogenase is transported to the Drosophila eye. Genetics 123:503-509[Abstract/Free Full Text].

RUBIN, G. M. and A. C. SPRADLING, 1982  Genetic transformation of Drosophila with transposable vectors. Science 218:348-353[Abstract/Free Full Text].

SEARLES, L. L., R. S. RUTH, A. M. PRET, R. A. FRIDELL, and A. J. ALI, 1990  Structure and transcription of the Drosophila vermilion gene and several mutant alleles. Mol. Cell. Biol. 10:1423-1431[Abstract/Free Full Text].

SHIPPY, T. D., S. J. BROWN, and R. E. DENELL, 2000  maxillopedia is the Tribolium ortholog of proboscipedia. Evol. Dev. 2:145-151[Medline].

SMALE, S. T., 1997  Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351:73-88[Medline].

THOMPSON, M. S., K. S. FRIESEN, R. E. DENELL, and R. W. BEEMAN, 1995  A hybrid incompatibility factor in Tribolium castaneum. J. Hered. 86:6-11[Abstract/Free Full Text].

WALKER, A. R., A. J. HOWELLS, and R. G. TEARLE, 1986  Cloning and characterization of the vermilion gene of Drosophila melanogaster. Mol. Gen. Genet. 202:102-107.

WARREN, W. D., S. PALMER, and A. J. HOWELLS, 1996  Molecular cloning of the cinnabar region of Drosophila melanogaster: identification of the cinnabar transcription unit. Genetica 98:249-262[Medline].

WHITE, L. D., C. J. COATES, P. W. ATKINSON, and D. A. O'BROCHTA, 1996  An eye-color gene for the detection of transgenic non-drosophilid insects. Insect Biochem. Mol. Biol. 26:641-644[Medline].

YAMADA, Y., 1961  Section on new mutants. Tribolium Inform. Bull. 5:13.




This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Arakane, J. Lomakin, R. W. Beeman, S. Muthukrishnan, S. H. Gehrke, M. R. Kanost, and K. J. Kramer
Molecular and Functional Analyses of Amino Acid Decarboxylases Involved in Cuticle Tanning in Tribolium castaneum
J. Biol. Chem., June 12, 2009; 284(24): 16584 - 16594.
[Abstract] [Full Text] [PDF]


Home page
Biol LettHome page
R. Leys, S. J.B Cooper, U. Strecker, and H. Wilkens
Regressive evolution of an eye pigment gene in independently evolved eyeless subterranean diving beetles
Biol Lett, December 22, 2005; 1(4): 496 - 499.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Pavlopoulos, A. J. Berghammer, M. Averof, and M. Klingler
Efficient Transformation of the Beetle Tribolium castaneum Using the Minos Transposable Element: Quantitative and Qualitative Analysis of Genomic Integration Events
Genetics, June 1, 2004; 167(2): 737 - 746.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
D. Zhong, A. Pai, and G. Yan
AFLP-Based Genetic Linkage Map for the Red Flour Beetle (Tribolium castaneum)
J. Hered., January 1, 2004; 95(1): 53 - 61.
[Abstract] [Full Text] [PDF]