- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lung, O.
- Articles by Wolfner, M. F.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lung, O.
- Articles by Wolfner, M. F.
The Drosophila melanogaster Seminal Fluid Protein Acp62F Is a Protease Inhibitor That Is Toxic Upon Ectopic Expression
Oliver Lung1,2,a, Uyen Tram1,3,a, Casey M. Finnertya, Marcie A. Eipper-Mainsa, John M. Kalb4,a, and Mariana F. Wolfneraa Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14853
Corresponding author: Mariana F. Wolfner, 423 Biotechnology Bldg., Cornell University, Ithaca, NY 14853., mfw5{at}cornell.edu (E-mail)
| ABSTRACT |
|---|
Drosophila melanogaster seminal fluid proteins stimulate sperm storage and egg laying in the mated female but also cause a reduction in her life span. We report here that of eight Drosophila seminal fluid proteins (Acps) and one non-Acp tested, only Acp62F is toxic when ectopically expressed. Toxicity to preadult male or female Drosophila occurs upon one exposure, whereas multiple exposures are needed for toxicity to adult female flies. Of the Acp62F received by females during mating,
10% enters the circulatory system while
90% remains in the reproductive tract. We show that in the reproductive tract, Acp62F localizes to the lumen of the uterus and the female's sperm storage organs. Analysis of Acp62F's sequence, and biochemical assays, reveals that it encodes a trypsin inhibitor with sequence and structural similarities to extracellular serine protease inhibitors from the nematode Ascaris. In light of previous results demonstrating entry of Acp62F into the mated female's hemolymph, we propose that Acp62F is a candidate for a molecule to contribute to the Acp-dependent decrease in female life span. We propose that Acp62F's protease inhibitor activity exerts positive protective functions in the mated female's reproductive tract but that entry of a small amount of this protein into the female's hemolymph could contribute to the cost of mating.
IN Drosophila melanogaster, secretions from the male accessory glands, the ejaculatory duct, and the ejaculatory bulb comprise the bulk of seminal fluid (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
There are
83 Acps, most of whose functions are presently unknown (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Acp62F is transferred to females during mating and
10% of the transferred Acp62F enters the female's hemolymph, thus giving it access to organs outside the reproductive tract (![]()
To ascertain what functions Acp62F might play and why it might be toxic to Drosophila, we used sequence analysis and homology modeling to predict Acp62F's biochemical function. We report here that Acp62F has sequence and structural similarity to a novel class of small extracellular serine protease inhibitors from Ascaris, parasitic roundworms that infect the intestinal tract of mammals (![]()
![]()
Protease inhibitors are present in the seminal fluid of many mammalian species [see, for example, human (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In light of Acp62F's presence in the reproductive tract and its protease inhibitory activity, we propose that Acp62F plays a beneficial role in regulating proteolysis in the genital tract. Given its entry into the female hemolymph (![]()
![]()
| MATERIALS AND METHODS |
|---|
Fly stocks:
All flies were maintained on a 12 hr light/dark cycle at 23° ± 2°. UAS-Acp lines for Acp29AB, Acp32CD, Acp33A, Acp53Ea, Acp62F, Acp63F/64A, and Acp95EF were generated as described below. UAS-Acp26Aa was described in ![]()
![]()
![]()
For germline transformation, full-length cDNAs including the predicted signal sequences for the Acps to be tested (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Preadult lethality assay:
To determine the preadult toxicity of each Acp, we induced its ectopic expression during larval and pupal development. All Acps and GFP were tested in parallel. Nine replicates were set for each line. For each replicate, four virgin UAS-Acp or UAS-GFP females were allowed to mate with four virgin hsp70-GAL4/CyO males overnight. The following day, the parents were removed and the number of eggs the females had laid were counted. Each of the nine replicates then followed a different heat-shock regimen. To control for effects resulting from low basal expression of the hsp70 promoter during development (![]()
![]()
Adult lethality assay:
To test for effects of Acp62F on adult viability, sibling Curly and non-Curly virgin female progeny from crosses of UAS-Acp62F virgin females (lines 2 and 4) to hsp70-GAL4/CyO males were subjected to heat shock (as above) on days 2, 4, 6, 8, 10, and 12 posteclosion. The number of surviving Curly and non-Curly flies was counted daily. The statistical significance of the survival distribution was assessed by a log-rank test.
Immunohistochemistry and confocal microscopy:
Reproductive tracts were dissected from unmated Canton-S (wild-type) females and from wild-type females 50 min after the start of mating to wild-type males and processed for immunohistochemistry as in ![]()
Recombinant protein production using baculovirus:
The entire Acp62F coding region including that of the signal sequence was amplified by PCR using the primers P62F5'Bam (CCGGGGATCCCTTCTATTACTTTTC) and P62F3'H6 (GCTAGCGGCCGCTTAGTGATGGTGATGGTGATGTGAACAGTTGTA). The 5' primer generated a BamHI site upstream of the start codon and the 3' primer generated a 6-His tag following the last codon. The PCR product was cloned into the pBacPac8 transfer vector (CLONTECH, Palo Alto, CA) to generate p62FH6BP. Site-directed mutagenesis was performed on p62FH6BP using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) to generate two single mutations (C59A and K61A) and a double mutation (C59A, C63A) with alanine replacements in the Acp62F coding region. The primers used for mutagenesis, with the changes underlined, are the following: C59A (GGCAATGGACCCGCCGTCAAGATGTG); K61A (GACCCTGCGTCGCGATGTGCGGAGC); and C59,63A (GGCAATGGACCCGCCGTCAAGATGGCCGGATCTCCTTG). The entire PCR-derived region and flanking sequences in each construct were sequenced to ensure that no nucleotide substitutions had occurred during PCR.
Recombinant baculovirus generation and protein expression were done as in ![]()
Sequence comparison and structure prediction:
All database searching was performed through the World Wide Web, using the predicted sequence of secreted Acp62F (amino acids 15115; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Structural homologs were identified by submitting the Acp62F sequence to the META PredictProtein server (http://www.embl-heidelberg.de/predictprotein/submit_meta.html; ![]()
![]()
![]()
![]()
Protease inhibition assay:
To test whether Acp62F-H6 could inhibit protease activity, protease inhibition assays were performed at least three times according to ![]()
30,0A405 of protein preincubated protease/
30,0A405 of buffer preincubated protease) x 100%. For assessment of the effects of disulfide bridges in Acp62F-H6, 5 µg of Acp62F-H6 (or buffer as control) was treated with 50 mM dithiothreitol (DTT) for 10 min at RT, prior to preincubation with trypsin.
Control proteins (BSA and lysozyme at similar concentrations as Acp62F-H6) did not inhibit trypsin activity at all, but instead caused a greater increase in A405 relative to buffer-pretreated trypsin, presumably due to reduced trypsin autolysis (![]()
[3H]Diisopropyl fluorophosphate (DFP) labeling:
A total of 10 µl (0.5 µg/µl) of wild-type Acp62F-H6 or K61A mutant protein (or buffer as control) was incubated with 5 µl of trypsin or elastase (0.1 µg/µl) for 30 min at RT. Then 2 µl [3H]DFP (NEN Life Sciences) was added and incubated for another 10 min. The resulting mixture was then subjected to SDS-PAGE analysis on a 12% polyacrylamide gel and to autoradiography, as in ![]()
| RESULTS |
|---|
Acp62F, but not other Acps tested, is toxic to Drosophila:
To identify Acps that may cause the reduction in the life span of mated females, we generated transgenic flies that ectopically express individual Acps using the GAL4/UAS system (![]()
![]()
For all non-Acp62F lines, both Curly and non-Curly adult flies emerged under non-heat-shock conditions. Approximately 78% of all eggs laid developed to adulthood (Fig 1A). The proportion of progeny emerging approximated the expected 50% Curly flies and 50% non-Curly flies in each case (Fig 1B and Table 1). In each category, males and females were approximately equally represented. This demonstrated that under non-heat-shock conditions, basal level expression of Acps or GFP, driven by the hsp70 promoter (![]()
|
|
Increased mortality was not observed when larvae or pupae were induced to express secretable Acp26Aa, Acp29AB, Acp32CD, Acp33A, Acp53Ea, Acp63F/64A, Acp95EF (Fig 1A), or GFP (data not shown). As under non-heat-shock conditions, the proportion of Curly to non-Curly flies approximated 50:50 in most of these lines when heat shock was applied during L1 (day 1), L2 (day 2), L3 (day 3 or 4), and P (day 5, 6, 7, or 9) of development (Fig 1B). While significant differences from the expected 50:50 ratio of Curly to non-Curly were occasionally observed, they occurred in only one of the two lines tested for each of these Acps (Table 1), suggesting that the effects are line specific rather than Acp specific. Thus, heat shock and expression of any of these seven Acp genes or GFP on any given day of development did not decrease survival to adulthood.
In contrast to the results for non-Acp62F genes, expression of Acp62F produced significantly fewer non-Curly adults or no non-Curly adults (Fig 1B and Table 1), even under non-heat-shock conditions (see below).
UAS-Acp62F lines 2 and 4: In contrast to the results for the other seven Acp genes and GFP, expression of Acp62F during preadult development significantly decreased viability. Under non-heat-shock conditions, the percentage of eggs that developed to adulthood was slightly lower for these lines (61 and 66%, respectively; Fig 1A) than for the other UAS-Acp constructs tested. Very few of the emerging adults were non-Curly (Fig 1B and Table 1), suggesting that low levels of Acp62F expression due to basal activity of the hsp70 promoter slightly depressed the viability of preadults.
A reduced percentage of Acp62F-expressing progeny survived to adulthood when the crosses were heat-shocked to induce Acp62F expression during L1 (day 1), L2 (day 2), L3 (day 3 or 4), and P (day 5, 6, 7, or 9). Compared to a 6166% survival rate under non-heat-shock conditions, the survival rate for heat-shocked animals was 41 to 51% (Fig 1A). Moreover, the majority (6997%) of adults emerging in these vials were Curly (rather than the 50% expected; Fig 1B and Table 1), suggesting that the reduction in survival was due to non-Curly animals being killed by expression of Acp62F prior to adulthood. When heat shock was applied during L3 (day 4) and P (day 5, 6, or 7), dead pupae were evident, a situation not observed in other hsp70-GAL4/CyO x UAS-Acp crosses. This indicated that expression of Acp62F on days 4 through 7 caused pupal lethality while expression earlier may have prevented the formation of pupae. More than 90% of the progeny were Curly when heat shock was applied during L2 (day 2), L3 (day 3 and 4) for line 2 and during L2 (day 2), L3 (day 3 and 4), and P (day 5, 6, 7, or 9) for line 4 (Table 1). Thus, overexpression of Acp62F on any day (1 through 7) of preadult development is toxic to D. melanogaster.
UAS-Acp62F lines 1 and 3: Surprisingly, progeny from hsp70-GAL4/CyO x UAS-Acp62F lines 1 or 3, even under non-heat-shock conditions, displayed much lower survival rates (43 and 29%, respectively) than other hsp70-GAL4/CyO x UAS-Acp crosses (Fig 1A). With UAS-Acp62F lines 1 and 3, only Curly adults emerged and dead pupae were not observed (Fig 1B and Table 1), indicating that lethality occurred prior to the pupal stage. The absence of non-Curly flies under non-heat-shock conditions suggested that basal expression from the hsp70 promoter might have killed these animals. However, since non-Curly hsp70-Gal4; UAS-62F lines 2 and 4 flies were obtained under non-heat-shock conditions, expression of Acp62F driven by the basal activity from the hsp70 promoter could not have been solely responsible for the death of hsp70-GAL4; UAS-62F animals from lines 1 or 3. Since the UAS-Acp62F lines 1 and 3 stocks themselves are viable, it is unlikely that the UAS-Acp62F construct inserted into the genome near an enhancer or promoter that drove its expression independently of GAL4 in these lines. It is more likely that the transgene inserted near a regulatory element that enhanced expression from the UAS element when it was activated at a low level, e.g., by low basal amounts of hsp-70-driven GAL4. In summary, ectopically expressed Acp62F is toxic to preadult D. melanogaster, and it is the only one of eight Acps tested (and GFP) to show this activity.
To determine whether Acp62F is toxic to adult female flies, we heat-shocked hsp70-GAL4; UAS-Acp62F (lines 2 and 4) adult virgin females on days 2, 4, 6, 8, 10, and 12 posteclosion. We observed no difference in mortality between Curly and non-Curly female adults when heat shock was applied only once. However, upon repeated heat shocks every other day, a significant decrease in viability is seen in the non-Cy flies (P < 0.0003, line 2; P < 0.0001, line 4; Fig 2). Results of lines 2 and 4 were equivalent in all respects. We cannot test lines 1 and 3 because non-Curly adults were not generated, even under non-heat-shock conditions. Preliminary results indicate that Acp62F is similarly toxic to males, indicating that males are not immune to Acp62F; normally this protein does not gain access to their hemolymph. Ectopic expression of Acp26Aa (![]()
![]()
![]()
|
Acp62F localization in the female reproductive tract:
The localization of a protein can provide insight into its function. We previously reported that
90% of the Acp62F transferred during mating remains within the female reproductive tract, while
10% enters the female's hemolymph from a specialized region of the reproductive tract (![]()
![]()
![]()
![]()
|
Sequence similarity, secondary structure, and threading reveal Acp62F's high similarity to Ascaris extracellular protease inhibitors:
To address which functions Acp62F might play in the female reproductive tract and why its ectopic expression might be toxic, we examined the Acp62F sequence for clues to its biochemical function (results summarized in Table 2). BLAST searching of the protein sequence databases using the sequence of secreted Acp62F (amino acids 15115) returned hits for proteins of dissimilar size, function, and/or distribution. It is apparent that the sequence similarity shared between Acp62F and the high-scoring hits, zonadhesin, Von Willebrand factor, and metallothioneins, was a result of the high Cys content (12%) in Acp62F. Because these proteins are either much larger than Acp62F or possess a different intracellular vs. extracellular location, we surmised that they do not represent true homologs.
|
In contrast, FASTA searching returned serine protease inhibitors from the nematode Ascaris as high-scoring hits. Four additional sequence comparison methods (see MATERIALS AND METHODS) also returned the Ascaris trypsin inhibitor as the top-scoring hit (Table 2), with scores for each method lending confidence to the significance of the match. The Acp62F sequence was also searched against known protein structures using the threading algorithm 123D (![]()
![]()
The protease inhibitors exhibiting similarity to Acp62F belong to a small family of structurally unique proteins with five disulfide bridges (![]()
![]()
![]()
|
The structures of Ascaris chymotrypsin/elastase inhibitor (ICE1_ASCU; ![]()
![]()
![]()
![]()
|
The multiple sequence alignment allowed identification of Acp62F's P1 reactive site residue, the primary determinant of protease inhibitor specificity (![]()
![]()
![]()
Acp62F inhibits trypsin in vitro:
To determine whether the sequence analysis results reflected biological activity, we tested whether Acp62F-H6 inhibits proteases in vitro. Our model above predicts that Acp62F would inhibit trypsin-like proteases particularly well and other proteases less well or not at all.
Preincubating trypsin with increasing concentrations of Acp62F-H6 prior to addition of substrate results in a dose-dependent inhibition of trypsin activity (Fig 6A). This inhibition is not seen with BSA and lysozyme controls (data not shown), indicating that trypsin inhibition is not due to substrate competition and that Acp62F-H6 is a trypsin inhibitor. However, in contrast to aprotinin, which can completely inhibit trypsin at a 1:1 molar ratio (data not shown), a higher 10:1 molar ratio of Acp62F to trypsin is needed for 95% inhibition (see Fig 6A). In similar assays using a 10:1 molar ratio of Acp62F to the protease, Acp62F-H6 showed a lower level of chymotrypsin inhibition (
50% inhibition, Fig 6C), and it did not inhibit elastase or thrombin (Fig 6B).
|
The lack of a hydrophobic core in the Ascaris protease inhibitors and the involvement of all 10 conserved Cys residues in disulfide bond formation suggest these disulfide bridges are structurally and functionally important. Consistent with this, reducing Acp62F-H6's disulfide bonds with DTT abolished its trypsin inhibitory activity (Fig 6A). To further confirm our prediction that Acp62F has a structure similar to that of Ascaris protease inhibitors, we generated site-directed mutations in Acp62F-H6 at the predicted P1 residue (K61A) or at one (C59A) or both of the cysteines flanking the predicted reactive site loop (C59,63A). Both the C59A and C59,63A mutations abolished Acp62F-H6's trypsin inhibitory activity in vitro (Fig 6C), indicating the importance of the conserved cysteine residues in Acp62F's protease inhibition activity. On the basis of the structure of the active site pockets of trypsin, chymotrypsin, and elastase, we predicted that substitution of Acp62F's P1 lysine with alanine would result in abolition of inhibition activity against trypsin and an increase in inhibition activity against elastase. The P1 position is occupied by an alanine in the Anasakis simplex elastase inhibitor AsPI-1 (![]()
![]()
Thus our mutagenesis and structural modeling results show that Acp62F most likely has a structure similar to the extracellular Ascaris protease inhibitors and that K61 is its reactive site P1 residue. To further confirm that residue 61 of Acp62F can interact directly with the active site of serine proteases, we examined whether Acp62F-H6 or the K61A mutant protein can inhibit binding of a specific active site inhibitor of serine esterases (diisofluorophosphate, or DFP) to trypsin and elastase, respectively. Consistent with our in vitro protease inhibitor assays, wild-type Acp62F-H6, but not the K61A mutant protein, inhibited [3H]DFP binding to trypsin (Fig 7, lanes 2 and 3). The reverse is true for elastase, where the K61A mutant, but not the wild-type protein, inhibited [3H]DFP binding (Fig 7, lanes 5 and 6). These results indicate that residue 61 is the P1 residue that interacts with the active sites of the proteases we tested.
|
| DISCUSSION |
|---|
Acp62F is the only Acp out of eight tested that is toxic to D. melanogaster when ectopically expressed. Ectopically expressed Acp62F is toxic to larvae and to pupae upon single exposure and to adults upon multiple exposure. In attempting to identify a molecular function for Acp62F that could account for this toxicity, we determined that Acp62F has both sequence and predicted structural similarity to a family of extracellular protease inhibitors from Ascaris. We showed in vitro that Acp62F has trypsin inhibitory activity and weak chymotrypsin inhibitory activity consistent with the molecular predictions. Given the importance of serine proteases in regulating biological processes, we propose that Acp62F's toxicity in the ectopic expression assay may be due to its protease inhibitor activity.
On the basis of its localization in the female reproductive tract and its predicted molecular function, we propose that Acp62F could perform a positive function in the reproductive tract, such as protecting sperm or other seminal fluid proteins from protease attack. Acp62F's presence in the female sperm storage organs suggests that it may function in protecting sperm. Seminal fluid protease inhibitors have been reported in several vertebrates, and they were proposed to perform regulatory roles. For example, bovine seminal plasma inhibitor BUSI-II localizes to the acrosomal region of epididymal spermatozoa and is thought to prevent premature acrosome reaction (![]()
![]()
![]()
![]()
![]()
![]()
In contrast to its potentially beneficial functions in the female reproductive tract, Acp62F's toxicity upon ectopic expression and its entry into the mated female's hemolymph make it a candidate for contributing to the cost of mating in females. Multiple matings decrease the life span of the mated female (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
If a cost of mating is associated with protease inhibition, it most likely would involve more than just Acp62F. At least eight potential secreted protease inhibitors are produced by the accessory glands (![]()
![]()
![]()
![]()
![]()
The hypothesis that Acp62F, and potentially other protease inhibitors from seminal fluid, are toxic to a Drosophila upon entry into her hemolymph raises the question of why this (these) seminal fluid Acp(s) have not been eliminated during evolution. It is interesting in this light that 20% of predicted Acps are predicted regulators of proteolysis (nine predicted proteases, eight predicted inhibitors) in 83 predicted Acps (![]()
![]()
![]()
One method to tune the amount or activity of seminal fluid protease inhibitors in the hemolymph would be to regulate Acp entry into the hemolymph. Preventing all Acp entry into hemolymph, however, would likely be disadvantageous, since at least some Acps appear to act through the hemolymph (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
2 Present address: Boyce Thompson Institute for Plant Research, Ithaca, NY 14853. ![]()
3 Present address: Department of Biology, University of California, Santa Cruz, CA 95064. ![]()
4 Present address: Department of Biology, Canisius College, Buffalo, NY 14208. ![]()
| ACKNOWLEDGMENTS |
|---|
The authors thank Drs. K. Kemphues, T. Huffaker, W. Swanson, and J. Calvo for comments on the manuscript. We thank Drs. G. Blissard, A. Karplus, M. Chang, J. Slack, T. Oomens, D. Garrity, P. Wang, and H. Jiang for advice or protocols and Y. Heifetz and M. Strawderman for statistical analysis. This work was supported by National Science Foundation grant IBN 97-23356 and subsequently by National Institutes of Health grant HD38921 to M.F.W. C. Finnerty was supported on NIH fellowship 1 F32 GM17673.
Manuscript received June 10, 2001; Accepted for publication October 22, 2001.
| LITERATURE CITED |
|---|
AGUADE, M., 1998 Different forces drive the evolution of the Acp26Aa and Acp26Ab accessory gland genes in the Drosophila melanogaster species complex. Genetics 150:1079-1089
AGUADE, M., 1999 Positive selection drives the evolution of the Acp29AB accessory gland protein in Drosophila. Genetics 152:543-551
AGUADE, M., N. MIYASHITA, and C. H. LANGLEY, 1992 Polymorphism and divergence in the Mst 335 male accessory gland gene region. Genetics 132:755-770[Abstract].
AIGAKI, T., I. FLEISCHMANN, P. S. CHEN, and E. KUBLI, 1991 Ectopic expression of sex peptide alters reproductive behavior of female D. melanogaster. Neuron 7:557-563[Medline].
ALEXANDROV, N. N., R. NUSSINOV and R. M. ZIMMER, 1996 Fast protein fold recognition via sequence to structure alignment and contact capacity potentials. Pac. Symp. Biocomput., pp. 5372.
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
BABIN, D. R., R. J. PEANASKY, and S. M. GOOS, 1984 The isoinhibitors of chymotrypsin/elastase from Ascaris lumbricoides: the primary structure. Arch. Biochem. Biophys. 232:143-161[Medline].
BAIRATI, A., 1968 Structure and ultrastructure of the male reproductive system of Drosophila melanogaster Meig. 2. The genital duct and accessory glands. Monit. Zool. Ital. 2:105-182.
BANIA, J., D. STACHOWIAK, and A. POLANOWSKI, 1999 Primary structure and properties of the cathepsin G/chymotrypsin inhibitor from the larval hemolymph of Apis mellifera. Eur. J. Biochem. 262:680-687[Medline].
BEGUN, D. J., P. WHITLEY, B. L. TODD, H. M. WALDRIP-DAIL, and A. G. CLARK, 2000 Molecular population genetics of male accessory gland proteins in Drosophila. Genetics 156:1879-1888
BRAND, A. H. and N. PERRIMON, 1993 Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415[Abstract].
BRANDEN, C., and J. TOOZE, 1991 Introduction to Protein Structure. Garland Publishing, New York.
CECHOVA, D. and H. FRITZ, 1976 Characterization of the proteinase inhibitors from bull seminal plasma and spermatozoa. Hoppe Seylers Z. Physiol. Chem. 357:401-408[Medline].
CHAPMAN, T., L. F. LIDDLE, J. M. KALB, M. F. WOLFNER, and L. PARTRIDGE, 1995 Cost of mating in Drosophila melanogaster females is mediated by male accessory gland products. Nature 373:241-244[Medline].
CHAPMAN, T., D. M. NEUBAUM, S. GILCHRIST, M. F. WOLFNER, and L. PARTRIDGE, 2000 The role of male Drosophila melanogaster seminal fluid proteins in sperm defence and displacement. Proc. R. Soc. Lond. B Biol. Sci. 267:1097-1105[Medline].
CHAPMAN, T., L. A. HERNDON, Y. HEIFETZ, L. PARTRIDGE, and M. F. WOLFNER, 2001 The Acp26Aa seminal fluid protein is a modulator of early egg hatchability in Drosophila melanogaster. Proc. R. Soc. Lond. B Biol. Sci. 268:1647-1654[Medline].
CHEN, P. S., E. STUMM-ZOLLINGER, T. AIGAKI, J. BALMER, and M. BIENZ et al., 1988 A male accessory gland peptide that regulates reproductive behavior of female D. melanogaster. Cell 54:291-298[Medline].
CHOSA, N., T. FUKUMITSU, K. FUJIMOTO, and E. OHNISHI, 1997 Activation of prophenoloxidase A1 by an activating enzyme in Drosophila melanogaster. Insect Biochem. Mol. Biol. 27:61-68[Medline].
CIRERA, S. and M. AGUADE, 1997 Evolutionary history of the sex-peptide (Acp70A) gene region in Drosophila melanogaster. Genetics 147:189-197[Abstract].
CLARK, A. G., M. AGUADÉ, T. PROUT, L. G. HARSHMAN, and C. H. LANGLEY, 1995 Variation in sperm displacement and its association with accessory gland protein loci in Drosophila melanogaster. Genetics 139:189-201[Abstract].
COFFMAN, M. A. and F. W. GOETZ, 1998 Trout ovulatory proteins are partially responsible for the anti-proteolytic activity found in trout coelomic fluid. Biol. Reprod. 59:497-502
COLEMAN, S., B. DRAHN, G. PETERSEN, J. STOLOROV, and K. KRAUS, 1995 A Drosophila male accessory gland protein that is a member of the serpin superfamily of proteinase inhibitors is transferred to females during mating. Insect Biochem. Mol. Biol. 25:203-207[Medline].
CORDEIRO, M., M. RICHARDSON, J. GILROY, S. GOMES DE FIGUEREIDO, and P. S. L. BEIRAO et al., 1995 Properties of the venom from the South American "armed" spider Phoneutria nigriventer. J. Toxicol.-Toxin Rev. 14:309-326.
DIBENEDETTO, A. J., D. M. LAKICH, W. D. KRUGER, J. M. BELOTE, and B. S. BAKER et al., 1987 Sequences expressed sex-specifically in Drosophila melanogaster adults. Dev. Biol. 119:242-251[Medline].
DIBENEDETTO, A. J., H. HARADA, and M. F. WOLFNER, 1990 Structure, cell-specific expression and mating-induced regulation of a Drosophila melanogaster male accessory gland gene. Dev. Biol. 139:134-148[Medline].
EDWARDS, K. A., M. DEMSKY, R. A. MONTAGUE, N. WEYMOUTH, and D. P. KIEHART, 1997 GFP-moesin illuminates actin cytoskeleton dynamics in living tissue and demonstrates cell shape changes during morphogenesis in Drosophila. Dev. Biol. 191:103-117[Medline].
FINK, E., C. HEHLEIN-FINK, and M. EULITZ, 1990 Amino acid sequence elucidation of human acrosin-trypsin inhibitor (HUSI-II) reveals that Kazal-type proteinase inhibitors are structurally related to beta-subunits of glycoprotein hormones. FEBS Lett. 270:222-224[Medline].
FISCHER, D. and D. EISENBERG, 1996 Protein fold recognition using sequence-derived predictions. Protein Sci. 5:947-955[Medline].
FOWLER, K. and L. PARTRIDGE, 1989 A cost of mating in female fruitflies. Nature 338:760-761.
GILBERT, D. G., 1981 Ejaculate esterase and initial sperm use by female Drosophila melanogaster. J. Insect Physiol. 27:641-650.
GLASER, R. L., M. F. WOLFNER, and J. T. LIS, 1986 Spatial and temporal pattern of hsp26 expression during normal development. EMBO J. 5:747-754[Medline].
GOODMAN, R. B. and R. J. PEANASKY, 1982 Isolation of the trypsin inhibitors in Ascaris lumbricoides var. suum using affinity chromatography. Anal. Biochem. 120:387-393[Medline].
GRASBERGER, B. L., G. M. CLORE, and A. M. GRONENBORN, 1994 High-resolution structure of Ascaris trypsin inhibitor in solution: direct evidence for a pH-induced conformational transition in the reactive site. Structure 2:669-678[Medline].
GREEN, C., E. LEVASHINA, C. MCKIMMIE, T. DAFFORN, and J. M. REICHHART et al., 2000 The necrotic gene in Drosophila corresponds to one of a cluster of three serpin transcripts mapping at 43A1.2. Genetics 156:1117-1127
GUEX, N. and M. C. PEITSCH, 1997 SWISS-MODEL and the Swiss-Pdb Viewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723[Medline].
HARSHMAN, L. G. and T. PROUT, 1994 Sperm displacement without sperm transfer in Drosophila melanogaster. Evolution 48:758-766.
HAWLEY, J. H. and R. J. PEANASKY, 1992 Ascaris suum: Are trypsin inhibitors involved in species specificity of Ascarid nematodes? Exp. Parasitol. 75:112-118[Medline].
HE, S., Y. L. LIN, and Y. X. LIU, 1999 Functionally inactive protein C inhibitor in seminal plasma may be associated with infertility. Mol. Hum. Reprod. 5:513-519
HEFFERON, K. L., A. G. P. OOMENS, S. A. MONSMA, C. M. FINNERTY, and G. W. BLISSARD, 1999 Host cell receptor binding by baculovirus GP64 and kinetics of virion entry. Virology 258:455-468[Medline].
HEIFETZ, Y., O. LUNG, E. A. FRONGILLO, and M. F. WOLFNER, 2000 The role of seminal fluid proteins in the stimulation of ovulation and egg-production in D. melanogaster. Curr. Biol. 10:99-102[Medline].
HEIFETZ, Y., U. TRAM, and M. F. WOLFNER, 2001 Male contributions to egg production: the role of accessory gland products and sperm in Drosophila melanogaster. Proc. R. Soc. Lond. B Biol. Sci. 268:175-180[Medline].
HERNDON, L. A. and M. F. WOLFNER, 1995 A Drosophila seminal fluid protein, Acp26Aa, stimulates egglaying in females for 1 day after mating. Proc. Natl. Acad. Sci. USA 92:10114-10118
HÖRLER, E. and H. BRIEGEL, 1997 Chymotrypsin inhibitors in mosquitoes: activity profile during development and after blood feeding. Arch. Insect Biochem. Physiol. 36:315-333[Medline].
HUANG, K., N. C. STRYNADKA, V. D. BERNARD, R. J. PEANASKY, and M. N. JAMES, 1994 The molecular structure of the complex of Ascaris chymotrypsin/elastase inhibitor with porcine elastase. Structure 2:679-689[Medline].
IRWIN, M., N. NICHOLSON, J. T. HAYWOOD, and G. R. POIRIER, 1983 Immunofluorescent localization of a murine seminal vesicle proteinase inhibitor. Biol. Reprod. 28:1201-1206[Abstract].
JIANG, H., Y. WANG, and M. R. KANOST, 1998 Pro-phenol oxidase activating proteinase from an insect, Manduca sexta: a bacteria-inducible protein similar to Drosophila easter. Proc. Natl. Acad. Sci. USA 95:12220-12225
KALB, J., A. J. DIBENEDETTO, and M. F. WOLFNER, 1993 Probing the function of Drosophila melanogaster accessory glands by directed cell ablation. Proc. Natl. Acad. Sci. USA 90:8093-8097
KANOST, M. R., 1999 Serine proteinase inhibitors in arthropod immunity. Dev. Comp. Immunol. 23:291-301[Medline].
KARPLUS, K., C. BARRETT, and R. HUGHEY, 1998 Hidden Markov models for detecting remote protein homologies. Bioinformatics 14:846-856
KISE, H., J. NISHIOKA, J. KAWAMURA, and K. SUZUKI, 1996 Characterization of semenogelin II and its molecular interaction with prostate-specific antigen and protein C inhibitor. Eur. J. Biochem. 238:88-96[Medline].
LESSLEY, B. A. and K. I. BROWN, 1978 Purification and properties of a proteinase inhibitor from chicken seminal plasma. Biol. Reprod. 19:223-234[Abstract].
LEVASHINA, E. A., E. LANGLEY, C. GREEN, D. GUBB, and M. ASHBURNER et al., 1999 Constitutive activation of Toll-mediated antifungal defense in serpin-deficient Drosophila. Science 285:1917-1919
LU, C. C., T. NGUYEN, S. MORRIS, D. HILL, and J. SAKANARI, 1998 Anisakis simplex: mutational bursts in the reactive site centers of serine protease inhibitors from an Ascarid nematode. Exp. Parasitol. 89:257-261[Medline].
LUNG, O. and M. F. WOLFNER, 1999 Drosophila seminal fluid proteins enter the circulatory system through the walls of the posterior vagina. Insect Biochem. Mol. Biol. 29:1043-1052[Medline].
MAROUX, S. and P. DESNUELLE, 1969 On some autolyzed derivatives of bovine trypsin. Biochim. Biophys. Acta 181:59-72[Medline].
MASON, P. J., L. M. C. HALL, and J. GAUSZ, 1984 The expression of heat shock genes during development in Drosophila melanogaster. Mol. Gen. Genet. 194:73-78.
MIGNOGNA, G., S. PASCARELLA, C. WECHSELBERGER, C. HINTERLEITNER, and C. MOLLAY et al., 1996 BSTI, a trypsin inhibitor from skin secretions of Bombina bombina related to protease inhibitors of nematodes. Protein Sci. 5:357-362[Medline].
MONSMA, S. A. and M. F. WOLFNER, 1988 Structure and expression of a Drosophila male accessory gland gene whose product resembles a peptide pheromone precursor. Genes Dev. 2:1063-1073
MURER, V., J. F. SPETZ, U. HENGST, L. M. ALTROGGE, and A. DE AGOSTINI et al., 2001 Male fertility defects in mice lacking the serine protease inhibitor protease nexin-1. Proc. Natl. Acad. Sci. USA 98:3029-3033
NAKAYAMA, S., K. KAISER, and T. AIGAKI, 1997 Ectopic expression of sex-peptide in a variety of tissues in Drosophila females using the P[GAL4] enhancer-trap system. Mol. Gen. Genet. 254:449-455[Medline].
NEUBAUM, D. M. and M. F. WOLFNER, 1999 Mated Drosophila melanogaster females requires a seminal fluid protein, Acp36DE, to store sperm efficiently. Genetics 153:845-857
PARK, M. and M. F. WOLFNER, 1995 Male and female cooperate in the prohormone-like processing of a Drosophila melanogaster seminal fluid protein. Dev. Biol. 171:694-702[Medline].
PARK, S. and J. K. LIM, 1995 A microinjection technique for ethanol-treated eggs and a mating scheme for detection of germ line transformants. Dros. Inf. Serv. 76:197-199.
PEANASKY, R. J., Y. BENTZ, G. A. HOMANDBERG, S. T. MINOR, and D. R. BABIN, 1984 The isoinhibitors of chymotrypsin/elastase from Ascaris lumbricoides: the reactive site. Arch. Biochem. Biophys. 232:135-142[Medline].
PEARSON, W. R. and D. J. LIPMAN, 1988 Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448
RICE, W. R., 1996 Sexually antagonistic male adaptation triggered by experimental arrest of female evolution. Nature 381:232-234[Medline].
ROBERT, M. and C. GAGNON, 1999 Semenogelin I: a coagulum forming, multifunctional seminal vesicle protein. Cell. Mol. Life Sci. 55:944-960[Medline].
ROBINSON, R., R. RICHARSON, K. HINDS, D. CLAYTON, and G. R. POIRIER, 1987 Features of a seminal proteinase inhibitor- zona pellucida-binding component on murine spermatozoa. Gamete Res. 16:217-228[Medline].
ROST, B., 1996 PHD: predicting one-dimentional protein structure by profile-based neural networks. Methods Enzymol. 266:525-539[Medline].
ROST, B. and C. SANDER, 1993 Prediction of protein secondary structure at better than 70% accuracy. J. Mol. Biol. 232:584-599[Medline].
ROST, B. and C. SANDER, 1994 Combining evolutionary information and neural networks to predict protein secondary structure. Proteins 19:55-72[Medline].
ROST, B., C. SANDER, and R. SCHNEIDER, 1994 PHD-an automatic mail server for protein secondary structure prediction. Comput. Appl. Biosci. 10:53-60
SCHÄFER, U., 1986 Genes for male-specific transcripts in Drosophila melanogaster. Mol. Gen. Genet. 202:219-225.
SCHECHTER, I. and A. BERGER, 1967 On the size of the active site in proteases. I. Papain. Biochem. Biophys. Res. Commun. 27:157-162[Medline].
SCHIESSLER, H., E. FINK, and H. FRITZ, 1976 Acid-stable proteinase inhibitors from human seminal plasma. Methods Enzymol. 45:847-859[Medline].
SCHMIDT, T., E. STUMM-ZOLLINGER, and P. S. CHEN, 1989 A male accessory gland peptide with protease inhibitory activity in Drosophila funebris. J. Biol. Chem. 264:9745-9749
SIMMERL, E., M. SCHÄFER, and U. SCHÄFER, 1995 Structure and regulation of a gene cluster for male accessory gland transcripts in Drosophila melanogaster. Insect Biochem. Mol. Biol. 25:127-137[Medline].
SOLLER, M., M. BOWNES, and E. KUBLI, 1997 Mating and sex peptide stimulate the accumulation of yolk in oocytes of Drosophila melanogaster. Eur. J. Biochem. 243:732-738[Medline].
SOLLER, M., M. BOWNES, and E. KUBLI, 1999 Control of oocyte maturation in sexually mature Drosophila females. Dev. Biol. 208:337-351[Medline].
SWANSON, W. J., A. G. CLARK, H. WALDRIP-DAIL, M. F. WOLFNER, and C. F. AQUADRO, 2001 Evolutionary ESTs, a method to identify rapidly evolving genes, and its application to Drosophila reproductive proteins. Proc. Natl. Acad. Sci. USA 98:7375-7379
TRAM, U. and M. F. WOLFNER, 1999 Male seminal fluid proteins are essential for sperm storage in Drosophila melanogaster. Genetics 153:837-844
TSAUR, S. C. and C.-I WU, 1997 Positive selection and molecular evolution of a gene of male reproduction, Acp26Aa of Drosophila. Mol. Biol. Evol. 14:544-549[Abstract].
TSAUR, S. C., C. T. TING, and C.-I WU, 1998 Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila: II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046[Abstract].
TSAUR, S. C., C. T. TING, and C.-I WU, 2001 Sex in Drosophila mauritiana: a very high level of amino acid polymorphism in a male reproductive protein gene, Acp26Aa. Mol. Biol. Evol. 18:22-26
VESELSKY, L. and D. CECHOVA, 1980 Distribution of acrosin inhibitors in bull reproductive tissues and spermatozoa. Hoppe Seylers Z. Physiol. Chem. 361:715-722[Medline].
VESELSKY, L., V. JONAKOVA, and D. CECHOVA, 1985 A Kunitz type of proteinase inhibitor isolated from boar seminal vesicle fluid. Andrologia 17:352-358[Medline].
VON FELLENBERG, R., H. R. ZWEIFEL, G. GRUNIG, and A. PELLEGRINI, 1985 Proteinase inhibitors of horse seminal plasma. A high molecular mass, acid-soluble proteinase inhibitor. Biol. Chem. Hoppe Seyler 366:705-712[Medline].
WATT, K W., P. J. LEE, T. M'TIMKULU, W. P. CHAN, and R. LOOR, 1986 Human prostate-specific antigen: structural and functional similarity with serine proteases. Proc. Natl. Acad. Sci. USA 83:3166-3170
WOLFNER, M. F., H. A. HARADA, M. J. BERTRAM, T. J. STELICK, and K. W. KRAUS et al., 1997 New genes for male accessory gland proteins in Drosophila melanogaster. Insect Biochem. Mol. Biol. 27:825-834[Medline].
XUE, L. and M. NOLL, 2000 Drosophila female sexual behavior induced by sterile males showing copulation complementation. Proc. Natl. Acad. Sci. USA 97:3272-3275
YEH, E., K. GUSTAFSON, and G. L. BOULIANNE, 1995 Green fluorescent protein as a vital marker and reporter of gene expression in Drosophila. Proc. Natl. Acad. Sci. USA 92:7036-7040
This article has been cited by other articles:
![]() |
M. F. Wolfner Battle and Ballet: Molecular Interactions between the Sexes in Drosophila J. Hered., July 1, 2009; 100(4): 399 - 410. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wong, S. N. Albright, J. D. Giebel, K. R. Ram, S. Ji, A. C. Fiumera, and M. F. Wolfner A Role for Acp29AB, a Predicted Seminal Fluid Lectin, in Female Sperm Storage in Drosophila melanogaster Genetics, October 1, 2008; 180(2): 921 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Almeida and R. DeSalle Evidence of Adaptive Evolution of Accessory Gland Proteins in Closely Related Species of the Drosophila repleta Group Mol. Biol. Evol., September 1, 2008; 25(9): 2043 - 2053. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. McGraw, A. G. Clark, and M. F. Wolfner Post-mating Gene Expression Profiles of Female Drosophila melanogaster in Response to Time and to Four Male Accessory Gland Proteins Genetics, July 1, 2008; 179(3): 1395 - 1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Mueller, J. R. Linklater, K. Ravi Ram, T. Chapman, and M. F. Wolfner Targeted Gene Deletion and Phenotypic Analysis of the Drosophila melanogaster Seminal Fluid Protease Inhibitor Acp62F Genetics, March 1, 2008; 178(3): 1605 - 1614. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wong, M. C. Turchin, M. F. Wolfner, and C. F. Aquadro Evidence for Positive Selection on Drosophila melanogaster Seminal Fluid Protease Homologs Mol. Biol. Evol., March 1, 2008; 25(3): 497 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Allen and A. C. Spradling The Sf1-related nuclear hormone receptor Hr39 regulates Drosophila female reproductive tract development and function Development, January 15, 2008; 135(2): 311 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Ramm, P. L. Oliver, C. P. Ponting, P. Stockley, and R. D. Emes Sexual Selection and the Adaptive Evolution of Mammalian Ejaculate Proteins Mol. Biol. Evol., January 1, 2008; 25(1): 207 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Dottorini, L. Nicolaides, H. Ranson, D. W. Rogers, A. Crisanti, and F. Catteruccia A genome-wide analysis in Anopheles gambiae mosquitoes reveals 46 male accessory gland genes, possible modulators of female behavior PNAS, October 9, 2007; 104(41): 16215 - 16220. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Wagstaff and D. J. Begun Adaptive Evolution of Recently Duplicated Accessory Gland Protein Genes in Desert Drosophila Genetics, October 1, 2007; 177(2): 1023 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ravi Ram and M. F. Wolfner Seminal influences: Drosophila Acps and the molecular interplay between males and females during reproduction Integr. Comp. Biol., September 1, 2007; 47(3): 427 - 445. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. N. Lawniczak and D. J. Begun Molecular population genetics of female-expressed mating-induced serine proteases in Drosophila melanogaster Mol. Biol. Evol., September 1, 2007; 24(9): 1944 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M Fedorka, J. E Linder, W. Winterhalter, and D. Promislow Post-mating disparity between potential and realized immune response in Drosophila melanogaster Proc R Soc B, May 7, 2007; 274(1614): 1211 - 1217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Mueller, J. L. Page, and M. F. Wolfner An Ectopic Expression Screen Reveals the Protective and Toxic Effects of Drosophila Seminal Fluid Proteins Genetics, February 1, 2007; 175(2): 777 - 783. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ravi Ram, L. K. Sirot, and M. F. Wolfner Predicted seminal astacin-like protease is required for processing of reproductive proteins in Drosophila melanogaster PNAS, December 5, 2006; 103(49): 18674 - 18679. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Panhuis and W. J. Swanson Molecular Evolution and Population Genetic Analysis of Candidate Female Reproductive Genes in Drosophila Genetics, August 1, 2006; 173(4): 2039 - 2047. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M Panhuis, N. L Clark, and W. J Swanson Rapid evolution of reproductive proteins in abalone and Drosophila Phil Trans R Soc B, February 28, 2006; 361(1466): 261 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ford, D. B. Guiliano, Y. Oksov, A. K. Debnath, J. Liu, S. A. Williams, M. L. Blaxter, and S. Lustigman Characterization of a Novel Filarial Serine Protease Inhibitor, Ov-SPI-1, from Onchocerca volvulus, with Potential Multifunctional Roles during Development of the Parasite J. Biol. Chem., December 9, 2005; 280(49): 40845 - 40856. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A Maklakov, N. Kremer, and G. Arnqvist Adaptive male effects on female ageing in seed beetles Proc R Soc B, December 7, 2005; 272(1580): 2485 - 2489. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Mueller, K. R. Ram, L. A. McGraw, M. C. Bloch Qazi, E. D. Siggia, A. G. Clark, C. F. Aquadro, and M. F. Wolfner Cross-Species Comparison of Drosophila Male Accessory Gland Protein Genes Genetics, September 1, 2005; 171(1): 131 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jagadeeshan and R. S. Singh Rapidly Evolving Genes of Drosophila: Differing Levels of Selective Pressure in Testis, Ovary, and Head Tissues Between Sibling Species Mol. Biol. Evol., September 1, 2005; 22(9): 1793 - 1801. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Wagstaff and D. J. Begun Comparative Genomics of Accessory Gland Protein Genes in Drosophila melanogaster and D. pseudoobscura Mol. Biol. Evol., April 1, 2005; 22(4): 818 - 832. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Heifetz, L. N. Vandenberg, H. I. Cohn, and M. F. Wolfner Two cleavage products of the Drosophila accessory gland protein ovulin can independently induce ovulation PNAS, January 18, 2005; 102(3): 743 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Fiumera, B. L. Dumont, and A. G. Clark Sperm Competitive Ability in Drosophila melanogaster Associated With Variation in Male Reproductive Proteins Genetics, January 1, 2005; 169(1): 243 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Swanson, A. Wong, M. F. Wolfner, and C. F. Aquadro Evolutionary Expressed Sequence Tag Analysis of Drosophila Female Reproductive Tracts Identifies Genes Subjected to Positive Selection Genetics, November 1, 2004; 168(3): 1457 - 1465. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Mueller, D. R. Ripoll, C. F. Aquadro, and M. F. Wolfner Comparative structural modeling and inference of conserved protein classes in Drosophila seminal fluid PNAS, September 14, 2004; 101(37): 13542 - 13547. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Arbeitman, A. A. Fleming, M. L. Siegal, B. H. Null, and B. S. Baker A genomic analysis of Drosophila somatic sexual differentiation and its regulation Development, May 1, 2004; 131(9): 2007 - 2021. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Morrow, G. Arnqvist, and S. Pitnick Adaptation versus pleiotropy: why do males harm their mates? Behav. Ecol., November 1, 2003; 14(6): 802 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Swanson Sex peptide and the sperm effect in Drosophila melanogaster PNAS, August 19, 2003; 100(17): 9643 - 9644. [Full Text] [PDF] |
||||
![]() |
T. Chapman, J. Bangham, G. Vinti, B. Seifried, O. Lung, M. F. Wolfner, H. K. Smith, and L. Partridge From the Cover: The sex peptide of Drosophila melanogaster: Female post-mating responses analyzed by using RNA interference PNAS, August 19, 2003; 100(17): 9923 - 9928. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lung, O.
- Articles by Wolfner, M. F.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lung, O.
- Articles by Wolfner, M. F.















