- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Li, Y.
- Articles by Alleman, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Li, Y.
- Articles by Alleman, M.
Gene Conversion Within Regulatory Sequences Generates Maize r Alleles With Altered Gene Expression
Ying Lia, John P. Bernota, Charles Illingworthc, Wyatt Lisona, Kelsie M. Bernota, William B. Egglestonb, Keri J. Foglea, James E. DiPaolaa, Jerry Kermiclec, and Mary Allemanaa Department of Biological Sciences, Duquesne University, Pittsburgh, Pennsylvania 15282,
b Department of Biology, Virginia Commonwealth University, Richmond, Virginia 23284
c Laboratory of Genetics, University of Wisconsin, Madison, Wisconsin 53706
Corresponding author: Mary Alleman, Department of Biological Sciences, Duquesne University, Pittsburgh, PA 15282., alleman{at}duq.edu (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
The maize r locus encodes a transcription factor that regulates the developmental expression of the plant pigment anthocyanin. In an unusual example of gene regulatory diversity, the R-sc (Sc, strong seed color) and the R-p (P, plant color) alleles of r have nonoverlapping tissue specificity and nonhomologous 5' flanking sequences. Heterozygotes between wild-type P and Sc mutants with Ds6 transposable element inserts (r-sc:m::Ds6 or sc:m) produce colored seed derivatives (Sc+) during meiotic recombination. The sc:m alleles with Ds6 insertion in 3' regions of r produce crossover Sc+ derivatives. sc:m alleles with Ds6 elements inserted in 5' regions produce rare Sc+ derivatives borne on nonrecombinant chromosomes. Among 52 such noncrossover Sc+ derivatives, 18 are indistinguishable from the Sc progenitor in phenotype and DNA sequence [Scp(+) alleles]. The remaining 34 derivatives have strong Sc+ expression, including darkly pigmented aleurone, scutellum, coleoptile, and scutellar node [Scp(e) alleles]. The coleoptile and scutellar node phenotypes are unique from either progenitor but are similar to those of some naturally occurring r alleles. Both classes of Sc+ derivatives are explained by gene conversion between the promoter region of Sc:124 and a homologous region located proximal to P. The recombinational intermediate formed between sc:m alleles and P results in deletion of the Ds6 element alone or both Ds6 and a nearby unrelated transposable element-like sequence.
ONE of several loci in maize that regulates the transcription of the genes that encode the biosynthetic enzymes for anthocyanin, the purple pigment found in plants (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The r chromosomal region in many maize varieties is structurally complex, containing up to five genes per r haplotype. Individual genes in a haplotype can be arranged in either direct or inverted orientation and either closely spaced or spread over several hundred kilobase pairs (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
r and other kernel-specific maize genes are also used in the study of homologous recombination in higher plants. Recombinant alleles can be recovered from heteroallelic combinations by selecting phenotypic derivatives from large populations of progeny. Several novel observations have resulted from studies of recombination in plants compared to the yeast Saccharomyces cerevisiae. First, studies with the genes a (anthocyaninless-1), r, wx, and bz (bronze-1) indicate that, although conversion tracts are the same approximate length in plants vs. yeast, noncrossover products are recovered much less frequently than crossover products (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
This study explores recombination between two r alleles chosen for their phenotypic dissimilarity. R-sc (Sc) and R-p (P) alleles are derived as simplex alleles from the R-st (stippled) and R-r:std (standard) complexes, respectively (![]()
![]()
![]()
![]()
![]()
![]()
|
The target alleles for this study include indistinguishable P alleles and 41 transposable element-containing mutants of the simplex Sc:124 allele. This series of r-sc:m::Ds6 mutants (or, for simplicity, sc:m) were generated using a cyclic mutagenesis scheme in which the transposable element Ds6 was mobilized by the autonomous element, Ac, to excise and reinsert back into Sc at a high frequency (![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have used heteroallelic combinations of P and 39 of the 41 sc:m to recover colored seed (Sc+) progeny. This article reports a striking difference in the recombinational properties of sc:m that are located in 3' as compared to 5' regions of Sc:124. Frequently, 3'-located mutants recombine with P to produce Sc+ derivatives, usually crossover in origin. In contrast, 5'-located mutants produce Sc derivatives that are reduced in total frequency and noncrossover in origin. In addition, some of the Sc+ derivatives from 5'-located sc:m have a novel phenotype in which aleurone, scutellum, coleoptile, and scutellar node are strongly pigmented, distinct from sc:m, P, or Sc:124. These derivatives are associated with loss of the Ds6 element and another nearby sequence from Sc:124. Structural attributes of the r gene in which the two groups of sc:m alleles reside are not sufficient to explain this recombinational dichotomy.
| MATERIALS AND METHODS |
|---|
Maize lines and genetics:
All maize lines used had an inbred W22 genetic background, established by five or more generations of backcrossing. The r allele R-sc:124 (Sc:124) is a simplex allele that is the progenitor of all sc:m mutants described in this report. The phenotype of Sc:124 and other similar Sc alleles is strong nonimprinted aleurone pigmentation and weak coleoptile pigmentation. The sc:m alleles used in this research are colorless or pale seed mutations described previously (![]()
![]()
Several r alleles were used in these experiments because of contrasting phenotypes or structures readily distinguished from the test alleles. The r-
902 allele is a deletion including 11.3 kbp of r coding region and 5' untranslated sequences (![]()
![]()
![]()
![]()
![]()
![]()
The r-linked loci g1 (golden-1 plant color, 20 cM proximal) and mst1 (modifier of stippling due to R-st, 6 cM distal) were used as flanking markers for recombination studies. The g1 alleles that were used are G1-w22 (wild type) and g1-1 (mutant). The g1 phenotype is scored during a germination test in which g1-1 produces a light golden-colored plant tissue relative to G1-w22, which produces green tissue. The Mst1-1 mutant allele is a dominant modifier of stippling that is assayed in the presence of the r-g:nc3.5 allele (![]()
The P-vv::Ac allele (variegated pericarp color) of the P locus on chromosome 1 was used as the source of the autonomous transposable element Ac (Activator) for these experiments. The unlinked recessive allele wx1-1 (waxy-1 seed) was used as a pollen contamination marker.
sc:m mutant alleles used in these experiments include 42 insertions of the transposable element Ds6 (sc:m3, m301-m328, m330-m341, and m9) and one with insertion of transposable element Ds1 (sc:m1). These alleles produce colorless or pale aleurone in the absence of transposable element Ac and spotted aleurone in the presence of Ac (![]()
![]()
Isolation of Sc+ derivatives:
The genetic starting material for these experiments includes 39 sc:m mutations of Sc:124 with insertion of the Ds6 element. Positions of the insertions are distributed throughout the r coding and 5' flanking regions (![]()
Recombination tests were performed as follows. Seeds of the genotype g1-1, P, Mst1-1/G1-w22, sc:m::Ds6, mst1-w22; wx1-1/Wx1-w22 and involving each of the sc:m alleles were planted as detasseled female rows in an isolation plot with alternating rows of homozygous g1-1, r-g:8p mst1-w22; wx1-1 as the male parent. The resulting ears were screened for Sc+ kernels. The selected kernels were progeny tested to determine Sc+ heritability and the flanking marker combination. Seedling phenotypes of P and g1 were assayed in germination trays under fluorescent lighting at 18°20°. The mst1 phenotype was tested by crossing Sc+ individuals with the nearly colorless R-st derivative allele r-g:nc3.5 and pollinating the heterozygous plants with a colorless seed r allele. The recombinant Mst1-1, r-g:nc3.5 phenotype is spotted kernels while the mst1-w22, r-g:nc3.5 phenotype is unspotted kernels.
In most experiments, the genotype g1-1 sc:m mst1-w22/G1-w22 P (P:n19, P:n46, or P:n142) Mst1-1 was the female parent. In a few experiments involving 5'-located sc:m, seeds of the genotype g1-1 sc:m mst1-w22/G1-w22 P (p:m3 or p:m1) Mst1-1 in which a Ds insertion was also present at the P allele located in the protein-coding region were used (![]()
![]()
|
|
Molecular analyses:
Maize DNA was isolated according to ![]()
![]()
phage were screened using radiolabeled r probe (Nj:1). Three clones (
MB1,
MD1, and
MF2) contained the 5' region of the Sc gene, confirmed by restriction endonuclease mapping. Clone
R4.7 containing the P gene of R-r:std was received from Dr. T. Robbins (![]()
Regions of clones
MF2 and
R4.7 were subcloned into pBluescript vectors (Stratagene, La Jolla, CA) for DNA sequence analysis. Dideoxy chain termination sequencing using Sequenase II kits (United States Biochemical, Cleveland) was used with single-stranded templates. Sequencing strategies included subcloning, synthetic primer design, and the generation of nested deletions (Exo/Mung deletion kit, Stratagene). Subsequent sequencing of mutants and derivatives used double-stranded sequencing of plasmids or PCR products and the ABI automated DNA sequencing system (Perkin-Elmer, Norwalk, CT). All DNA sequence analysis used MacVector software (Oxford Molecular Group, Palo Alto, CA).
Synthetic oligonucleotides (Oligos or Operon, Alameda, CA) specific to regions of the Ds6 element or the r gene were used as PCR primers to generate probes, for inverse PCR, and for the mapping of the position of Ds6 elements in Sc. They include the following: B32 (CTCGATGTCTGTCAAGCGTTGG), B66 (TTCACCAAACAAAAGCTGGCGG), B971 (GCTAGCCTTGCTAATAC), B104 (TTGGCTGTACGCATTACCATGC), B129 (TTGTGTCATGTGGCTCC), B530 (GTACGTAACACGCATGG), B2261 (TAGGAGTTTGGGACTCTTCCG), F3 (TGCGACGGACAAGAAGATTTG), F4 (TTCTCGGACGTTTTCCCAGCAG), F17 (AAGCAGCAGGAGACGAAGGTAG), F59 (GACGGACGAATTGAAGAACACCTG), F66 (CCGCCAGCTTTTGTTTGGTGAA), F1178 (ATCCTCAGACGCTACACGACAC), MAR102 (GGATATACCGGTAACGAAAACGA), and MAR103 (TTCGTTTTTTACCTCGGGTTC). MAR102 and MAR103 are specific to transposable element Ac and Ds6 sequences. Other primers were from the Sc:124 sequence. The locations of Sc and P primers are shown in Fig 2.
|
The positions of the Ds6 insertions at the 5' end of the Sc gene were determined using Ds6 primer MAR102 or MAR103 and a flanking r-specific primer. PCR was performed using genomic DNA as a template and Amplitaq DNA polymerase (Applied Biosystems, Foster City, CA). PCR products were purified and cloned into the pCRII vector (Invitrogen, San Diego) for sequencing.
Probes were gel-isolated restriction fragments or PCR products that were radiolabeled by random-primed incorporation of [32P]dCTP or digoxygenin-labeled dCTP (Roche Molecular Biochemicals, Indianapolis). PCR using primer combination F4/B971 and P DNA as a template was used to isolate the YL1 probe. Probes BH1415 and PX1029 were gel-purified restriction fragments from a subclone of
MF2. Nj:1 was a probe derived from clone pR-Nj:1, a BglII/HincII subclone from the R-Nj:Cudu mutant r-nj:m1 (![]()
The location of P:A was determined with respect to the P gene using Southern blot analysis of restriction fragment length polymorphism (RFLP) data. Two types of recombinant alleles were used: (1) three Sc+ alleles from sc:m/P heterozygotes in which flanking marker combinations indicated a recombinant origin (Sc:n3081, Sc:n3082, and Sc:n3083 derived from sc:m308/P heterozygotes) and (2) three p:m::Ds alleles (p:m1, p:m3, or p:m9) that had the reciprocal combination of flanking markers relative to the Sc+ alleles (![]()
| RESULTS |
|---|
Recombination with P divides the Sc gene into two distinct regions:
The general approach of these experiments was to use meiotic recombination to explore the structure and behavior of two distinct r progenitor alleles, Sc (seed color) and P (plant color). These two r alleles were derived from very different progenitor r haplotypes and have nonoverlapping tissue specificity. By constructing heterozygotes of 39 colorless seed sc:m mutants and wild-type P alleles, colored seed derivatives can be selected. The diagram in Fig 3 shows the composition of the heterozygotes that were used in these experiments and the strategy for derivative selection.
|
From populations of 13,70046,500 progeny kernels, Sc+ derivatives were recovered in frequencies ranging from 0 to 0.233% Sc+ kernels per sc:m chromosome tested (Table 1). The 39 sc:m alleles fall into two distinct groups defined by the relative frequency of Sc+ derivatives and by the association of these derivatives with recombination of alleles of the flanking marker loci golden-1 (g1) and modifier of stippled-1 (mst1). Group I sc:m mutants produce Sc+ derivatives at relatively high frequencies, averaging 6.1 x 10-4 Sc+ per chromosome tested. Nearly all of these derivatives (416 of 434 Sc+) are carried on recombinant chromosomes carrying the 5' flanking marker of the sc:m parent and the 3' flanking marker of the P parent. In contrast, heterozygotes involving group II sc:m mutants produce Sc+ infrequently, averaging 6.4 x 10-5 Sc+ per chromosome tested, most of which are associated with the noncrossover flanking marker combination of the sc:m parent (21 of 28 Sc+). Spotted kernels were not present among the testcross populations, indicating absence of an active Ac element. Furthermore, germinal Sc+ revertants as well as spotted kernels were absent in populations of sc:m homozygotes (![]()
Group II sc:m mutants are located in 5' flanking regions of Sc:
Preliminary studies indicated that group I alleles contain Ds6 insertions located in relatively 3' regions of r whereas group II alleles are located in relatively 5' regions, mostly upstream of the transcription start site (![]()
EMBL3 as recombinant phage
MF2, part of which was subcloned and sequenced (GenBank accession number for Sc 5' flanking DNA:
AF380388). The Sc sequence was compared with the published sequence of the lc gene, a displaced member of the r gene family, to determine sequence landmarks and the orientation of the cloned DNA (![]()
The precise locations of the 5'-located group II alleles and alleles near the boundary of the two regions were determined by PCR analysis and DNA sequencing. PCR products overlapping the Ds6 insertion sites for each of the mutants were generated using oligonucleotide primers, one specific to Ds6 and the other using Sc sequence near the mapped positions of the sc:m alleles. Sequencing determined the insertion site for each mutant as the 8 bp of target site duplication adjacent to the Ds6 element. The insertion sites for the 19 5'-most Ds6 insertional mutants are shown on the map of Sc in Fig 2. On the basis of these results, group I and group II alleles are demarcated at an approximate position 370470 bp 3' of the Sc transcription start site or between the insertion sites of sc:m337 and m312. Although derivative frequencies from sc:m/P for sc:m located close to this position are infrequent, Ds6 insertion sites close to the boundary include m338 (four convertants/zero crossovers), m337 (two convertants/zero crossovers), m312 (zero convertant/one crossover), m320 (zero convertants/zero crossovers), and m308 (zero convertants/three crossovers). Crossover data for individual alleles are not delineated in Table 1.
The sequence of the P region homologous to the sc:m insertion sites indicates a structurally segmented region proximal to the P allele:
Because upstream regions of maize genes can be very different for alleles with distinct tissue specificities (![]()
R4.7 from Dr. T. Robbins (![]()
R4.7 was subcloned and sequenced (published as GenBank accession no.
AF380390). Sequence comparison of a 5646-bp region of
MF2 and a 4702-bp region of
R4.7 indicates that Sc and P are 99.7% identical in the 698 bp 5' of the start of transcription. Further 5' of -698, the two alleles are completely nonhomologous within the sequenced regions, including 3099 bp of 5' flanking DNA from Sc (
MF2) and 3560 bp of 5' flanking DNA from P (
R.47). The segment from
MF2 that is unique to the Sc gene contains the insertion site for 13 sc:m mutants and is designated Sc:A (Fig 2).
A recombination-based mechanism for the production of Sc+ alleles from sc:m/P heterozygotes requires that sequences homologous to the insertion sites of Ds6 mutations must be present in P. Southern blot analysis of genomic DNA from the P genotype indicated that sequences homologous to Sc:A are present in the P allele genome (not shown). This region (called P:A) was cloned using an inverse PCR (I-PCR) strategy (![]()
902 was digested separately with the restriction enzymes BamHI, BglII, and XbaI. Digested DNA was diluted to 2.5 ng/µl, favoring the formation of monomeric circles, and ligated with T4 DNA ligase to circularize the fragments. PCR using primers F4 and B530 amplified the flanking sequences. Southern blots of the PCR products were hybridized with YL210.1 to confirm homology with Sc:A. No PCR products or hybridization resulted when r-
902 DNA was used as the template (not shown). Three PCR products from P were cloned, including pYLB, pYLG, and pYLX, denoting the restriction enzyme source of the digested DNA as BamHI (B), BglII (G), or XbaI (X). Clone pYLB was sequenced as described above.
The sequence of I-PCR clone pYLB indicates a highly homologous, yet fragmented, P:A region relative to Sc:A (diagrammed in Fig 4). Four significant regions of discontinuity exist between these two sequences: (1) P:YL1 is a 1.6-kbp region located in P:A but not in Sc:A; (2) Bnot is a 471-bp region located in Sc:A but not in P:A (published independently of Sc:A as GenBank accession no.
AF380387); (3) P:YL2 is a large region of unknown length located between P:A and P, partially contained in clone
R4.7 (P); (4) A 416-bp segment of Sc:A is located adjacent to the r common region but is not present in P or P:A (Fig 4). These four insertion-deletion differences between P:A and Sc:A are defined as sequences that are present on one homolog but absent from the other. Excluding these insertion-deletion differences, the homologous segments shared by Sc:A and P:A are identical in sequence, a total of 2209 bp of DNA.
|
To characterize the genomic and r-linked copy numbers of insertion-deletion differences between P:A and Sc:A, Southern blot analyses were performed. Probes included Nj:1, a 600-bp region surrounding the promoter of all r genes; BH1415, a 1.4-kbp segment of Sc:A that is homologous to both P:A and Sc:A; YL1, a segment unique to P:A; PX1029, a segment of Sc:A containing part of the Bnot element; and YL202, a region of Sc:A that overlaps PX1029 but excludes Bnot. Fig 2 and Fig 4 show the location of these probes. Results are summarized below.
First, the relative copy number of the insertion-deletion differences was determined by Southern blot analysis. The YL1 region, present in P:A but not Sc:A, was used as a probe on Southern blots containing genomic DNA from Sc:124 and P:n46. A single band appears for P DNA but not for Sc:124 DNA (Fig 5A). YL1 is, therefore, unique to the genome of P and does not exist in the Sc gene or genome. Similarly, probes were generated from Bnot and the region of Sc:A that surrounds Bnot. The probe PX1029 contains most of the 471-bp Bnot segment. Hybridization of PX1029 to Southern blots containing Sc:124 and P:n46 DNA indicates that PX1029 hybridizes to
20 bands for DNA of either genotype (Fig 5B). A larger probe of this region excluding the Bnot segment (YL202) hybridizes to a single band on the same Southern blots (not shown). Thus, Sc:A is a single-copy segment and the Bnot element is the cause of the repetitive hybridization of probe PX1029.
|
To determine the copy number of Sc:A/P:A within complex r haplotypes, Southern blots containing genomic digests of Sc:124, P:n46, complex r haplotypes R-st and R-r:std Lc, were hybridized with probes Nj:1 and BH1415. R-st and R-r:std are the complex progenitor alleles of Sc and P; these r haplotypes each contain multiple r genes or pseudogenes. Previous studies indicate that R-r:std and R-st contain four Nj:1-homologous segments (![]()
![]()
![]()
The P:A region is located proximally to P on chromosome 10 and is not duplicated in complex r alleles:
Locating P:A relative to the P transcriptional unit was also accomplished by Southern blot analysis using RFLP analysis of recombinant r alleles. Two types of recombinant alleles were used, including (1) Sc+ from sc:m/P heterozygotes that were recombinant with respect to flanking markers and (2) the reciprocal product of this event, p:m::Ds (refer to Fig 3). Southern blots were produced using digested DNA from recombinant alleles and the Sc:A region probe BH1415 to map the position of P:A relative to the P structural gene. Recombinant Sc+ alleles (for example, Sc:n3081) contain the BH1415-hybridizing restriction fragment that is associated with the Sc allele. Recombinant p:m::Ds alleles (for example, p:m1 and p:m9) contain the BH1415-hybridizing restriction fragment that is associated with the P allele. Representative Southern blot data are shown in Fig 5D. This result indicates that the BH1415 homologous region P:A is proximal to P in R-r:std and simplex P alleles. In addition, individual restriction fragments from P, even fragments >15 kbp in length in which the 3'-located restriction site is located within the P promoter, do not hybridize to both BH1415 and Nj:1 (not shown), indicative of distance between the P promoter and P:A. Thus, P:A is located at a quasi-ectopic proximal site compared to the location of Sc:A, which is immediately 5' to the Sc promoter.
Bnot is a non-LTR-transposable element:
Several features of the Bnot segment from Sc:A are consistent with this element being a maize transposable element. First, Bnot is homologous to a multicopy sequence in the maize genome (Fig 5B). In addition, the Bnot sequence in Sc:A is flanked by a 22-bp imperfect direct repeat sequence [TCTTGCTTTTTTCTACTT (T/G) TTT] that is present once in the P:A sequence. This 22-bp sequence is assumed to represent the target site that was duplicated during insertion of Bnot into the Sc gene of R-st during maize evolution.
The 449-bp Bnot sequence, excluding the 22-bp flanking repeats, was compared to sequence databases using the BLASTN program (![]()
![]()
![]()
Recombination in sc:m/P heterozygotes involving the group II sc:m alleles produces a unique class of Sc derivatives:
Initial populations of progeny from sc:m/P heterozygotes produced a dichotomy between the derivatives of group I vs. group II sc:m mutants. In these experiments, few Sc+ were obtained from group II (NCO-generating) alleles. To determine a possible unique relationship between derivatives from group I vs. group II sc:m and the basis for the difference between these groups, larger populations of progeny kernels were generated from group II mutants. Two types of parental populations were used. These included sc:m/P (n19, n46, or n142) as described in Table 1 and sc:m/p:m::Ds (p:m3 or p:m1). The latter populations, in which a Ds insertion was located in the 3' region of P (see diagram in Fig 3), cannot generate Sc+ products by reciprocal recombination and were excluded from the data presented in Table 1. A total of 52 Sc+ were generated from sc:m/P or sc:m/p:m heterozygotes. Table 2 summarizes these data for individual alleles in group II mutants and those close to the border between groups II and I. A novel result emerges. Sc+ derivatives from eight of the group II sc:m are of two distinct phenotypic classes. The first class, Scp(+), is indistinguishable from Sc:124 crossover-derived Sc+ alleles from group I alleles and Sc+ revertants isolated in the presence of Ac. The second class, Scp(e) or enhanced pigment alleles, has the darkly pigmented aleurone and scutellum of Sc:124 but also has strongly pigmented coleoptile and scutellar node, unique from Sc:124, from the immediate progenitors sc:m and P, and from other Sc+ derivatives. Fig 1C and Fig D, shows the phenotypes of representative members of both classes of Scp alleles.
The Scp(+) and Scp(e) phenotypes are due to differences in gene conversion events in sc:m/P heterozygotes:
The structures of the Scp derivatives were determined using PCR amplification and DNA sequence analysis. DNA from several derivatives of both Scp(+) and Scp(e) classes were amplified via PCR using primers F17 and B2261 and sequenced directly. A total of six Scp(+) and five Scp(e) alleles were sequenced. The sequences of representative derivatives and progenitor alleles are shown in Fig 6. In all Scp(+) that were sequenced, the Ds6 element is deleted, consistent with the revertant Sc+ phenotype. In each case, the Ds6 element as well as the 8-bp target site duplication is excised precisely, restoring the progenitor Sc:124 sequence in the 517 bp flanking the original site of Ds6 insertion. In contrast, in addition to the loss of Ds6, the Scp(e) derivatives contain precise deletions of Bnot and one copy of the 22-bp direct repeat flanking it. Thus, there is a one-for-one correlation between enhanced expression of the Scp(e) alleles and deletion of Bnot. Production of Scp(+) and production of Scp(e) derivatives are presumed to occur by the same mechanism, gene conversion events in which the recombinational intermediate can be repaired in two ways, one deleting only Ds6 [Scp(+)] and the other deleting Ds6 and Bnot [Scp(e)].
|
A conversion tract of at least 200 bp is necessary to remove both Bnot and Ds6 from the sc:m. To determine if the YL1 region was included in the conversion tract, primers F4 and B2261 were used to amplify DNA from the same 11 Scp derivatives. The presence of the YL1 sequence in any of the Scp derivatives would indicate coconversions of both this region and the Bnot region during meiotic recombination. In each case, amplification of a 1.5-kbp product [Scp(+)] or a 1-kbp product [Scp(e)] indicated that YL1 was not present in the Scp alleles (not shown).
Thus, a region of the Sc gene containing Ds insertional mutants is able to undergo gene conversion with a proximal segment of homology located upstream of the promoter of the P gene from R-r:std. The positions of the Ds6 insertions and the types and numbers of Sc+ derivatives that are produced from sc:m alleles show a strong correlation (Fig 2 and Table 2). Of the 14 mapped group II sc:m alleles, the 8 sc:m for which the insertion is located within or 5' of the Bnot element generated Sc+ derivatives of both Scp(+) and Scp(e) types (m305, m311, m316, m322, m328, m330, m333, and m341). Three insertions located 3' of the Bnot element in a 416-bp segment that is not present in P:A (segment 4, Fig 4) produced no Sc+ derivatives (m315, m331, and m332). Three alleles that were located 3' of the Sc:A region produced only Scp(+) derivatives (m323, m337, and m338).
| DISCUSSION |
|---|
The maize r locus is unique among plant genes because of the diverse array of expression patterns of variant r alleles affecting nearly all parts of the seed and plant. r allele phenotypic diversity is the result of the complex structure of r alleles, including variation among the genes in an r haplotype and regulatory complexity of single transcriptional unit r genes (![]()
![]()
![]()
![]()
We have used heteroallelic combinations of P and 39 Ds6 insertion mutations (sc:m) in the maize Sc:124 allele to recover colored seed (Sc+) progeny. Three principal results emerge from these studies.
- A recombinational dichotomy occurs at a position
370470 bp from the start of r transcription. sc:m alleles located 5' of that position (group II alleles) produce colored seed (Sc+) variants by gene conversion. sc:m mutants located 3' of that position (group I alleles) produce Sc+ variants at a 10-fold higher rate, mostly in association with crossing over. - Eleven of the 14 group II sc:m mutants are in a region of Sc that is not present adjacent to the P allele promoter but is located at a proximal ectopic site on the P chromosome 10. The other 3 group II mutants are located near the Sc promoter.
- The conversion event between most of these sc:m and P results in two different Sc+ products, produced by deleting either one or two polymorphic sites from the sc:m (Ds6 alone or Ds6 and the Bnot element). Deletion of Bnot from the sc:m alleles produces altered tissue specificity of anthocyanin deposition, unique from either progenitor allele.
Structural explanations for the recombinational behavior of sc:m/P heterozygotes:
Two discrete recombinationally based regions of Sc are demarcated at a point between the m337 and m312 insertion sites, near the start of r gene translation. sc:m/P combinations involving group I alleles result in reciprocal crossover events at rates similar to intragenic recombination frequencies for other genes in maize and with double crossover frequencies consistent with expected values (![]()
26 kbp/cM (J. KERMICLE, M. ALLEMAN and C. ILLINGWORTH, unpublished data). This length is consistent with the published range of 1450 kbp/cM for maize genic regions (![]()
![]()
![]()
![]()
![]()
One explanation for the recombinational dichotomy observed in these data is that DNA structure or sequence influences crossing over in sc:m/P heterozygotes. Possible structural parameters might include the position of insertion/deletion differences between Sc and P or the distribution of single-base-pair polymorphisms. The location of P:A is unknown but is at least 15 kbp proximal to the P structural gene. Because of this distance, P:A may behave as an ectopic segment. According to this model, recombination events involving P:A preferentially produce noncrossover progeny whereas recombination events between "homologous" regions would produce primarily crossover progeny. Ectopic recombination has been studied extensively in yeast and in mammals and is shown to proceed through normal meiotic pathways (![]()
![]()
![]()
![]()
![]()
![]()
![]()
A second structural feature of the r gene that might explain the recombinational behavior of upstream vs. downstream sc:m mutants is the distribution of small polymorphic sites in Sc vs. P. Studies in yeast using engineered restriction site polymorphisms show that sequence divergence decreases the recombination efficiency and, in many cases, skews the recovery of products toward gene conversion events (![]()
![]()
![]()
![]()
![]()
Neither of these models for the recombinational dichotomy between group I and group II mutants is consistent with our data. If the position of P:A were the basis for the nearly exclusive production of gene convertants from group II mutants, these structural parameters are not predicted to affect recombination that involved inserts located within or near the transcribed region of Sc. Three mutants (m323, m337, and m338) located near the Sc promoter produce primarily convertant progeny. It is, therefore, difficult to explain a recombinational dichotomy using the distribution of insertion/deletion differences between Sc and P. Similarly, single-base heterologies and insertion-deletion differences are scattered through Sc and P with no apparent positional dichotomy separating group II and group I alleles.
Transposition of Ds6 or Bnot as an explanation for production of Scp derivatives:
An alternative explanation for the production of Scp alleles from 5'-located sc:m is that either Ds6 or Bnot excision occurs by transposition. Transposition of Ds6 in the sc:m/P heterozygotes is highly unlikely in the absence of autonomous element Ac. sc:m alleles are completely stable as homozygotes in the absence of the autonomous transposable element Ac, as described for Ds insertion mutants in other maize genes (![]()
![]()
![]()
![]()
Bnot is a novel maize transposable element of the non-LTR class of retroelements but its excision by transposition does not contribute to our recombination data. Non-LTR retroelements transpose extremely rarely (![]()
Production of Scp derivatives by heteroduplex repair during gene conversion at r:
A second aspect of these results bears on the types of products obtained via recombination involving different sc:m alleles. Heteroallelic combinations of sc:m and P presumably produce Sc+ derivatives via the formation and repair of recombinational intermediates (heteroduplex) involving the two alleles. The proposed heteroduplex tract would include sequences from sc:m and either P or P:A depending on the location of the sc:m insert. sc:m mutants located within Sc:A and producing both Scp(+) and Scp(e) derivatives are informative. These sc:m (m305, m311, m316, m328, and m330) are able to generate Scp(+) or Scp(e) alleles. The two sites are located from 108 to 159 bp apart dependent on the sc:m allele used (Fig 2). Our data do not require discontinuous conversion tracts, only the formation of two types of recombinational intermediates or differential repair of polymorphic sites. It is possible that there is either incomplete repair of the heteroduplex or initiation of DSB in different positions. The reciprocal event, transfer of Ds6 and Bnot to P:A, or loss of Bnot alone, could not be identified in our screen.
Generation of gene regulatory differences by transposable element insertion, genetic recombination, and chromosomal rearrangement:
These data support the evolution of maize genes by transposable element insertion, rearrangement, deletion, and genetic recombination. Most of the first 3.5 kbp 5' of the start of transcription of Sc and P are nonhomologous, consistent with the structure of alleles of the maize b (booster-1) gene. Two well-characterized alleles, B-Peru (strong seed pigmentation) and B-I (strong leaf blade pigmentation), although homologous in coding region sequence, are highly divergent in the 5' flanking sequences (![]()
![]()
A putative P-like progenitor would have undergone rearrangement to bring the P:A region into contact with the r gene, deletion of the YL1 region, and insertion of the Bnot transposable element during maize evolution. Because a P phenotype appears in most teosinte lines tested thus far (![]()
![]()
In addition, the flanking region of P contains several known repetitive elements, including ones with homology to the maize retroviral element Ji-6 (![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. Timothy Robbins for the
R4.7 clone. We also thank Beverly Oashgar, David Heller, and Darla West for technical assistance. United States Department of Agriculture grant 93-37301-8878 (M.A.), National Science Foundation grant 9603747 (M.A.), and Department of Energy grant DE-FG02-86ER-13539 (J.L.K.) supported this work.
Manuscript received February 22, 2001; Accepted for publication August 19, 2001.
| LITERATURE CITED |
|---|
ALLEMAN, M. and J. DOCTOR, 2000 Genomic imprinting in plants: observations and evolutionary implications. Plant Mol. Biol. 43:147-161[Medline].
ALLEMAN, M. and J. L. KERMICLE, 1993 Somatic variegation and germinal mutability reflect the position of the transposable element Dissociation within the maize R gene. Genetics 135:189-203[Abstract].
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHÄFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
BENNETZEN, J. L., P. SANMIGUEL, M. CHEN, A. TIKHONOV, and M. FRANCKI et al., 1998 Grass genomes. Proc. Natl. Acad. Sci. USA 95:1975-1978
BORTS, R. H. and J. E. HABER, 1987 Meiotic recombination in yeast: alteration by multiple heterozygosities. Science 237:1459-1465
BORTS, R. H. and J. E. HABER, 1989 Length and distribution of meiotic gene conversion tracts and crossovers in Saccharomyces cerevisiae. Genetics 123:69-80
BRINK, R. A., 1958 Paramutation at the R locus in maize. Cold Spring Harbor Symp. Quant. Biol. 23:379-391
BROWN, J. and V. SUNDARASAN, 1991 A recombinational hotspot in the maize a1 intragenic region. Theor. Appl. Genet. 81:185-188.
BURR, F. A., B. BURR, B. E. SCHEFFLER, M. BLEWITT, and U. WIENAND et al., 1996 The maize repressor-like gene intensifier1 shares homology with the r1/b1 multigene family of transcription factors and exhibits missplicing. Plant Cell 8:1249-1259[Abstract].
CHANDLER, V. L., J. P. RADICELLA, T. P. ROBBINS, J. CHEN, and D. TURKS, 1989 Two regulatory genes of the maize anthocyanin pathway are homologous: isolation of B utilizing R genomic sequences. Plant Cell 1:1175-1183
CHANDLER, V. L., W. E. EGGLESTON, and J. E. DORWEILER, 2000 Paramutation in maize. Plant Mol. Biol. 43:121-145[Medline].
CHEN, J., I. M. GREENBLATT, and S. L. DELLAPORTA, 1992 Molecular analysis of Ac transposition and DNA replication. Genetics 130:665-676[Abstract].
CHEN, W. and S. JINKS-ROBERTSON, 1999 The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151:1299-1313
CIVARDI, L., Y. XIA, K. J. EDWARDS, P. S. SCHNABLE, and B. J. NIKOLAU, 1994 The relationship between genetic and physical distances in the cloned a1-sh2 interval of the Zea mays L. genome. Proc. Natl. Acad. Sci. USA 91:8268-8272
COOPER, D. M., K. J. SCHIMENTI, and J. C. SCHIMENTI, 1998 Factors affecting ectopic gene conversion in mice. Mamm. Genome 9:355-360[Medline].
DELLAPORTA, S. L., I. M. GREENBLATT, J. L. KERMICLE, J. B. HICKS and S. R. WESSLER, 1988 Molecular cloning of the maize R-Nj allele by transposon tagging with Ac, pp. 263282 in Chromosome Structure and Function, 18th Stadler Genetics Symposium, edited by J. P. GUSTAFSON and R. APPELS. Plenum, New York.
DOONER, H. K. and A. BELACHEW, 1989 Transposition pattern of the maize element Ac from the bz-m2(Ac) allele. Genetics 122:447-457
DOONER, H. K. and J. L. KERMICLE, 1971 Structure of the R-r tandem duplication in maize. Genetics 67:427-435
DOONER, H. K. and J. L. KERMICLE, 1986 The transposable element Ds affects the pattern of intragenic recombination at the bz and R loci in maize. Genetics 113:135-143
DOONER, H. K. and I. M. MARTINEZ-FEREZ, 1997 Recombination occurs uniformly within the bronze gene, a meiotic recombination hotspot in the maize genome. Plant Cell 9:1633-1646[Abstract].
DOONER, H. K. and E. J. RALSTON, 1990 Effect of the Mu1 insertion on intragenic recombination at the bz locus in maize. Maydica 35:333-337.
DOONER, H. K., T. P. ROBBINS, and R. A. JORGENSEN, 1991 Genetic and developmental control of anthocyanin biosynthesis. Annu. Rev. Genet. 25:173-199[Medline].
EGGLESTON, W. B., M. ALLEMAN, and J. L. KERMICLE, 1995 Molecular organization and bases for germinal instability in R-stippled maize. Genetics 141:347-360[Abstract].
FEDOROFF, N. V., 1989 Maize transposable elements, pp. 375411 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington DC.
GOFF, S. A., K. C. CONE, and V. L. CHANDLER, 1992 Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct functional interaction between two classes of regulatory proteins. Genes Dev. 6:864-875
HANSON, M. A., B. S. GAUT, A. O. STEC, S. I. FUERSTENBERG, and M. M. GOODMAN et al., 1996 Evolution of anthocyanin biosynthesis in maize kernels: the role of regulatory and enzymatic loci. Genetics 143:1395-1407[Abstract].
JACKSON, J. A. and G. R. FINK, 1981 Gene conversion between duplicated genetic elements in yeast. Nature 292:306-311[Medline].
KERMICLE, J. L., 1970a Dependence of the R-mottled aleurone phenotype in maize on mode of sexual transmission. Genetics 66:69-85
KERMICLE, J. L., 1970b Somatic and meiotic instability of R-stippled, an aleurone spotting factor in maize. Genetics 64:247-258
KERMICLE, J. L., 1980 Probing the component structure of a maize gene with transposable elements. Science 208:1457-1459
KERMICLE, J. L., 1985 Alternative tests of allelism, pp. 491507 in Plant Genetics, edited by M. FREELING. Alan R. Liss, New York.
KERMICLE, J. L., 1988 Recombinant mutable alleles of the maize R gene, pp. 8189 in Plant Transposable Elements, edited by O. E. NELSON. Plenum, New York.
KERMICLE, J. L., 1996 Epigenetic silencing and activation of a maize r gene, pp. 267287 in Epigenetic Mechanisms of Gene Regulation, edited by V. E. A. RUZZO, R. A. MARTIENSSEN and A. D. RIGGS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
KERMICLE, J. L., M. ALLEMAN, and S. L. DELLAPORTA, 1989 Sequential mutagenesis of a maize gene using the transposable element Dissociation. Genome 31:712-716.
KERMICLE, J. L., M. ALLEMAN, and W. B. EGGLESTON, 1995 Paramutation of the maize R gene depends on R gene copy number and arrangement. Genetics 141:361-372[Abstract].
KUPIEC, M. and T. D. PETES, 1988 Allelic and ectopic recombination between Ty elements in yeast. Genetics 119:549-559
LICHTEN, M., R. H. BORTS, and J. E. HABER, 1987 Meiotic gene conversion and crossing over between dispersed homologous sequences occurs frequently in Saccharomyces cerevisiae. Genetics 115:233-246
LIN, X., S. KAUL, S. ROUNSLEY, T. P. SHEA, and M. I. BENITO et al., 1999 Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402:761-768[Medline].
LIU, Y., M. ALLEMAN, and S. R. WESSLER, 1996 A Ds insertion alters the nuclear localization of the maize transcriptional activator R. Proc. Natl. Acad. Sci. USA 93:7816-7820
LIU, Y., L. WANG, J. L. KERMICLE, and S. R. WESSLER, 1998 Molecular consequences of Ds insertion into and excision from the helix-loop-helix domain of the maize R gene. Genetics 150:1639-1648
LUDWIG, S. R. and S. R. WESSLER, 1990 Maize R gene family: tissue-specific helix-loop-helix proteins. Cell 62:849-851[Medline].
LUDWIG, S. R., L. F. HABERA, S. L. DELLAPORTA, and S. R. WESSLER, 1989 Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc. Natl. Acad. Sci. USA 86:7092-7096
LUDWIG, S. R., B. BOWEN, L. BEACH, and S. R. WESSLER, 1990 A regulatory gene as a novel visible marker for maize transformation. Science 247:449-450
MCCLINTOCK, B., 1951 Chromosome organization and genic expression. Cold Spring Harbor Symp. Quant. Biol. 16:13-47[Medline].
MCWHIRTER, K. S. and R. A. BRINK, 1962 Continuous variation in level of paramutation at the R locus in maize. Genetics 47:1053-1074
MODRICH, P. and R. LAHUE, 1996 Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133[Medline].
MORENO, M. A., J. CHEN, I. M. GREENBLATT, and S. L. DELLAPORTA, 1992 Reconstitutional mutagenesis of the maize P gene by short-range Ac transpositions. Genetics 131:939-956[Abstract].
NAG, D. K. and T. D. PETES, 1990 Meiotic recombination between dispersed repeated genes is associated with heteroduplex formation. Mol. Cell. Biol. 10:4420-4423
OCHMAN, H., A. S. GERBER, and D. L. HARTL, 1988 Genetic application of an inverse polymerase chain reaction. Genetics 120:621-623
OKAGAKI, R. J. and C. F. WEIL, 1997 Analysis of recombination sites within the maize waxy-1 locus. Genetics 147:815-821[Abstract].
PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407521 in The Molecular and Cellular Biology of the Yeast Saccharomyces, Vol. 1. Genome Dynamics, Protein Synthesis, and Energetics, edited by J. R. BROACH, E. W. JONES and J. R. PRINGLE. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
RADICELLA, J. P., D. TURKS, and V. L. CHANDLER, 1991 Cloning and nucleotide sequence of a cDNA encoding B-Peru, a regulatory protein of the anthocyanin pathway in maize. Plant Mol. Biol. 17:127-130[Medline].
RADICELLA, J. P., D. BROWN, L. A. TOLAR, and V. L. CHANDLER, 1992 Allelic diversity of the maize B regulatory gene: different leader and promoter sequences of two B alleles determine distinct tissue-specificities of anthocyanin production. Genes Dev. 6:2152-2164
ROBBINS, T. P., E. L. WALKER, J. L. KERMICLE, M. ALLEMAN, and S. L. DELLAPORTA, 1991 Meiotic instability of the R-r complex arising from displaced intragenic exchange and intrachromosomal rearrangement. Genetics 129:271-283[Abstract].
SANMIGUEL, P., A. TIKHONOV, Y.-K. JIN, N. MOTCHOULSKAIA, and D. ZAKHAROV et al., 1996 Nested retrotransposons in the intergenic regions of the maize genome. Science 274:765-768
SCHMIDT, T., 1999 LINEs, SINEs, and repetitive DNA: non-LTR retrotransposons in plant genomes. Plant Mol. Biol. 40:903-910[Medline].
SCHNABLE, P. S., A.-P. HSIA, and B. J. NIKOLAU, 1998 Genetic recombination in plants. Curr. Opin. Plant Biol. 1:123-129[Medline].
SCOTT, L., D. LAFOE, and C. F. WEIL, 1996 Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246[Abstract].
STEELE, D. F., M. E. MORRIS, and S. JINKS-ROBERTSON, 1991 Allelic and ectopic interactions in recombination-defective yeast strains. Genetics 127:53-60[Abstract].
STYLES, E. D., O. CESKA, and K. T. SEAH, 1973 Developmental differences in action of R and B alleles in maize. Can. J. Genet. Cytol. 15:59-72.
SYMINGTON, L. S. and T. D. PETES, 1988 Expansions and contractions of the genetic map relative to the physical map of yeast chromosome III. Mol. Cell. Biol. 8:595-604
TIKHONOV, A. P., P. J. SANMIGUEL, Y. NAKAJIMA, N. M. GORENSTEIN, and J. L. BENNETZEN et al., 1999 Colinearity and its exceptions in orthologous adh regions of maize and sorghum. Proc. Natl. Acad. Sci. USA 96:7409-7414
WALKER, E. L., T. P. ROBBINS, T. E. BUREAU, J. L. KERMICLE, and S. L. DELLAPORTA, 1995 Transposon-mediated chromosomal rearrangements and gene duplications in the formation of the maize R-r complex. EMBO J. 14:2350-2363[Medline].
WANG, L. and S. R. WESSLER, 1998 Inefficient reinitiation is responsible for upstream open reading frame-mediated translational repression of the maize R gene. Plant Cell 10:1733-1746
WEYERS, W. H., 1961 Expression and stability of the marbled allele in maize. Genetics 46:1061-1067
WHITE, S. E., L. F. HABERA, and S. R. WESSLER, 1994 Retrotransposons in the flanking regions of normal plant genes: a role for Copia-like elements in the evolution of gene structure and expression. Proc. Natl. Acad. Sci. USA 91:11792-11796
XU, X., A. P. HSIA, L. ZHANG, B. J. NIKOLAU, and P. S. SCHNABLE, 1995 Meiotic recombination break points resolve at high rates at the 5' end of a maize coding sequence. Plant Cell 12:2151-2161.
This article has been cited by other articles:
![]() |
F. Zhang and T. Peterson Gene Conversion Between Direct Noncoding Repeats Promotes Genetic and Phenotypic Diversity at a Regulatory Locus of Zea mays (L.) Genetics, October 1, 2006; 174(2): 753 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang and T. Peterson Comparisons of Maize pericarp color1 Alleles Reveal Paralogous Gene Recombination and an Organ-Specific Enhancer Region PLANT CELL, March 1, 2005; 17(3): 903 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Yandeau-Nelson, Q. Zhou, H. Yao, X. Xu, B. J. Nikolau, and P. S. Schnable MuDR Transposase Increases the Frequency of Meiotic Crossovers in the Vicinity of a Mu Insertion in the Maize a1 Gene Genetics, February 1, 2005; 169(2): 917 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Wray, M. W. Hahn, E. Abouheif, J. P. Balhoff, M. Pizer, M. V. Rockman, and L. A. Romano The Evolution of Transcriptional Regulation in Eukaryotes Mol. Biol. Evol., September 1, 2003; 20(9): 1377 - 1419. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Li, Y.
- Articles by Alleman, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Li, Y.
- Articles by Alleman, M.














