- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mejlumian, L.
- Articles by Terzian, C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mejlumian, L.
- Articles by Terzian, C.
Comparative and Functional Studies of Drosophila Species Invasion by the gypsy Endogenous Retrovirus
Lucine Mejlumiana, Alain Pélissona, Alain Buchetona, and Christophe Terzianaa Institut de Génétique Humaine, 34396 Montpellier Cedex 5, France
Corresponding author: Christophe Terzian, 141 rue de la Cardonille, 34396 Montpellier Cedex 5, France., terzian{at}igh.cnrs.fr (E-mail)
Communicating editor: M. VEUILLE
| ABSTRACT |
|---|
Gypsy is an endogenous retrovirus of Drosophila melanogaster. Phylogenetic studies suggest that occasional horizontal transfer events of gypsy occur between Drosophila species. gypsy possesses infective properties associated with the products of the envelope gene that might be at the origin of these interspecies transfers. We report here the existence of DNA sequences putatively encoding full-length Env proteins in the genomes of Drosophila species other than D. melanogaster, suggesting that potentially infective gypsy copies able to spread between sexually isolated species can occur. The ability of gypsy to invade the genome of a new species is conditioned by its capacity to be expressed in the naive genome. The genetic basis for the regulation of gypsy activity in D. melanogaster is now well known, and it has been assigned to an X-linked gene called flamenco. We established an experimental simulation of the invasion of the D. melanogaster genome by gypsy elements derived from other Drosophila species, which demonstrates that these non- D. melanogaster gypsy elements escape the repression exerted by the D. melanogaster flamenco gene.
RETROELEMENTS form a large and diverse class of mobile elements that can be found in all eukaryotes. The structural organization of retroelements reflects their common mechanism of replication: They propagate by reverse transcription of RNA intermediates and integrate their genetic information into the genome of a host cell. Their presence in all organisms suggests that they are very ancient. Several lines of evidence, such as their regulation and putative domestication by the host, indicate that the transposable elements and particularly retroelements (REs) can co-evolve with the host genome. Comparison of the phylogenies of retroelements and of their hosts provides a reliable background for the study of their evolutionary history. In particular, the mechanisms responsible for their distribution and their impact on the host genome can be explored.
Gypsy (DmeGypV) is an endogenous retrovirus of Drosophila melanogaster, showing a genomic structure remarkably similar to the proviral form of vertebrate retroviruses (Fig 1) and exhibiting infectious properties in particular conditions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
However, the ability of gypsy to invade the genome of a new species is conditioned by its capacity to be expressed in this species. The genetic basis for the regulation of gypsy activity is now well known, and it has been assigned to an X-linked gene called flamenco (![]()
![]()
![]()
We analyzed two regions of gypsy, known to be critical for the tissue-specific tropism of retroviruses: (i) the 5' regulatory region containing both the 5' long terminal repeat (LTR) and the untranslated leader region (ULR), which drives the expression of gypsy and is controlled by flamenco (![]()
| MATERIALS AND METHODS |
|---|
Fly stocks:
w1118(R) is the laboratory white reference stock described in ![]()
![]()
![]()
All non-melanogaster Drosophila species were kindly provided by Françoise Lemeunier (Centre National de la Recherche Scientifique, Gif-sur-Yvette, France). The OR(721)/FM3 D. melanogaster strain (![]()
PCR primers and conditions:
The primers used for env amplification from the melanogaster subgroup species were designed from the gypsy sequence (M12927). The upstream primer was positioned at the beginning of ORF3 and permitted to start transcription at the underlined ATG: 5' GGATCCTAATACGACTCACTATAGGAACAGACCACCATGTTCATACCCTTGGTAG 3'. The upstream primers used for env amplification from D. subobscura (5' GGATCCTAATACGACTCACTATAGGAACAGACCACCATGTTTGTACTCACTTTACT 3') and D. virilis (5' GGATCCTAATACGACTCACTATAGGAACAGACCACCATGTTCGTCCATTTCAAATT 3') were based on the DsuGypV and DviGypV published sequences (GenBank accession nos.
X72390 and
M38438, respectively) and contained the trinucleotide ATG (underlined) upstream in the env sequence in order to create a start codon, which is normally generated by RNA splicing (![]()
![]()
The three downstream primers were positioned into the 3' LTR of DmeGypV (5' GGCGATAGCGATTTGATTGTAAA 3') and DviGypV (5' TTATCTTGGGTAAGTTGCGTTGA 3'), and at the 3' end of the DsuGypV env gene (5' TCAGAATGATGACCGTCC 3') to amplify complete env sequences.
Reaction volumes were 50 µl and contained 50 ng template DNA and 2.5 units Taq DNA polymerase (Promega, Madison, WI). Reaction parameters were as follows: 3 cycles of 93° for 45 sec, 45° for 45 sec, 72° for 3 min; 25 cycles of 93° for 30 sec, 61° (56° for D. virilis) for 30 sec, 72° for 2 min, followed by 72° for 10 min.
A primer pair was designed (upper 5' TCGCATGCCAACTACATT 3', lower 5' AGGCTCGTCTTCTCCTTA 3') according to regions conserved between DmeGypV, DsuGypV, and DviGypV Env sequences to amplify and sequence the env gene derived from gypsy elements of D. simulans.
PTT:
A T7-coupled reticulocyte lysate system (Promega) was used for the PTT analysis according to the protocol recommended by the manufacturer with minor modifications. The reactions were carried out in a volume of 20 µl, and half of the recommended volume of [35S]methionine was used. Purified full-length env gene PCR products as well as cloned env PCR product were transcribed and translated in a TNT T7-coupled reticulocyte lysate system at 30° for 1 hr. The translation products were separated by discontinuous SDS-PAGE through a 15% separating gel with Tris-glycine buffer. The signals were detected by autoradiography.
Cloning of the gypsy regulatory elements from various Drosophila species:
pDsugyp and pDvigyp were constructed from PCR-amplified gypsy LTR-ULR regions derived from D. virilis and D. subobscura, fused transcriptionally to the lacZ reporter gene, and subcloned into the transformation vector pW7. Primers were designed according to the D. subobscura and D. virilis gypsy published sequences.
The gypsy LTR-ULR from D. subobscura was isolated by PCR amplification using 50 ng genomic DNA as template and 2.5 units Pfu DNA polymerase in the following conditions: 93°, 30 sec; 57°, 45 sec; 72°, 2 min for one cycle; annealing at 61°, 30 sec for 25 cycles; and 72°, 10 min as final extension. The upstream primer was 5' GGAATTCCAGTTAAGAACTAAGTACATAAGTTATTCCC 3' and the downstream primer was 5' CGGGATCCCGCATTGGCTTATGGTTGGCAC 3'.
The DviGypV LTR-ULR was obtained by PCR amplification using as template 5 ng of cloned full-length DviGypV (supplied by M. Evgen'ev) and 2.5 units Pfu DNA polymerase in the following conditions: 93°, 30 sec; 55°, 30 sec; 72°, 1 min 30 sec for 25 cycles. The upstream primer was 5' GGAATTCCAGTTAACAACTAAGCATAAATATATTGCCC 3', and the downstream primer was 5' CGGGATCCCGCTCATTGGCTTATGGTTGGC 3'. The underlined nucleotides correspond to the EcoRI- and BamHI-cleavable extensions used in the cloning strategy.
P-element-mediated germline transformation and genetic crosses:
All transgenes were recovered as colored-eyed w+ individuals after P-mediated transformation (![]()
![]()
Histochemistry and quantitative measurements of ß-galactosidase activity:
Histochemical staining for ß-galactosidase and quantitative measurements of ß-galactosidase activity in the ovaries of the pgyp, pDsugyp, and pDvigyp transgenic flies were done according to ![]()
Sequencing:
PCR products of interest were cloned into the pPCR-Script Amp SK(+) vector (Stratagene, La Jolla, CA) and both strands were sequenced using vector-specific T7 and T3 primers.
Nucleotide and amino acid sequence analyses:
Multiple alignments of LTR-ULR nucleotide sequences were performed with the DIALIGN2 program (![]()
![]()
![]()
![]()
| RESULTS |
|---|
Sequences homologous to gypsy from D. melanogaster (DmeGypV) are widely distributed among Drosophila species. Complete gypsy elements have been previously cloned and sequenced from D. subobscura (DsuGypV) and D. virilis (DviGypV) species (![]()
![]()
![]()
The coding capacities for Env proteins are conserved in gypsy elements from various Drosophila species:
The PTT, a mutation-detection method generally used to scan for premature termination mutations (![]()
![]()
A major 1.8-kb product and a few minor bands were observed in genomic DNA amplifications from the species of the melanogaster subgroup except D. simulans for which no product was obtained. The expected D. melanogaster PCR product size is 1.8 kb, corresponding to the 1.4-kb complete env gene plus 0.4 kb of the 3' LTR. The specificity of the amplified fragments was checked by Southern blot hybridization at high stringency, using a radioactively marked internal fragment of DmeGypV env as a probe, revealing only the 1.8-kb fragment out of several PCR products obtained with the species of the melanogaster subgroup (data not shown). The 1.8-kb major PCR product from each species was subsequently gel purified and used for PTT analyses.
The 1.4- and 1.8-kb fragments observed with D. subobscura and D. virilis did not hybridize to the D. melanogaster probe in the Southern blot experiments, presumably because of the divergence between DmeGypV, DsuGypV, and DviGypV. In these two cases, we gel purified the 1.4- and 1.8-kb PCR products from DsuGypV and DviGypV, respectively.
The major protein products obtained in the PTT assay with D. teissieri, D. yakuba, D. erecta, and D. orena have molecular weights corresponding to the expected 54-kD Env protein of D. melanogaster (Fig 2). In the case of D. virilis and D. subobscura, we obtained PTT products of
54 and 53.5 kD, respectively (Fig 2). These results show that the genomes of these species contain at least one copy of gypsy putatively encoding a complete envelope protein. One should note that protein products with smaller sizes are also present in this assay. They might correspond to the previously described truncated Env putative proteins of 52.8 and 42.7 kD for D. virilis and D. subobscura, respectively (![]()
|
The PCR products of D. virilis, D. subobscura, D. erecta, and D. teissieri used in the PTT assays were cloned into the pCRScript cloning vector, and two positive clones for each species were randomly selected and sequenced. Although it was concluded from the published sequence of DsuGypV that D. subobscura does not contain gypsy elements encoding functional Env products (![]()
Similarly, the PCR products of D. virilis encode a complete Env protein. The deletion in our D. virilis env sequences of a C nucleotide present at position 5848 in the M38438 sequence eliminates a downstream stop codon present in the previously published sequence (![]()
One of the two gypsy env sequences obtained from the D. teissieri genome encodes a full-length Env protein, whereas the other contains a deletion of 19 nucleotides that generates a frameshift mutation resulting in a stop codon.
Both gypsy env sequences of D. erecta show high levels of similarity, and none has a complete protein-coding capacity. Comparison with the DmeGypV env sequence reveals multiple point mutations and several significant deletions that create stop codons.
The env-based phylogeny is congruent with the int-based phylogeny of gypsy:
We performed a phylogenetic analysis of gypsy based on the env gene sequences. A previous phylogenetic analysis based on the integrase gene showed that the distribution of gypsy among the eight melanogaster subgroup species does not follow the phylogeny of the host species, defining two main lineages: GypA and GypB (![]()
Since we could not amplify a gypsy homologous env gene from the D. simulans genome using the PTT assay primers, we carried out a PCR using a couple of primers conserved in DmeGypV, DsuGypV, and DviGypV Env sequences. A single fragment was obtained. It was cloned in pCRScript, and two independent clones were sequenced. The results indicate that D. simulans contains gypsy elements putatively encoding full-length Env proteins. As the percentages of nucleotide identity between both sequences from the same species were very high (>98%), only one sequence from each species was used to construct a multiple alignment with CLUSTALX (Fig 3). This alignment shows that the putative cellular endopeptidase cleavage site, the two putative N-linked glycosylation sites, the six cysteine residues, and the transmembrane domain described in ![]()
Ks/Ka
9), suggesting that the env sequences have evolved under purifying selection. Altogether, these data indicate the existence of a selective pressure for the conservation of the Env function in the gypsy elements from various Drosophila species.
|
We estimated the JC nucleotide distances between the aligned env sequences and compared them graphically with the int JC distances (Fig 4). The data demonstrate that there is a strong correlation between env and int distances (r = 0.87), indicating that the env and int phylogenetic trees are congruent. Moreover, the int:env distance ratios are very close to 1 (Fig 4), suggesting that int and env evolve at the same rate in the same gypsy genome, most likely because of the lack of recombination between int and env. These results provide significant information supporting the phylogeny of gypsy that we previously established (![]()
|
The expression of gypsy in D. subobscura and D. virilis is not repressed by the flamenco gene in D. melanogaster:
We developed an experimental model of the invasion of the genome of D. melanogaster by a gypsy element from another Drosophila species. A series of experiments was carried out to study the ability of alien gypsy regulatory sequences to drive the expression of the bacterial lacZ reporter gene in D. melanogaster.
It has been previously shown that gypsy in D. melanogaster is controlled by the flamenco host gene (![]()
![]()
lacZ expression was detected in follicle cells of vitellogenic stages of oogenesis in the ovaries of flamenco permissive pgyp transgenic flies, as previously shown by ![]()
![]()
Histochemical staining of dissected ovaries of permissive transgenic females homozygous for the pDsugyp and pDvigyp constructs show that reporter gene expression remains restricted to the somatic follicular epithelial cells surrounding egg chambers (Fig 5). However, some significant differences were observed: First, the ß-galactosidase activity promoted by the LTR-ULR regions of DsuGypV and DviGypV is higher than that of the LTR-ULR of DmeGypV; second, the pDsugyp and pDvigyp transgenes are expressed at all stages of oogenesis; third, the expression of pDsugyp and pDvigyp is not much repressed by restrictive alleles of flamenco, namely, w1118(R) and wRev(R), in contrast to pgyp, which is completely repressed in the presence of these alleles. Quantitative measurements of ß-galactosidase activity in the ovaries of transgenic flies confirmed the histochemical observations. High levels of ß-galactosidase activity were observed in the ovaries of permissive and restrictive transgenic flies for pDsugyp and pDvigyp while pgyp was expressed only in permissive females (Fig 6). A significant repression was observed for pDsugyp in the repressive wRev(R)/wRev(R) genetic background. However, the level of ß-galactosidase activity in this case is still much higher than that observed with pgyp in the same background. Hence, DviGypV and DsuGypV are both able to express themselves at a high level in D. melanogaster ovaries, whichever flamenco alleles are present in the females.
|
|
The extent of divergence between the gypsy LTR-ULR sequences varies along the nucleotide sequence:
In an attempt to understand the evolutionary forces that shaped the regulatory sequences of gypsy leading to the expression profiles that we observed, we sequenced the LTR-ULR from pDsugyp and pDvigyp and compared these sequences with the sequence of the LTR-ULR of DmeGypV previously published (M12927). A multiple sequence alignment was generated using the DIALIGN segment-to-segment approach, which is particularly appropriate for detecting local similarities, and some editing was done manually according to the MEME results (Fig 7).
|
Many differences are observed between the gypsy LTR-ULR sequences. They are not equally distributed along the LTR-ULR regions. The divergences among these sequences result from point mutations and large insertions and deletions (indels): In particular, the DsuGypV LTR region contains several insertions compared to the other two sequences.
We tried to characterize the differences in the nucleotide sequences that might be responsible for the differences in the patterns of expression observed previously among pgyp, pDsugyp, and pDvigyp in transgenic flies. Because pDsugyp and pDvigyp transgenic flies share a similar pattern of expression different from that of pgyp, we determined whether they also share similarities in the regions that diverge from DmeGypV. This was done by plotting DviGypV vs. DsuGypV, DviGypV vs. DmeGypV, and DmeGypV vs. DsuGypV divergences along the sequence (Fig 8) using PlotSimilarity. Distance values were calculated for a window of 50 nucleotides after removal of all gaps from the alignments. The plots showed clearly that the ULR region allows us to discriminate DmeGypV from DviGypV and DsuGypV. We found one domain where the extent of divergence between DviGypV and DsuGypV is minimal whereas the extent of divergence between DviGypV and DmeGypV or DmeGypV and DsuGypV is maximal (Fig 8). This 30-bp sequence lies within the ULR region, upstream of the first Su(Hw)-binding domain (Fig 7). It is also worthy of note that the similarity scores between the gypsy LTR-ULR sequences change suddenly at the U3/R boundary (Fig 8). The highest level of similarity observed in the U3 region concerns DmeGypV and DviGypV, whereas the highest similarity score observed in the ULR region concerns DsuGypV and DviGypV. This difference in the degree of similarity between the U3 and ULR regions suggests that DviGypV results from recombination events between DmeGypV and DsuGypV.
|
| DISCUSSION |
|---|
The Envelope proteins can be a major determinant of horizontal gypsy transfers:
An increasing amount of experimental data indicates that many classes of transposable elements have been transferred horizontally between species (![]()
![]()
![]()
The mechanisms by which horizontal transfers of noninfectious elements could occur remain obscure and probably involve diverse vectors (![]()
![]()
![]()
![]()
![]()
![]()
We cannot exclude that the gypsy env gene was instead co-opted by the host genome for some cellular functions and that the env genes described in this work are not part of full-length active gypsy copies. For instance, recent results suggest that the HERV-W Env protein might have a physiological role during pregnancy and placenta formation whereas the HERV-W gag and pol genes are defective (![]()
![]()
DsuGypV and DviGypV might invade flamenco restrictive D. melanogaster populations:
Gypsy proviruses of the present-day populations of D. melanogaster (DmeGypV) are efficiently repressed by the restrictive alleles of the flamenco gene. Although the molecular mechanism of this repression is yet unknown, it appears that this regulation acts primarily on the accumulation of the transcripts of DmeGypV in the follicle cells of the ovaries (![]()
![]()
A pairwise detailed comparison of the three aligned sequences revealed a stretch of 30 nucleotides that is shared by DviGypV and DsuGypV and is strongly divergent in DmeGypV. This sequence was previously described as part of a negative regulatory domain of DmeGypV transcription under the conditions of transient expression in Drosophila cultured cells (![]()
These data raise the question of the status of a naive genome and its potential invasion by retroelements. One simple hypothesis is that a naive genome is a priori permissive for a retroelement because acquisition of mechanisms of resistance have a fitness cost. Our results suggest that an "alien" gypsy element could propagate into a naive host genome. Indeed, flamenco seems to be a highly specific host defense system that could not control gypsy elements from other Drosophila species. It is probably one of the less "costly" mechanisms for D. melanogaster, but its inefficiency in the case of invasion by DsuGypV or DviGypV would make it necessary for the host to select new mechanisms to avoid the deleterious effect of gypsy activity. Several examples (reviewed in ![]()
| FOOTNOTES |
|---|
Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos.
AJ308090,
AJ308091,
AJ308092,
AJ308093,
AJ308094,
AJ308095,
AJ308096. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. Michael Evgen'ev for generously providing the DviGypV clone. This work was supported by grants from the Association pour la Recherche sur le Cancer and the Fondation pour la Recherche Médicale (FRM). L.M. was the recipient of fellowships from the French Government and the FRM.
Manuscript received May 14, 2001; Accepted for publication October 19, 2001.
| LITERATURE CITED |
|---|
ALBEROLA, T. M. and R. DE FRUTOS, 1996 Molecular structure of a gypsy element of Drosophila subobscura (gypsyDs) constituting a degenerate form of insect retroviruses. Nucleic Acids Res. 24:914-923
BAILEY, T. L. and C. ELKAN, 1995 The value of prior knowledge in discovering motifs with MEME. Proc. Int. Conf. Intell. Syst. Mol. Biol. 3:21-29[Medline].
BLOND, J. L., D. LAVILLETTE, V. CHEYNET, O. BOUTON, and G. ORIOL et al., 2000 An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J. Virol. 74:3321-3329
BOEKE, J. D., and J. P. STOYE, 1997 Retrotransposons, endogenous retroviruses, and the evolution of retroelements, pp. 343436 in Retroviruses, edited by J. M. COFFIN, S. H. HUGHES and H. E. VARMUS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BUCHETON, A., 1995 The relationship between the flamenco gene and gypsy in Drosophila: how to tame a retrovirus. Trends Genet. 11:349-353[Medline].
CHALVET, F., L. TEYSSET, C. TERZIAN, N. PRUD'HOMME, and P. SANTAMARIA et al., 1999 Proviral amplification of the Gypsy endogenous retrovirus of Drosophila melanogaster involves env-independent invasion of the female germline. EMBO J. 18:2659-2669[Medline].
CLARK, J. B., W. P. MADDISON, and M. G. KIDWELL, 1994 Phylogenetic analysis supports horizontal transfer of P transposable elements. Mol. Biol. Evol. 11:40-50[Abstract].
DEN DUNNEN, J. T. and G. J. VAN OMMEN, 1999 The protein truncation test: a review. Hum. Mutat. 14:95-102[Medline].
DESSET, S., C. CONTE, P. DIMITRI, V. CALCO, and B. DASTUGUE et al., 1999 Mobilization of two retroelements, ZAM and Idefix, in a novel unstable line of Drosophila melanogaster. Mol. Biol. Evol. 16:54-66[Abstract].
FLAVELL, A. J., 1999 Long terminal repeat retrotransposons jump between species. Proc. Natl. Acad. Sci. USA 96:12211-12212
HALL, T. A., 1999 BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95-98.
HOUCK, M. A., J. B. CLARK, K. R. PETERSON, and M. G. KIDWELL, 1991 Possible horizontal transfer of Drosophila genes by the mite Proctolaelaps regalis. Science 253:1125-1128
JORDAN, I. K., L. V. MATYUNINA, and J. F. MCDONALD, 1999 Evidence for the recent horizontal transfer of long terminal repeat retrotransposon. Proc. Natl. Acad. Sci. USA 96:12621-12625
KIM, A., C. TERZIAN, P. SANTAMARIA, A. PELISSON, and N. PRUD'HOMME et al., 1994 Retroviruses in invertebrates: The gypsy retrotransposon is apparently an infectious retrovirus of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 91:1285-1289
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, London.
MAZO, A. M., L. J. MIZROKHI, A. A. KARAVANOV, Y. A. SEDKOV, and A. A. KRICHEVSKAJA et al., 1989 Suppression in Drosophila: su(Hw) and su(f) gene products interact with a region of gypsy (mdg4) regulating its transcriptional activity. EMBO J. 8:903-911[Medline].
MIZROKHI, L. J. and A. M. MAZO, 1991 Cloning and analysis of the mobile element gypsy from D. virilis. Nucleic Acids Res. 19:913-916
MORGENSTERN, B., 1999 DIALIGN 2: improvement of the segment-to-segment approach to multiple sequence alignment. Bioinformatics 15:211-218
PARKHURST, S. M., D. A. HARRISON, M. P. REMINGTON, C. SPANA, and R. L. KELLEY et al., 1988 The Drosophila su(Hw) gene, which controls the phenotypic effect of the gypsy transposable element, encodes a putative DNA-binding protein. Genes Dev. 2:1205-1215
PELISSON, A., S. U. SONG, N. PRUD'HOMME, P. A. SMITH, and A. BUCHETON et al., 1994 gypsy transposition correlates with the production of a retroviral envelope-like protein under the tissue-specific control of the Drosophila flamenco gene. EMBO J. 13:4401-4411[Medline].
PRUD'HOMME, N., M. GANS, M. MASSON, C. TERZIAN, and A. BUCHETON, 1995 Flamenco, a gene controlling the gypsy retrovirus of Drosophila melanogaster. Genetics 139:697-711[Abstract].
ROBERT, V., N. PRUD'HOMME, A. KIM, A. BUCHETON, and A. PELISSON, 2001 Characterization of the flamenco region of the Drosophila melanogaster genome. Genetics 158:701-713
ROBERTSON, H. M., 1997 Multiple Mariner transposons in flatworms and hydras are related to those of insects. J. Hered. 88:195-201
SONG, S. U., T. GERASIMOVA, M. KURKULOS, J. D. BOEKE, and V. G. CORCES, 1994 An env-like protein encoded by a Drosophila retroelement: evidence that gypsy is an infectious retrovirus. Genes Dev. 8:2046-2057
SPRADLING, A. C., 1986 P element-mediated transformation, pp. 175197 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Oxford.
SYOMIN, B. V., L. I. FEDOROVA, S. A. SURKOV, and Y. V. ILYIN, 2001 The endogenous Drosophila melanogaster retrovirus gypsy can propagate in Drosophila hydei cells. Mol. Gen. Genet. 264:588-594[Medline].
TERZIAN, C., C. FERRAZ, J. DEMAILLE, and A. BUCHETON, 2000 Evolution of the gypsy endogenous retrovirus in the Drosophila melanogaster subgroup. Mol. Biol. Evol. 17:908-914
TEYSSET, L., J. C. BURNS, H. SHIKE, B. L. SULLIVAN, and A. BUCHETON et al., 1998 A Moloney murine leukemia virus-based retroviral vector pseudotyped by the insect retroviral gypsy envelope can infect Drosophila cells. J. Virol. 72:853-856
THOMPSON, J. D., T. J. GIBSON, F. PLEWNIAK, F. JEANMOUGIN, and D. G. HIGGINS, 1997 The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882
This article has been cited by other articles:
![]() |
A. Pelisson, E. Sarot, G. Payen-Groschene, and A. Bucheton A Novel Repeat-Associated Small Interfering RNA-Mediated Silencing Pathway Downregulates Complementary Sense gypsy Transcripts in Somatic Cells of the Drosophila Ovary J. Virol., February 15, 2007; 81(4): 1951 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Heredia, E. L. S. Loreto, and V. L. S. Valente Complex Evolution of gypsy in Drosophilid Species Mol. Biol. Evol., October 1, 2004; 21(10): 1831 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sarot, G. Payen-Groschene, A. Bucheton, and A. Pelisson Evidence for a piwi-Dependent RNA Silencing of the gypsy Endogenous Retrovirus by the Drosophila melanogaster flamenco Gene Genetics, March 1, 2004; 166(3): 1313 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Holmes Transcendent Elements: Whole-Genome Transposon Screens and Open Evolutionary Questions Genome Res., August 1, 2002; 12(8): 1152 - 1155. [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Mejlumian, L.
- Articles by Terzian, C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Mejlumian, L.
- Articles by Terzian, C.











