Light and Clock Expression of the Neurospora Clock Gene frequency Is Differentially Driven by but Dependent on WHITE COLLAR-2

Corresponding author: Jennifer J. Loros, Dartmouth Medical School, Hanover, NH 03755., jennifer.loros{at}dartmouth.edu (E-mail)

Communicating editor: R. H. DAVIS

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Visible light is thought to reset the Neurospora circadian clock by acting through heterodimers of the WHITE COLLAR-1 and WHITE COLLAR-2 proteins to induce transcription of the frequency gene. To characterize this photic entrainment we examined frq expression in constant light, under which condition the mRNA and protein of this clock gene were strongly induced. In continuous illumination FRQ accumulated in a highly phosphorylated state similar to that seen at subjective dusk, the time at which a step from constant light to darkness sets the clock. Examination of frq expression in several wc-2 mutant alleles surprisingly revealed differential regulation when frq expression was compared between constant light, following a light pulse, and darkness (clock-driven expression). Construction of a wc-2 null strain then demonstrated that WC-2 is absolutely required for both light and clock-driven frq expression, in contrast to previous expectations based on presumptive nulls containing altered Zn-finger function. Additionally, we found that frq light signal transduction differs from that of other light-regulated genes. Thus clock and light-driven frq expression is differentially regulated by, but dependent on, WC-2.

CIRCADIAN rhythms are self-sustaining oscillations generated at the cellular level with a period of 24 hr. They are found in a wide range of organisms and serve a predictive function, allowing an organism to anticipate daily and seasonal environmental oscillations (ZATZ 1992 ; PITTENDRIGH 1993 ). Daily cycles in environmental variables such as light and temperature provide reference points that synchronize circadian clocks—thus circadian clocks are sensitive to light and temperature (EDMUNDS 1988 ). Genetic and molecular analyses have identified a number of genes that are thought to encode components of mammalian, insect, fungal, plant, and cyanobacterial clocks (reviewed in DUNLAP 1999 ; CERMAKIAN and SASSONE-CORSI 2000 ; JOHNSON 2001 ; WILLIAMS and SEHGAL 2001 ). Such studies have established that circadian rhythms are based in part upon transcription-translation-based negative feedback loops. In each case, circadian oscillations in the transcript levels of specific clock genes (frequency in fungi, kaiA and kaiBC in cyanobacteria, period and timeless in flies, and the mper and mcry genes in mammals) appear to play a central role in the generation of circadian rhythms (DUNLAP 1999 ). The state of the clock protein within the oscillation provides the cell with temporal information, allowing prediction and measurement of daily and seasonal changes in the external environment.

Environmental signals, such as light, are thought to synchronize the molecular oscillations by acting to alter the levels of the clock components and hence their position in the oscillation. In fungi and mammals light acts to rapidly induce levels of clock gene transcripts (CROSTHWAITE et al. 1995 , CROSTHWAITE et al. 1997 ; ALBRECHT et al. 1997 ; SHEARMAN et al. 1997 ; SHIGEYOSHI et al. 1997 ); in the case of Drosophila this occurs through photic destruction of tim (HUNTER-ENSOR et al. 1996 ; MYERS et al. 1996 ; ZENG et al. 1996 ; CERIANI et al. 1999 ; NAIDOO et al. 1999 ).

In Neurospora, the speed, magnitude, and sensitivity of photic entrainment and photic induction of frq message correlate precisely (CROSTHWAITE et al. 1995 ). Moreover, in constant light (LL) there is an override of negative feedback by FRQ protein on its own transcript levels such that frq mRNA levels remain elevated over dark levels. Upon removal of the light stimulus, levels of frq transcript drop rapidly as FRQ negatively feeds back on its message levels, resetting the clock to a time in the cycle that corresponds to the low point of frq mRNA, subjective dusk. These and other data (CROSTHWAITE et al. 1995 ) have served as an important paradigm for understanding how light resets the circadian clock of higher eukaryotes (ALBRECHT et al. 1997 ; SHEARMAN et al. 1997 ; SHIGEYOSHI et al. 1997 ). However, several details of this model remain incomplete, particularly the response of FRQ to light.

Mutants of the white collar genes were studied for their effect on frq light induction to determine their involvement in light resetting of the Neurospora clock. The white collar-1 and white collar-2 (wc-1 and wc-2) loci were originally identified as mutations resulting in blindness for all photoresponses measured (HARDING and TURNER 1981 ; LINDEN et al. 1997A ). It has been shown that a photoblind allele of wc-1 results in loss of induction of frq by a light pulse. However, a presumptive wc-2 null allele, wc-2 (ER33), allowed partial induction of frq transcription by a light pulse. Thus it was concluded that WC-1 was required for induction of frq by light, but WC-2 was not (CROSTHWAITE et al. 1997 ). Despite the induction of frq transcription by light associated with this allele of wc-2, cycling in frq mRNA or FRQ never followed, leading to the prediction that WC-2 is a component of the Neurospora circadian clock (CROSTHWAITE et al. 1997 ). The finding that a partially functional allele of wc-2 results in period and temperature compensation defects concomitant with reduced but rhythmic frq expression (COLLETT et al. 2001 ) and that FRQ and WC-2 interact in vitro and in vivo (CHENG et al. 2001 ; DENAULT et al. 2001 ; MERROW et al. 2001 ) confirms a clock-critical role for WC-2.

The wc-1 and wc-2 loci encode putative transcription factors containing potential transcriptional activation domains and GATA-type zinc-fingers (Zn-fingers) capable of binding DNA sequences in the promoter of the albino-3 (al-3) gene necessary for light induction of its transcript (BALLARIO et al. 1996 ; LINDEN and MACINO 1997 ). WC-1 and WC-2 are nuclear proteins (TALORA et al. 1999 ; SCHWERDTFEGER and LINDEN 2000 ; CHENG et al. 2001 ; DENAULT et al. 2001 ). In addition, they have PAS domains (BALLARIO and MACINO 1997 ; CROSTHWAITE et al. 1997 ; GU et al. 2000 ), which are required for these proteins to form homo- and heterodimers in vitro (BALLARIO et al. 1998 ). Additionally, WC-1 and WC-2 associate with one another in vivo (TALORA et al. 1999 ; CHENG et al. 2001 ; DENAULT et al. 2001 ). These data have led to a model in which heterodimers of WC-1 and WC-2 regulate the majority of light-induced gene expression in Neurospora (LINDEN and MACINO 1997 ; TALORA et al. 1999 ). In darkness WC-1 and WC-2 are predicted to cooperate in increasing the levels of frq transcript, consistent with roles as positive-acting components of the Neurospora clock (CROSTHWAITE et al. 1997 ; COLLETT et al. 2001 ). Similar models based on PAS:PAS heterodimer formation of the circadian transcriptional activators CLOCK:CYCLE and CLOCK:BMAL have been elucidated in Drosophila and mouse, respectively (ALLADA et al. 1998 ; DARLINGTON et al. 1998 ; GEKAKIS et al. 1998 ; RUTILA et al. 1998 ). More recently, VIVID, a small protein of the PAS superfamily that possesses most similarity to the PAS domain of WC-1, has been identified as a negative component of the Neurospora light signal transduction pathway, possibly acting via interaction with WC-1 and/or WC-2 (SCHWERDTFEGER and LINDEN 2000 ; HEINTZEN et al. 2001 ; PANDO and SASSONE-CORSI 2001 ; SHRODE et al. 2001 ). In addition to the fungal and animal proteins, the involvement of plant PAS domain proteins in both light signaling and the circadian clock is well known (HUALA et al. 1997 ; SOMERS et al. 1998 , SOMERS et al. 2000 ; GU et al. 2000 ; BRIGGS et al. 2001 ; JARILLO et al. 2001 ).

Here we characterize the response of FRQ protein to light, finding FRQ strongly induced by light; in constant light the protein accumulates in a phosphorylated state similar to that seen at dusk or circadian time 12 (CT12) in constant dark (DD). The induction mimicked frq mRNA, with a significant lag between the peak of frq mRNA and peak of FRQ, as has also been observed for frq cycles in DD. Examination of light-induced expression of frq transcript and protein in a wc-2 allelic series found the null allele of wc-2 (wc-2), generated by gene disruption, to have extremely low levels of frq transcript and protein in the dark and to completely lack photoresponsiveness. Alleles with mutations in the Zn-finger DNA-binding domain (LINDEN et al. 1997A ; COLLETT et al. 2001 ) are shown to have partial function dependent on the severity of the mutation for photo-induced frq gene expression but not for another light-responsive gene. Thus frq induction by light is dependent on WC-2, but partially independent of the Zn-finger, suggesting that light induction of frq occurs by a different mechanism from that regulating other light-induced genes in Neurospora and from that regulating frq in the dark.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and growth conditions:
General conditions for growth and manipulation of Neurospora are described elsewhere (DAVIS and DESERRES 1970 ; DAVIS 2000 ). Liquid culture experiments were performed as previously described (LUO et al. 1998 ) with the exception that 1x Vogel's salts were used in all experiments. Light treatments were performed as described previously (CROSTHWAITE et al. 1995 ).

All Neurospora crassa strains used, including wc-2 (ER24); bd, wc-2 (ER44); bd, wc-2 (ER33); bd, and wc-2⁺; bd, were generated in this laboratory from strains provided by the Fungal Genetics Stock Center (FGSC; ER24 from FGSC4406, ER44 from FGSC 4410, and ER33 from FGSC 4408; DEGLI-INNOCENTI and RUSSO 1984A ; http://www.fgsc.net), Department of Microbiology, University of Kansas Medical Center (Kansas City, KS). Construction of strain wc-2; bd is described herein. The bd mutation, referred to as wild type (WT) throughout, has two clear phenotypes, reduced growth rate and increased conidiation, and allows clear visualization of circadian rhythmicity on race tubes without affecting the underlying clock mechanism (PERKINS et al. 1982 ). All our laboratory stocks carry this mutation and it is not included in strain names in the text.

RNA and protein analysis:
RNA analysis was performed as described previously (CROSTHWAITE et al. 1995 ). Western blot analysis was performed as previously described (GARCEAU et al. 1997 ). X-ray films of Northern and Western blots were scanned and densitometry was performed using NIH Image 1.59. For some experiments that gave a wide range of signal strengths densitometry was performed on long and short exposures of blots to obtain readings in the linear range of the film and scanner; these values were then normalized to reference samples and hence to each other.

Recombinant DNA procedures:
Standard recombinant DNA techniques were carried out according to standard protocols (SAMBROOK et al. 1989 ). For generation of the wc-2 deletion construct the genomic wc-2 clone (X7:12G) was isolated from an ordered cosmid library (ORBACH 1994 ) and the 6.75-kb SmaI fragment was cloned into pBM61 (MARGOLIN et al. 1997 ) to give pABC4b. This plasmid was tested for wc-2 function by its ability to rescue banding when transformed into strain his-3 wc-2 (ER33); bd and then was digested with EcoRI, and fragments corresponding to sequences flanking the wc-2 open reading frame (ORF) were religated to remove the ORF and give pABC5a. The pABC5a construct was then cut with SmaI and the fragment containing sequences from the wc-2 locus was ligated into pZErO-2 (Invitrogen, San Diego) to give pABC8b, which was partially digested with BglII and ligated to a BamHI fragment of pCSN44 carrying the hph gene encoding hygromycin resistance (STABEN et al. 1989 ) to give pBP2a. The pBP2a construct was then transformed into conidia of Neurospora strain bd; a (87-3) by electroporation and hygromycin-resistant transformants were screened for the presence of the deletion allele by PCR with primers BDA13 (AGCACTCGTCCGAGGGCAAA) and LZ1 (CGCCTATCGATAGGAGGAGA).

Phosphatase treatment:
Protein extracts were incubated in 50 µl of phosphatase buffer alone or with 1000 units PPase (New England Biolabs, Beverly, MA) for 1 hr before Western blot analysis.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

FRQ is induced in constant light and progressively phosphorylated:
A prediction arising from the model for light resetting of the Neurospora clock (CROSTHWAITE et al. 1995 ) is that the response of FRQ protein to light should, following a lag, mimic that of frq mRNA. We found that, broadly speaking, this was the case (Fig 1). When Neurospora cultures were placed in LL and frq mRNA and protein were collected at intervals for 24 hr, consistent with previous observations (CROSTHWAITE et al. 1995 ), frq mRNA (Fig 1A and Fig C) was at high levels within 15 min of lights on. Following the initial strong induction of frq mRNA by the light step, RNA levels drop and on average are higher than levels found in DD but exhibit a high degree of variability, as reported previously for frq mRNA in continuous light (CROSTHWAITE et al. 1995 ). An increase in the quantity of FRQ was apparent within 30 min of lights on (a low-molecular-weight FRQ band being visible after 30 min in LL, corresponding to newly synthesized FRQ, Fig 1B). However, while the quantity of frq mRNA was at a peak after 15 min in LL, the peak in FRQ quantities was not observed until 4–8 hr after lights on (Fig 1B and Fig D). Experiments performed at other circadian times gave results for frq mRNA and FRQ similar to these (data not shown), consistent with previous findings that frq mRNA is light induced at all times of day (CROSTHWAITE et al. 1995 ).

View larger version (52K): In this window In a new window Download PPT slide   Figure 1. FRQ is induced by constant light. (A) Representative Northern blots of frq mRNA (and rRNA) in cultures of bd; wc-2+. Cultures were incubated in constant light for at least 4 hr, shifted to DD for 21 hr (until CT11), and then either illuminated with 1000 lux of constant light (LL) for the indicated times or held in DD before tissue was harvested. Cultures were treated such that, at harvesting, all cultures had been grown for a similar length of time. (B) Representative Western analysis of FRQ from identical cultures to those in A. The amido black-stained membrane is shown below the FRQ blots to visualize loading. (C) Densitometric analysis of data from A, plotting the mean of frq mRNA divided by rRNA ± SEM (n = 3). Open and closed symbols represent LL and DD cultures, respectively. Data from the three experiments were normalized to the DD 0 samples. The DD 0 sample was arbitrarily set at 1.0. (D) Densitometric analysis of data from B, plotting the mean of FRQ divided by amido black ± SEM (n = 2). Data from the experiments were normalized to the LL8 sample. Open and closed symbols represent LL and DD samples, respectively. Hours in constant light or circadian time for controls held in darkness are plotted on the x-axis (LL or CT, respectively). (E) protein phosphatase treatment of protein extracts grown in DD or LL. The protein extracts were either held on ice (0°) or incubated at 30° in the presence of phosphatase buffer and MnCl2 alone (-) or with protein phosphatase (+). DD protein extracts (100 µg) and LL extracts (50 µg) were analyzed.

A progressive decrease in the mobility of FRQ synthesized in LL is apparent, as is observed for FRQ in DD. To test whether this progressive change in mobility is due to phosphorylation (as occurs in DD; GARCEAU et al. 1997 ) we treated Neurospora protein extracts from LL- and DD-grown cultures with protein phosphatase (Fig 1E). Phosphatase reduced the smear of FRQ bands to two distinct bands corresponding to the short and long forms of FRQ previously observed for FRQ synthesized in DD (GARCEAU et al. 1997 ).

The lag between peaks of frq mRNA and FRQ following lights on is consistent with the lag observed between the peak in frq transcript and FRQ in free-running cultures of Neurospora grown in constant darkness (GARCEAU et al. 1997 ) and with the lag in FRQ levels observed when frq transcript is induced from a heterologous promoter (MERROW et al. 1997 ). Thus this delay between the peak in frq mRNA and peak in FRQ appears to be a general feature of processes regulating FRQ expression.

Differential regulation of frq and FRQ in constant dark, constant light, or following a light pulse:
To gain further insight into the regulation of frq expression in response to light, we examined four different alleles of wc-2: wc-2⁺, wc-2 (ER24), wc-2 (ER33), and wc-2 (ER44). Alleles wc-2 (ER24) and wc-2 (ER44) had been identified as probable temperature-sensitive alleles of wc-2 (DEGLI-INNOCENTI and RUSSO 1984B ). The allele wc-2 (ER24) has a mutation, L489I, which converts a highly conserved leucine in the WC-2 Zn-finger to an isoleucine. This mutation results in reduced dark levels of frq mRNA and FRQ and a lengthened period of the circadian clock (COLLETT et al. 2001 ). The wc-2 (ER44) allele possesses a mutation in the lariat sequence of the first intron of wc-2, which results in almost all wc-2 transcripts having an unspliced first intron and drastically reduced levels of WC-2 protein (COLLETT et al. 2001 ; D. L. DENAULT and M. A. COLLETT, unpublished data). The wc-2 (ER33) allele has a mutation in the Zn-finger that converts a highly conserved glycine into a glutamic acid, almost certainly rendering the Zn-finger nonfunctional (LINDEN and MACINO 1997 ). Strains carrying this allele are photoblind for most measured light responses (NELSON et al. 1989 ; ARPAIA et al. 1993 , ARPAIA et al. 1995B ) but have (weak) induction of frq mRNA in response to a light pulse and low levels of frq mRNA and FRQ in constant dark (CROSTHWAITE et al. 1997 ).

The levels of frq mRNA and FRQ protein in constant darkness (see Fig 2 and Fig 3; frq mRNA in DD was visible only on very long exposures in ER24, ER33, and ER44, data not shown) reflected the race tube phenotype of these mutants reported previously (RUSSO 1988 ; CROSTHWAITE et al. 1997 ; COLLETT et al. 2001 ). In DD, expression in ER33 and ER44 was approximately equivalent, slightly lower than the level seen in ER24. Following a light pulse (Fig 2) the strains containing alleles wc-2 (ER33) and wc-2 (ER44) both showed a similar response: There was an induction of frq mRNA and protein to a similar level in these strains, but the amount of frq and FRQ induced was only 40–50% of that observed in wild type. Wild type and wc-2 (ER24) responded almost identically to a light pulse in frq and FRQ induction. Thus, while the alleles wc-2 (ER33), wc-2 (ER24), and wc-2 (ER44) all result in lowered expression of frq in constant dark, in response to a light pulse the different alleles lead to a range of frq expression levels, with wc-2 (ER24) mimicking wild type.

View larger version (71K): In this window In a new window Download PPT slide   Figure 2. Levels of frq mRNA and protein in strains containing various wc-2 alleles following a light pulse (LP). (A) Northern blots of frq mRNA in strains containing wc-2 alleles ER33, ER24, ER44, and wild type. Ethidium bromide (EtBr) staining of rRNA bands on the blotted membrane is shown below the Northern blot. Cultures were treated such that at harvesting all cultures had been grown for a similar length of time. DD controls were treated identically to the LP samples, but received no LP. Time in DD varied for each strain dependent on strain period length such that the time of LP fell at CT18. Wild type was held in DD for 28 hr, ER24 for 37 hr, and ER33 and ER44, which are arrhythmic, for the same length of time as wild type. Also included is an ER24 DD28 control (the first ER24 DD sample). All samples were grown at 25°. Light pulses were given to groups of four cultures and were staggered by 3 min for logistical reasons; thus each lane represents RNA from an individual culture, but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. Due to the high level of variability in amplitude of the response, LP samples are shown in triplicate. (B) Western blot of FRQ in strains containing wc-2 alleles ER33, ER44, ER24, and wild type. Two different exposures are shown to reveal FRQ in DD controls. The amido black-stained membrane is shown below the FRQ blots. Cultures were treated as in A, but tissue was harvested 4 hr after the LP. Each lane represents protein from an individual culture. (C) Densitometric analysis of data in A, relevant samples from Fig 4A and other experiments plotting the amount of frq mRNA normalized against EtBr-stained rRNA. (D) Densitometric analysis of data in B, relevant LP samples from Fig 4B and other experiments plotting the amount of FRQ normalized against amido black-stained total protein. For C and D, n = 3–5 for most samples and values shown are the mean ± SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, hatched bars to LP.

View larger version (69K): In this window In a new window Download PPT slide   Figure 3. Levels in constant light of frq mRNA and protein in wc-2 allelic strains. Experimental procedures are as in Fig 2 except where noted. (A) Northern blots of frq mRNA in strains containing wc-2 alleles ER33, ER24, ER44, and wild type grown in constant light. Cultures were grown for 4 hr in LL, transferred to DD for 12 hr, returned to LL for 24 hr, and then harvested. DD samples were treated identically to LL samples but kept in DD for 36 hr, except for wild type and ER24, which were harvested at times expected to reflect peak dark levels of frq mRNA (DD12 for WT and DD16 for ER24). Each lane represents RNA from an individual culture but the samples for ER33 and WT are duplicated on the left and right blots as reference samples. (B) Western blot of FRQ in strains containing wc-2 alleles ER33, ER44, ER24, and wild type. Two exposures of the blot are shown. Cultures were treated as in A except for DD samples of wild type and ER24, which were harvested at times expected to reflect trough (WT, DD32; ER24, DD41, first DD samples) or peak (WT, DD40; ER24, DD32, second DD samples) dark levels of FRQ. Each lane represents protein from an individual culture. (C) Densitometric analysis of data in A and relevant LL samples from Fig 4A, plotting the amount of frq mRNA normalized against EtBr-stained rRNA. (D) Densitometric analysis of data in B and relevant LL samples from Fig 4B, plotting the amount of FRQ normalized against amido black-stained total protein. For C and D, n = 3–5 for most samples and values shown are the mean ± SEM. DD samples were quantified from longer exposures of the blots shown and then normalized to reference samples. Solid bars correspond to DD, open bars to LL.

Levels of frq mRNA and FRQ were also monitored in strains grown in constant light for 24 hr (Fig 3). The wc-2 (ER33) strain was elevated 10–25% in LL vs. DD compared to the corresponding wild-type response, which was weaker than induction from a light pulse. Strain wc-2 (ER44) induction levels in LL were 50% of those observed in wild type. The LL levels of frq mRNA and FRQ were much higher than DD levels in the wc-2 (ER24) strain, similar to or greater than LL levels in the wild-type strain. Hence, the regulation of frq expression in constant light appears to differ from the regulation of frq expression in response to a light pulse. Specifically the strain containing wc-2 (ER33) displayed a very weak expression of frq mRNA and FRQ in LL but was capable of much stronger expression in response to a light pulse.

These data demonstrate clear differences in the regulation of frq expression between cultures grown in DD, LL, or in response to a light pulse. In the wc-2 (ER24) strain frq expression compared to wild type is greatly reduced in DD, but expression is virtually indistinguishable from wild type in light. The wc-2 (ER33) strain showed reduced frq expression compared to wild type under all conditions examined, but exhibited weaker frq expression in LL compared to that seen following a light pulse. The wc-2 (ER33) mutation has been reported to be blind for induction of all other light-regulated transcripts examined (NELSON et al. 1989 ; SOMMER et al. 1989 ; ARPAIA et al. 1993 , ARPAIA et al. 1995B ; LI and SCHMIDHAUSER 1995 ). This raised several possibilities: Either wc-2 (ER33) possessed the true null phenotype of wc-2, and WC-2 was not critical for frq light induction, or the Zn-finger of WC-2 was less important for frq expression in light than it is for other light-regulated genes and wc-2 (ER33) still possessed some function in the light signal transduction pathway leading to frq expression. To address this we generated a definitive wc-2 null allele by targeted gene replacement.

Photoinduction of frq expression requires WC-2:
All the alleles of wc-2 that were available to us had the potential to produce WC-2 protein, making it difficult to determine the true null phenotype of wc-2. We thus generated a null allele of wc-2 by targeted gene disruption. This disrupted gene (wc-2) deletes the entire wc-2 ORF and replaces a fragment of DNA thought to span the transcriptional start site (LINDEN and MACINO 1997 ) with a gene encoding hygromycin resistance. Ten primary transformant strains were characterized and 3 of the 10 were found to be homokaryotic for the wc-2 replacement. Southern analysis revealed these strains lacked DNA encoding the wc-2 ORF and Western analysis demonstrated a lack of any detectable WC-2 (data not shown).

Analysis of frq transcript and FRQ (Fig 4A and Fig B, respectively) in a strain containing wc-2 demonstrated that WC-2 is absolutely necessary for photic induction of frq expression. Unlike the other wc-2 alleles examined herein, no detectable increase in levels of frq mRNA or protein was observed in this strain either following a light pulse or in constant light. The previously analyzed alleles of wc-2, although reported as photoblind, are therefore not blind for the frq light induction pathway, but instead retain residual levels of activity in the light signal transduction pathway leading to frq expression. Thus the Zn-finger of wc-2 appears to play a limited role in the induction of frq by light. However, the Zn-finger clearly plays some role in light-driven expression of frq, as strains containing wc-2 (ER33), encoding a substantially altered WC-2 Zn-finger, have the most reduced frq expression in response to light.

View larger version (77K): In this window In a new window Download PPT slide   Figure 4. Photoinducible frq expression is lost in wc-2. (A) Northern blots of frq mRNA in strains containing wc-2 (ER33); bd, wc-2; bd and wc-2+; bd (WT), either following a light pulse or grown in constant light. EtBr staining of rRNA bands on the blotted membrane is shown below the Northern blot. Light-pulsed cultures and LL cultures were treated as in Fig 2 and Fig 3, respectively, except duplicate cultures were analyzed. (B) Western blots of FRQ in strains listed in A either following a light pulse or grown in constant light. The positions of the long and short FRQ proteins on the gel correspond to the FRQ label and are just below faint nonspecific bands seen in all lanes. The amido black-stained membrane is shown below the FRQ blots. Light-pulsed cultures and LL cultures were treated as in Fig 2 and Fig 3, respectively, except duplicate cultures were analyzed.

Long exposures of Western blots comparing protein extracts from frq¹⁰ (which has the entire frq ORF replaced by hph and thus produces no FRQ; ARONSON et al. 1994 ) to wc-2 revealed trace quantities of FRQ in wc-2 (data not shown), indicating that very limited frq transcription still occurs in the absence of WC-2.

Alleles of wc-2 photoinducible for frq are blind for another light-induced transcript:
The al-3 locus encodes a light-responsive gene involved in carotenoid biosynthesis. It encodes two transcripts, al-3 (c) and al-3 (m), driven by two independent promoters (ARPAIA et al. 1995A ). The al-3 (m) mRNA is expressed specifically in the mycelia and is induced rapidly by light, with induction kinetics similar to frq (ARPAIA et al. 1995A ). This transcript, as well as other light-regulated transcripts, has been reported as completely absent in strains containing the wc-2 (ER33) allele (NELSON et al. 1989 ; SOMMER et al. 1989 ; ARPAIA et al. 1993 , ARPAIA et al. 1995B ; LI and SCHMIDHAUSER 1995 ), leading to the expectation that these strains were photoblind. However, given that frq is still light induced in wc-2 (ER33) strains we were interested in comparing the induction of al-3 (m) in wc-2 (ER33), wc-2 (ER24), wc-2, and wild-type strains following a light pulse (Fig 5). The wc-2 (ER33), wc-2 (ER24), and wc-2-containing strains were all photoblind when assayed using al-3 (m) transcript as a reporter even though, as previously demonstrated herein, frq was induced in response to light in strains containing wc-2 (ER33) and wc-2 (ER24). Therefore, the mechanisms regulating frq in response to light appear to be distinct from those regulating al-3 (m), and the Zn-finger of WC-2 appears to be of less importance in frq light induction than in the induction of other light-regulated genes.

View larger version (82K): In this window In a new window Download PPT slide   Figure 5. Photoinduction of al-3 (m) transcript is lost in wc-2 alleles that remain photoinducible for frq. Northern blots of the light-inducible frq and al-3 transcripts in bd strains containing alleles (A) wc-2 (ER33), wc-2 (ER24), and wc-2+ and (B) wc-2 (ER33), wc-2, and WT are shown. Samples were treated essentially as in Fig 2. EtBr staining of rRNA bands on the blotted membrane is shown below the Northern blot.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

It was previously demonstrated that frq mRNA is rapidly and strongly induced in response to a light pulse and that frq is continuously elevated in constant light (CROSTHWAITE et al. 1995 ; MERROW et al. 2001 ). We have shown here that, as expected, FRQ is also strongly induced in response to light, detectable within minutes of exposure to light, although full induction takes several hours. The lag between the peak levels of frq mRNA and protein is similar to that seen for dark expression (GARCEAU et al. 1997 ; MERROW et al. 1997 ); thus it appears to be a characteristic property of frq expression. Similar lags are also seen in the expression of other clock genes [e.g., PER and TIM in Drosophila and mPER1 in the mouse suprachiasmatic nucleus (SCN); YOUNG 1998; HASTINGS et al. 1999] and most likely play important roles in the generation of a robust rhythm (SCHEPER et al. 1999 ).

FRQ protein remains elevated over prelight levels for at least 24 hr in LL, consistent with the behavioral arrhythmicity observed for Neurospora in LL (SARGENT and BRIGGS 1967 ). The highly phosphorylated state of FRQ in LL corresponds to the phosphorylation state of FRQ found in late afternoon to early evening in DD circadian time, just prior to its precipitous degradation (LIU et al. 2000 ), and fits well with entrainment of the Neurospora clock by LL to DD steps, which set the clock to CT12 or dusk. A major difference is that frq mRNA levels are at their trough at CT10–14 in DD, and FRQ is beginning to drop from peak levels, while in LL the transcript and protein levels are both elevated. Thus it appears that, rather than the level of frq transcript alone, the phosphorylation state of FRQ protein is also responsible for setting the phase of the clock following the light-to-dark step. Only one-half a circadian cycle after the light-to-dark shift frq mRNA levels are peaking; however, it takes a full circadian cycle for the protein to reach the same phosphorylation state as it had in LL. If one extends these data to the context of a full photoperiod, however, the timing of the state of message and protein appears more appropriate for a circadian cycle: Lights on leads to an immediate peak in mRNA, the level of which then drops slightly but remains high until sunset, 12 hr later. FRQ, however, peaks 4–8 hr after sunrise and is present predominately in a highly phosphorylated state by sunset, at which point it degrades over several hours, following which frq mRNA begins to rise again in anticipation of sunrise. The elevated levels of FRQ in LL imply elevated FRQ for the light portion of full photoperiods. This could be important for an organism adapting to different photoperiods. Short days and long nights would lead to a narrower peak of FRQ expression, while long days and short nights would give a broader peak of FRQ expression. These differences in FRQ expression would also likely alter the expression pattern of clock-controlled genes.

Neurospora has proven to be paradigmatic for understanding how light resets the mouse circadian clock: Rapid light induction of a clock gene transcript (frq in Neurospora, mPer1 in mice) rapidly phase shifts the clock by changing the phase of the oscillation of this transcript (CROSTHWAITE et al. 1995 ; ALBRECHT et al. 1997 ; SHEARMAN et al. 1997 ; SHIGEYOSHI et al. 1997 ). As in Neurospora where frq mRNA is elevated over dark levels in LL, mPer1 transcript is also elevated over dark levels in constant bright light. However, unlike the situation in Neurospora where frq transcript shows no significant cycling in LL (CROSTHWAITE et al. 1995 ), a rhythm in mPer1 transcript is apparent in constant bright light (SHIGEYOSHI et al. 1997 ). We have shown here that FRQ mimics its transcript and remains constantly elevated in LL. This has obvious implications for the waveform of FRQ oscillations in photoperiods of differing duration, which presumably has downstream effects on output. In a similar manner the waveform of mPer1 transcript and mPER1 protein differs between LD cycles and DD. In DD these cycles have a more transient peak than those found in LD, where a broader peak in message and protein is observed (HASTINGS et al. 1999 ). Thus, much as in Neurospora, light appears to have a sustained effect on clock gene expression in mice.

White collar-2, along with wc-1, was originally identified genetically as a component of the light signal transduction pathway in Neurospora (HARDING and TURNER 1981 ). Several saturating genetic screens for Neurospora mutants blocked in light-induced carotenogenesis, or light-induced transcription from the al-3 (m) promoter, have repeatedly identified only wc-1 and wc-2, making it likely these are the only nonredundant, nonessential genes positively regulating light-induced carotenogenesis in Neurospora (DEGLI-INNOCENTI and RUSSO 1984B ; LINDEN et al. 1997B ). Mutants of wc-1 and wc-2 blocked in light-induced carotenogenesis have been shown to be blocked in almost all photoresponses, with one notable exception: Transcripts of the central clock component, frequency, are still photoinduced in a wc-2 mutant blind for most other measured photoresponses (CROSTHWAITE et al. 1997 ). This suggested that light information signaling into the clock in Neurospora acted primarily through wc-1. We have demonstrated herein that wc-2 is also essential for frq expression in the light and dark.

Analyses of four wc-2 alleles uncovered differences in the regulation of frq expression in DD, LL, and in response to a light pulse. The wc-2 allele revealed that WC-2 is absolutely necessary for frq light induction and expression in DD. As expected, this allele is also blind for induction of al-3 (m). However, wc-2 alleles with mutations in residues of the Zn-finger, although blind for induction of al-3 (m), are photoinducible for frq expression. This demonstrates a surprising complexity in light-regulated gene expression in Neurospora and suggests that distinct mechanisms regulate, for instance, al-3 and frq photoinduction. It appears that the role of the WC-2 Zn-finger in frq photoinduction is limited whereas it may be essential for other light-induced transcripts. Further differences between the regulation of frq and other light-responsive genes have recently been demonstrated (MERROW et al. 2001 ) and are perhaps not surprising, as the regulation of frq in LL differs from other fast light-regulated genes; frq mRNA is continuously elevated over dark levels in LL; however, the transcripts of other fast light-regulated genes drop to prelight levels after 100 min in LL (LINDEN et al. 1999 ; MERROW et al. 2001 ).

In addition to the differences between al-3 (m) and frq photic regulation, there appear to be differences in the regulation of frq expression in DD, LL, or following a light pulse. The wc-2 (ER24) allele, which has reduced expression of frq in DD (data presented herein and COLLETT et al. 2001 ), has wild-type expression in response to a light pulse and in LL. In addition, wc-2 (ER33) reveals a differential response of frq to a light pulse and in LL.

An analogy among the circadian systems of Neurospora, Drosophila, and mice is the finding that mice homozygous for mutations in the PAS domain transcription factor CLOCK and flies homozygous for mutations in the PAS domain transcription factors dCLOCK and dBMAL have altered photoresponses. This similarity may not be completely unexpected as it is known that WC-1 from Neurospora and BMAL proteins from animals share sequence similarity over the entire BMAL amino acid sequence and must share a common evolutionary progenitor (LEE et al. 2000 ). Mice lacking fully functional CLOCK have reduced photoinduction of mPer1, mPer2, and c-fos in the SCN (SHEARMAN et al. 1999 ), while flies mutant for dClock and dBmal lack the peak in locomotor activity observed in flies immediately following lights on in an LD cycle. This response is not lost in a per or tim null mutant (ALLADA et al. 1998 ; RUTILA et al. 1998 ). Within the mouse and Drosophila circadian system these proteins perform an analogous function to WC-1 and WC-2, being a positive component of the molecular circadian loop. Thus, like WC-1 and WC-2, these PAS domain-containing transcription factors may be involved in regulating clock-related photoresponses in mice and flies.

Several lines of evidence suggest that WC-1 and WC-2 regulate photoresponses as a heterodimeric transcription factor. Along with their varied roles in light responses they are also both involved in regulating frq expression in the dark. How can the function of WC-1 and WC-2 in frq light responses, general light responses (e.g., al-3 transcription), and in regulating frq in DD be separated? Presumably if WC-1 and WC-2 were solely responsible for induction of light-regulated transcripts and solely responsible for induction of frq in DD as part of the circadian clock, then all fast light-induced transcripts might also be clock regulated, assuming they had comparable stability. However, not all transcripts that are photoregulated by WC-1 and WC-2 are clock-regulated transcripts [e.g., the al-3 (m) transcript; ARPAIA et al. 1995a]. Additionally, light and clock regulation of eas (ccg-2) transcript act through separate elements in the eas (ccg-2) promoter (BELL-PEDERSEN et al. 1996A ). It is also established that a number of WC-dependent clock-regulated genes are not photoinducible (BELL-PEDERSEN et al. 1996B ). Also, mutants have been isolated that are impaired in only one light response but not others, indicating the existence of separate pathways for blue-light responses in Neurospora (LINDEN et al. 1997A ), and Neurospora has been shown to have a bifurcated light input pathway for conidiation and carotenogenesis (MERROW et al. 2001 ). In agreement with these observations, data presented herein reveal that photic regulation of frq is distinct from another light-regulated gene (al-3), but is dependent on WC-2, and demonstrate distinct regulation of frq in DD, LL, and following a light pulse. Hence WC-1 and WC-2 appear to be involved in a number of distinct mechanisms regulating gene expression in Neurospora. Assuming heterodimers of WC-1 and WC-2 are solely responsible for light-induced expression of al-3 (m) and other carotenogenic genes (supported by the lack of other mutants blocked in this pathway despite several saturating genetic screens; DEGLI-INNOCENTI and RUSSO 1984B ; LINDEN et al. 1997B ), we could expect a distinct mechanism for regulating the clock-specific expression of frq. This may be mediated by specific transcription factors besides WC-1 and WC-2, and additional factors could be involved in the light regulation of frq. For instance, WC-1 and WC-2 could recognize other transcription factors (e.g., VIVID) that are specific for certain light-regulated genes. This would allow WC-1 and WC-2 to function in light responses, yet also play a role in the dark regulation of the clock, and impart specificity on the transcription of the appropriate groups of genes. Alternatively, WC-1 and WC-2 could have several mechanisms of action, each specific to the regulation of a distinct set of genes. Whatever the case, regulation of frq expression in Neurospora is clearly complex, and WC-2 plays an essential role in this process.

	FOOTNOTES

¹ Present address: New Zealand Dairy Research Institute, Palmerston North, Private Bag 11029, New Zealand.
² Present address: Pfizer Discovery Technology Center, Cambridge, MA 02138.

	ACKNOWLEDGMENTS

We thank Lina Zhang, Anne Cole, and Brenda Parsons for assistance in constructing the wc-2 deletion allele and members of our laboratory for scientific discussion and comments on this manuscript. This work was supported by grants from the National Science Foundation (MCB-0084509 to J.J.L.), the National Institutes of Health (MH44651 to J.C.D. and J.J.L.; MH01186 and GM34985 to J.C.D.), and the Norris Cotton Cancer Center core grant at Dartmouth Medical School.

Manuscript received August 6, 2001; Accepted for publication October 9, 2001.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALBRECHT, U., Z. SUN, G. EICHELE, and C. LEE, 1997  A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light. Cell 91:1055-1064[Medline].

ALLADA, R., N. E. WHITE, W. V. SO, J. C. HALL, and M. ROSBASH, 1998  A mutant Drosophila homolog of mammalian Clock disrupts circadian rhythms and transcription of period and timeless. Cell 93:791-804[Medline].

ARONSON, B. D., K. A. JOHNSON, and J. C. DUNLAP, 1994  The circadian clock locus frequency: A single ORF defines period length and temperature compensation. Proc. Natl. Acad. Sci. USA 91:7683-7687[Abstract/Free Full Text].

ARPAIA, G., J. J. LOROS, J. C. DUNLAP, G. MORELLI, and G. MACINO, 1993  The interplay of light and the circadian clock: independent dual regulation of clock-controlled gene ccg-2 (eas). Plant Physiol. 102:1299-1305[Abstract].

ARPAIA, G., A. CARATTOLI, and G. MACINO, 1995a  Light and development regulate the expression of the albino-3 gene in Neurospora crassa. Dev. Biol. 170:626-635[Medline].

ARPAIA, G., J. J. LOROS, J. C. DUNLAP, G. MORELLI, and G. MACINO, 1995b  The circadian clock-controlled gene ccg-1 is induced by light. Mol. Gen. Genet. 247:157-163[Medline].

BALLARIO, P. and G. MACINO, 1997  White collar proteins: PASsing the light signal in Neurospora crassa. Trends Microbiol. 5:458-462[Medline].

BALLARIO, P., P. VITTORIOSO, A. MAGRELLI, C. TALORA, and A. CABIBBO et al., 1996  White collar-1, a central regulator of blue-light responses in Neurospora crassa, is a zinc-finger protein. EMBO J. 15:1650-1657[Medline].

BALLARIO, P., C. TALORA, D. GALLI, H. LINDEN, and G. MACINO, 1998  Roles in dimerization and blue light photoresponses of PAS and LOV domains of Neurospora crassa white collar proteins. Mol. Microbiol. 29:719-729[Medline].

BELL-PEDERSEN, D., J. C. DUNLAP, and J. J. LOROS, 1996a  Distinct cis-acting elements mediate clock, light, and developmental regulation of the Neurospora crassa eas (ccg-2) gene. Mol. Cell. Biol. 16:513-521[Abstract].

BELL-PEDERSEN, D., M. SHINOHARA, J. LOROS, and J. C. DUNLAP, 1996b  Circadian clock-controlled genes isolated from Neurospora crassa are late night to early morning specific. Proc. Natl. Acad. Sci. USA 93:13096-13101[Abstract/Free Full Text].

BRIGGS, W. R., C. F. BECK, A. R. CASHMORE, J. M. CHRISTIE, and J. HUGHES et al., 2001  The phototropin family of photoreceptors. Plant Cell 13:993-997[Free Full Text].

CERIANI, M. F., T. K. DARLINGTON, D. STAKNIS, P. MAS, and A. A. PETTI et al., 1999  Light-dependent sequestration of TIMELESS by CRYPTOCHROME. Science 285:553-556[Abstract/Free Full Text].

CERMAKIAN, N. and P. SASSONE-CORSI, 2000  Multilevel regulation of the circadian clock. Nat. Rev. Mol. Cell Biol. 1:59-67[Medline].

CHENG, P., Y. YANG, C. HEINTZEN, and Y. LIU, 2001  Coiled-coil domain-mediated FRQ-FRQ interaction is essential for its circadian function in Neurospora. EMBO J. 20:101-108[Medline].

COLLETT, M. A., J. C. DUNLAP, and J. J. LOROS, 2001  Circadian clock-specific roles for the light response protein WHITE COLLAR-2. Mol. Cell. Biol. 21:2619-2628[Abstract/Free Full Text].

CROSTHWAITE, S. C., J. J. LOROS, and J. C. DUNLAP, 1995  Light-induced resetting of a circadian clock is mediated by a rapid increase in frequency transcript. Cell 81:1003-1012[Medline].

CROSTHWAITE, S. C., J. C. DUNLAP, and J. J. LOROS, 1997  Neurospora wc-1 and wc-2: transcription, photoresponses, and the origins of circadian rhythmicity. Science 276:763-769[Abstract/Free Full Text].

DARLINGTON, T. K., K. WAGER-SMITH, M. F. CERIANI, D. STANKIS, and N. GEKAKIS et al., 1998  Closing the circadian loop: CLOCK induced transcription of its own inhibitors, per and tim. Science 280:1599-1603[Abstract/Free Full Text].

DAVIS, R. H., 2000 NEUROSPORA. Oxford University Press, London/New York/Oxford.

DAVIS, R. L. and D. DESERRES, 1970  Genetic and microbial research techniques for Neurospora crassa. Methods Enzymol. 27A:79-143.

DEGLI-INNOCENTI, F., and V. E. A. RUSSO, 1984a Genetic analysis of blue light-induced responses in Neurospora crassa, pp. 213–219 in Blue Light Effects in Biological Systems, edited by H. SENGER. Springer-Verlag, Berlin.

DEGLI-INNOCENTI, F. and V. RUSSO, 1984b  Isolation of new white collar mutants of Neurospora crassa and studies on their behavior in the blue light-induced formation of protoperithecia. J. Bacteriol. 159:757-761[Abstract/Free Full Text].

DENAULT, D., J. LOROS, and J. DUNLAP, 2001  WC-2 mediates WC-1-FRQ interaction within the PAS protein-linked circadian feedback loop of Neurospora. EMBO J. 20:109-117[Medline].

DUNLAP, J., 1999  Molecular bases for circadian clocks. Cell 96:271-290[Medline].

EDMUNDS, JR., L. N., 1988 Cellular and Molecular Bases of Biological Clocks. Springer-Verlag, New York.

GARCEAU, N., Y. LIU, J. J. LOROS, and J. C. DUNLAP, 1997  Alternative initiation of translation and time-specific phosphorylation yield multiple forms of the essential clock protein FREQUENCY. Cell 89:469-476[Medline].

GEKAKIS, N., D. STAKNIS, H. B. NGUYEN, F. C. DAVIS, and L. D. WILSBACHER et al., 1998  Role of the CLOCK protein in the mammalian circadian mechanism. Science 280:1564-1569[Abstract/Free Full Text].

GU, Y.-Z., J. B. HOGENESCH, and C. A. BRADFIELD, 2000  The PAS superfamily: sensors of environmental and developmental signals. Annu. Rev. Pharmacol. Toxicol. 40:519-561[Medline].

HARDING, R. W. and R. V. TURNER, 1981  Photoregulation of the carotenoid biosynthetic pathways in albino and white collar mutants of Neurospora crassa. Plant Physiol. 68:745-749[Abstract/Free Full Text].

HASTINGS, M. H., M. D. FIELD, E. S. MAYWOOD, D. R. WEAVER, and S. M. REPPERT, 1999  Differential regulation of mPER1 and mTIM proteins in the mouse suprachiasmatic nuclei: new insights into a core clock mechanism. J. Neurosci. 19:RC11.

HEINTZEN, C., J. J. LOROS, and J. C. DUNLAP, 2001  The PAS protein VIVID defines a clock-associated feedback loop that represses light input, modulates gating, and regulates clock resetting. Cell 104:453-464[Medline].

HUALA, E., P. W. OELLER, E. LISCUM, I. S. HAN, and E. LARSEN et al., 1997  Arabidopsis NPH1: a protein kinase with a putative redox-sensing domain. Science 278:2120-2123[Abstract/Free Full Text].

HUNTER-ENSOR, M., A. OUSLEY, and A. SEHGAL, 1996  Regulation of the Drosophila protein TIMELESS suggests a mechanism for resetting the circadian clock by light. Cell 84:677-685[Medline].

JARILLO, J. A., J. CAPEL, R. H. TANG, H. Q. YANG, and J. M. ALONSO et al., 2001  An Arabidopsis circadian clock component interacts with both CRY1 and phyB. Nature 410:487-490[Medline].

JOHNSON, C. H., 2001  Endogenous timekeepers in photosynthetic organisms. Annu. Rev. Physiol. 63:695-728[Medline].

LEE, K., J. LOROS, and J. DUNLAP, 2000  Interconnected feedback loops in the Neurospora circadian system. Science 289:107-110[Abstract/Free Full Text].

LI, C. and T. J. SCHMIDHAUSER, 1995  Developmental and photoregulation of al-1 and al-2 structural genes for two enzymes essential for carotenoid biosynthesis in Neurospora. Dev. Biol. 169:90-95[Medline].

LINDEN, H. and G. MACINO, 1997  White collar-2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa. EMBO J. 16:98-109[Medline].

LINDEN, H., P. BALLARIO, and G. MACINO, 1997a  Blue light regulation in Neurospora crassa. Fungal Genet. Biol. 22:141-150[Medline].

LINDEN, H., M. RODRIGUEZ-FRANCO, and G. MACINO, 1997b  Mutants of Neurospora crassa defective in regulation of blue light perception. Mol. Gen. Genet. 254:111-118[Medline].

LINDEN, H., P. BALLARIO, G. ARPAIA, and G. MACINO, 1999  Seeing the light: news in Neurospora blue light signal transduction. Adv. Genet. 41:35-54[Medline].

LIU, Y., J. LOROS, and J. DUNLAP, 2000  Phosphorylation of the Neurospora clock protein FREQUENCY determines its degradation rate and strongly influences the period length of the circadian clock. Proc. Natl. Acad. Sci. USA 97:234-239[Abstract/Free Full Text].

LUO, C., J. J. LOROS, and J. C. DUNLAP, 1998  Nuclear localization is required for function of the essential clock protein FREQUENCY. EMBO J. 17:1228-1235[Medline].

MARGOLIN, B. S., M. FREITAG, and E. U. SELKER, 1997  Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Fungal Genet. Newsl. 44:34-36.

MERROW, M., N. GARCEAU, and J. C. DUNLAP, 1997  Dissection of a circadian oscillation into discrete domains. Proc. Natl. Acad. Sci. USA 94:3877-3882[Abstract/Free Full Text].

MERROW, M., L. FRANCHI, Z. DRAGOVIC, M. GORL, and J. JOHNSON et al., 2001  Circadian regulation of the light input pathway in Neurospora crassa. EMBO J. 20:307-315[Medline].

MYERS, M., K. WAGER-SMITH, A. ROTHENFLUH-HILFIKER, and M. YOUNG, 1996  Light-induced degradation of TIMELESS and entrainment of the Drosophila circadian clock. Science 271:1736-1740[Abstract].

NAIDOO, N., W. SONG, M. HUNTER-ENSOR, and A. SEHGAL, 1999  A role for the proteasome in the light response of the timeless clock protein. Science 285:1737-1741[Abstract/Free Full Text].

NELSON, M. A., G. MORELLI, A. CARATTOLI, N. ROMANO, and G. MACINO, 1989  Molecular cloning of a Neurospora crassa carotenoid biosynthetic gene (albino-3) regulated by blue light and the products of the white collar locus. Mol. Cell. Biol. 9:1271-1276[Abstract/Free Full Text].

ORBACH, M. J., 1994  A cosmid with a HyR marker for fungal library construction and screening. Gene 150:159-162[Medline].

PANDO, M. P. and P. SASSONE-CORSI, 2001  Molecular clocks. A vivid loop of light. Nature 410:311-313[Medline].

PERKINS, D. D., A. RADFORD, D. NEWMEYER, and M. BJORKMAN, 1982  Chromosomal loci of Neurospora crassa. Microbiol. Rev. 46:426-570[Free Full Text].

PITTENDRIGH, C. S., 1993  Temporal organization: reflections of a Darwinian clock-watcher. Annu. Rev. Physiol. 55:17-54.

RUSSO, V., 1988  Blue light induces circadian rhythms in the bd mutant of Neurospora: double mutants bd, wc-1 and bd, wc-2 are blind. J. Photochem. Photobiol. B 2:59-65[Medline].

RUTILA, J. E., V. SURI, M. LE, W. V. SO, and M. ROSBASH et al., 1998  CYCLE is a second bHLH-PAS clock protein essential for circadian rhythmicity and transcription of Drosophila period and timeless. Cell 93:805-813[Medline].

SAMBROOK, H., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SARGENT, M. L. and W. R. BRIGGS, 1967  The effect of light on a circadian rhythm of conidiation in Neurospora. Plant Physiol. 42:1504-1510[Abstract/Free Full Text].

SCHEPER, T. O., D. KLINKENBERG, J. VAN PELT, and C. PENNARTZ, 1999  A model of molecular circadian clocks: multiple mechanisms for phase shifting and a requirement for strong nonlinear interactions. J. Biol. Rhythms 14:213-220[Abstract/Free Full Text].

SCHWERDTFEGER, C. and H. LINDEN, 2000  Localization and light-dependent phosphorylation of white collar 1 and 2, the two central components of blue light signaling in Neurospora crassa. Eur. J. Biochem. 267:414-422[Medline].

SHEARMAN, L. P., M. J. ZYLKA, D. R. WEAVER, L. F. KOLAKOWSKI, JR., and S. M. REPPERT, 1997  Two period homologs: circadian expression and photic regulation in the suprachiasmatic nuclei. Neuron 19:1261-1269[Medline].

SHEARMAN, L. P., M. J. ZYLKA, S. M. REPPERT, and D. R. WEAVER, 1999  Expression of basic helix-loop-helix/PAS genes in the mouse suprachiasmatic nucleus. Neuroscience 89:387-397[Medline].

SHIGEYOSHI, Y., K. TAGUCHI, S. YAMAMOTO, S. TAKEIDA, and L. YAN et al., 1997  Light-induced resetting of a mammalian circadian clock is associated with rapid induction of the mPer1 transcript. Cell 91:1043-1053[Medline].

SHRODE, L. B., Z. A. LEWIS, L. D. WHITE, D. BELL-PEDERSEN, and D. J. EBBOLE, 2001  vvd is required for light adaptation of conidiation-specific genes of Neurospora crassa, but not circadian conidiation. Fungal Genet. Biol. 32:169-181[Medline].

SOMERS, D. E., P. F. DEVLIN, and S. A. KAY, 1998  Phytochromes and cryptochromes in the entrainment of the Arabidopsis circadian clock. Science 282:1488-1490[Abstract/Free Full Text].

SOMERS, D. E., T. F. SCHULTZ, M. MILNAMOW, and S. A. KAY, 2000  ZEITLUPE encodes a novel clock-associated PAS protein from Arabidopsis. Cell 101:319-329[Medline].

SOMMER, T., J. A. A. CHAMBERS, J. EBERLE, F. R. LAUTER, and V. E. A. RUSSO, 1989  Fast light-regulated genes of Neurospora crassa. Nucleic Acids Res. 17:5713-5723[Abstract/Free Full Text].

STABEN, C., B. JENSEN, M. SINGER, J. POLLACK, and M. SCHECHTMAN et al., 1989  Use of a bacterial Hygromycin B resistance gene as a dominant selectable marker in Neurospora crassa transformation. Fungal Genet. Newsl. 36:79-81.

TALORA, C., L. FRANCHII, H. LINDEN, P. BALLARIO, and G. MACINO, 1999  Role of a white collar-1-white collar-2 complex in blue-light signal transduction. EMBO J. 18:4961-4968[Medline].

WILLIAMS, J. A. and A. SEHGAL, 2001  Molecular components of the circadian system in Drosophila. Annu. Rev. Physiol. 63:729-755[Medline].

YOUNG, M. W., 1998  The molecular control of circadian behavioral rhythms and their entrainment in Drosophila. Annu. Rev. Biochem. 67:135-152[Medline].

ZATZ, M. (Editor), 1992 Circadian Rhythms. Elsevier, Amsterdam.

ZENG, H., Z. QIAN, M. MYERS, and M. ROSBASH, 1996  A light-entrainment mechanism for the Drosophila circadian clock. Nature 380:129-135[Medline].

This article has been cited by other articles:

				K. Schneider, S. Perrino, K. Oelhafen, S. Li, A. Zatsepin, P. Lakin-Thomas, and S. Brody Rhythmic Conidiation in Constant Light in Vivid Mutants of Neurospora crassa Genetics, March 1, 2009; 181(3): 917 - 931. [Abstract] [Full Text] [PDF]

				J. C. Dunlap Salad Days in the Rhythms Trade Genetics, January 1, 2008; 178(1): 1 - 13. [Full Text] [PDF]

				L. Navarro-Sampedro, C. Yanofsky, and L. M. Corrochano A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription Genetics, January 1, 2008; 178(1): 171 - 183. [Abstract] [Full Text] [PDF]

				M. Shi, L. F. Larrondo, J. J. Loros, and J. C. Dunlap A developmental cycle masks output from the circadian oscillator under conditions of choline deficiency in Neurospora PNAS, December 11, 2007; 104(50): 20102 - 20107. [Abstract] [Full Text] [PDF]

				L. Lombardi, K. Schneider, M. Tsukamoto, and S. Brody Circadian Rhythms in Neurospora crassa: Clock Mutant Effects in the Absence of a frq-Based Oscillator Genetics, March 1, 2007; 175(3): 1175 - 1183. [Abstract] [Full Text] [PDF]

				J.C. Dunlap, J.J. Loros, H.V. Colot, A. Mehra, W.J. Belden, M. Shi, C.I. Hong, L.F. Larrondo, C.L. Baker, C.-H. Chen, et al. A Circadian Clock in Neurospora: How Genes and Proteins Cooperate to Produce a Sustained, Entrainable, and Compensated Biological Oscillator with a Period of about a Day Cold Spring Harb Symp Quant Biol, January 1, 2007; 72(0): 57 - 68. [Abstract] [PDF]

				J. Cha, G. Huang, J. Guo, and Y. Liu Posttranslational Control of the Neurospora Circadian Clock Cold Spring Harb Symp Quant Biol, January 1, 2007; 72(0): 185 - 191. [Abstract] [PDF]

				J. J. Loros, J. C. Dunlap, L. F. Larrondo, M. Shi, W. J. Belden, V. D. Gooch, C.-H. Chen, C. L. Baker, A. Mehra, H. V. Colot, et al. Circadian Output, Input, and Intracellular Oscillators: Insights into the Circadian Systems of Single Cells Cold Spring Harb Symp Quant Biol, January 1, 2007; 72(0): 201 - 214. [Abstract] [PDF]

				J. C. Dunlap Proteins in the Neurospora Circadian Clockworks J. Biol. Chem., September 29, 2006; 281(39): 28489 - 28493. [Full Text] [PDF]

				W.-F. Chen, J. Majercak, and I. Edery Clock-Gated Photic Stimulation of Timeless Expression at Cold Temperatures and Seasonal Adaptation in Drosophila J Biol Rhythms, August 1, 2006; 21(4): 256 - 271. [Abstract] [PDF]

				Y. Liu and D. Bell-Pedersen Circadian Rhythms in Neurospora crassa and Other Filamentous Fungi. Eukaryot. Cell, August 1, 2006; 5(8): 1184 - 1193. [Full Text] [PDF]

				R. M. de Paula, Z. A. Lewis, A. V. Greene, K. S. Seo, L. W. Morgan, M. W. Vitalini, L. Bennett, R. H. Gomer, and D. Bell-Pedersen Two Circadian Timing Circuits in Neurospora crassa Cells Share Components and Regulate Distinct Rhythmic Processes J Biol Rhythms, June 1, 2006; 21(3): 159 - 168. [Abstract] [PDF]

				A. C. Froehlich, B. Noh, R. D. Vierstra, J. Loros, and J. C. Dunlap Genetic and Molecular Analysis of Phytochromes from the Filamentous Fungus Neurospora crassa Eukaryot. Cell, December 1, 2005; 4(12): 2140 - 2152. [Abstract] [Full Text] [PDF]

				Q. He and Y. Liu Molecular mechanism of light responses in Neurospora: from light-induced transcription to photoadaptation Genes & Dev., December 1, 2005; 19(23): 2888 - 2899. [Abstract] [Full Text] [PDF]

				Q. He, P. Cheng, Q. He, and Y. Liu The COP9 signalosome regulates the Neurospora circadian clock by controlling the stability of the SCFFWD-1 complex Genes & Dev., July 1, 2005; 19(13): 1518 - 1531. [Abstract] [Full Text] [PDF]

				Q. He, H. Shu, P. Cheng, S. Chen, L. Wang, and Y. Liu Light-independent Phosphorylation of WHITE COLLAR-1 Regulates Its Function in the Neurospora Circadian Negative Feedback Loop J. Biol. Chem., April 29, 2005; 280(17): 17526 - 17532. [Abstract] [Full Text] [PDF]

				J. C. Dunlap and J. J. Loros The Neurospora Circadian System J Biol Rhythms, October 1, 2004; 19(5): 414 - 424. [Abstract] [PDF]

				M. K. Christensen, G. Falkeid, J. J. Loros, J. C. Dunlap, C. Lillo, and P. Ruoff A Nitrate-Induced frq-Less Oscillator in Neurospora crassa J Biol Rhythms, August 1, 2004; 19(4): 280 - 286. [Abstract] [PDF]

				Y. Tan, M. Merrow, and T. Roenneberg Photoperiodism in Neurospora Crassa J Biol Rhythms, April 1, 2004; 19(2): 135 - 143. [Abstract] [PDF]

				Y. Yang, P. Cheng, Q. He, L. Wang, and Y. Liu Phosphorylation of FREQUENCY Protein by Casein Kinase II Is Necessary for the Function of the Neurospora Circadian Clock Mol. Cell. Biol., September 1, 2003; 23(17): 6221 - 6228. [Abstract] [Full Text] [PDF]

				T. Granshaw, M. Tsukamoto, and S. Brody Circadian Rhythms in Neurospora Crassa: Farnesol or Geraniol Allow Expression of Rhythmicity in the Otherwise Arrhythmic Strains frq 10, wc-1, and wc-2 J Biol Rhythms, August 1, 2003; 18(4): 287 - 296. [Abstract] [PDF]

				T. Roenneberg, S. Daan, and M. Merrow The Art of Entrainment J Biol Rhythms, June 1, 2003; 18(3): 183 - 194. [Abstract] [PDF]

				Y. Liu Molecular Mechanisms of Entrainment in the Neurospora Circadian Clock J Biol Rhythms, June 1, 2003; 18(3): 195 - 205. [Abstract] [PDF]

				A. C. Froehlich, J. J. Loros, and J. C. Dunlap Rhythmic binding of a WHITE COLLAR-containing complex to the frequency promoter is inhibited by FREQUENCY PNAS, May 13, 2003; 100(10): 5914 - 5919. [Abstract] [Full Text] [PDF]

				P. Cheng, Q. He, Y. Yang, L. Wang, and Y. Liu Functional conservation of light, oxygen, or voltage domains in light sensing PNAS, May 13, 2003; 100(10): 5938 - 5943. [Abstract] [Full Text] [PDF]

				P. Cheng, Y. Yang, L. Wang, Q. He, and Y. Liu WHITE COLLAR-1, a Multifunctional Neurospora Protein Involved in the Circadian Feedback Loops, Light Sensing, and Transcription Repression of wc-2 J. Biol. Chem., January 31, 2003; 278(6): 3801 - 3808. [Abstract] [Full Text] [PDF]

				Q. He, P. Cheng, Y. Yang, L. Wang, K. H. Gardner, and Y. Liu White Collar-1, a DNA Binding Transcription Factor and a Light Sensor Science, August 2, 2002; 297(5582): 840 - 843. [Abstract] [Full Text] [PDF]

				A. C. Froehlich, Y. Liu, J. J. Loros, and J. C. Dunlap White Collar-1, a Circadian Blue Light Photoreceptor, Binding to the frequency Promoter Science, August 2, 2002; 297(5582): 815 - 819. [Abstract] [Full Text] [PDF]