- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Korey, C. A.
- Articles by Van Vactor, D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Korey, C. A.
- Articles by Van Vactor, D.
small bristles Is Required for the Morphogenesis of Multiple Tissues During Drosophila Development
Christopher A. Koreya, Gavin Wilkieb, Ilan Davisb, and David Van Vactoraa Department of Cell Biology, The Program in Neuroscience and The Dana Farber Cancer Institute/Harvard Cancer Center, Harvard Medical School, Boston, Massachusetts 02115
b Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, Edinburgh EH9 3JR, Scotland
Corresponding author: David Van Vactor, Department of Cell Biology, Harvard Medical School, 240 Longwood Ave.-LHRRB Rm. 401A, Boston, MA 02115., davie{at}hms.harvard.edu (E-mail)
Communicating editor: A. J. LOPEZ
| ABSTRACT |
|---|
We found that mutations in small bristles (sbr) affect several tissues during the development of the fruit fly. In sbr embryos, neurons have defects in pathfinding and the body wall muscles have defective morphology. As adults, sbr flies have smaller and thinner bristles with a reduced diameter, suggesting a defective cytoskeleton within. The phenotypes we observe are consistent with defects in cell morphogenesis. We identified DmNXF1, the Drosophila homolog of a mRNA export protein that has been characterized in human (NXF1/TAP) and yeast (Mex67p) as the protein encoded by the small bristles locus. Given that a global decrease in mRNA export in these mutants is likely, the phenotypes we observe suggest that certain tissues are acutely sensitive to lower levels of cytoplasmic mRNA and the resultant decrease in protein synthesis during key stages of cellular morphogenesis.
THE development of a multicellular organism requires that cells undergo a complex and sometimes rapid morphogenesis to form the distinct tissues that are required for normal function. To accomplish this, genes are expressed and translated into the proteins that orchestrate the formation of each tissue type. The coordination of this process entails a complex communication between the extracellular milieu, the cytoplasm, and the nucleus. This results in the production of the signaling and structural proteins required for the formation and function of the resultant tissues and organs. While this process may be gradual in different cell types, certain cells undergo very rapid and complex morphogenesis such as the gametes, flight muscles, and sensory bristles of adult Drosophila. It has been postulated that such cells require higher levels of protein synthesis to accommodate their rapid rate of development (![]()
One important step toward understanding RNA export in higher eukaryotes was the discovery of how retroviruses, particularly Mason-Pfizer monkey virus (MPMV), get their spliced and unspliced viral RNA into the cytoplasm of infected cells. In a normal cellular context, unspliced preRNAs are retained within the nucleus. Retroviruses require that their full-length unspliced RNA be exported from the nucleus to produce viral proteins and to be packaged into new viral particles. To accomplish this the MMPV viral RNA contains a constitutive transport element (CTE) that mediates efficient export of unspliced RNA out of the cell nucleus (![]()
![]()
![]()
![]()
![]()
![]()
Previous to the identification of human TAP (TAP/NXF1), work in Saccharomyces cerevisiae identified the yeast homolog, mex67, in a screen for genes required for the export of poly(A)+ RNA (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The C termini of TAP/NXF1 and Mex67p have been shown to bind to nucleoporins through a domain similar to a ubiquitin-associated (UBA) domain (![]()
![]()
![]()
![]()
![]()
![]()
The recent identification of the Caenorhabditis elegans homolog, CeNXF1, showed that this protein is essential for viability of embryos and adults (![]()
| MATERIALS AND METHODS |
|---|
Histology:
Embryos were processed as described (![]()
![]()
![]()
![]()
![]()
Scanning electron microscopy:
Newly eclosed female adults of the specified genotypes were collected and aged for several days in a yeast-free food vial. These flies were then taken through a series of ethanol dehydration steps. They were first placed in 25% ethanol and after a 12-hr incubation time they were moved to 50% ethanol. This process continued, moving through the following dilutions: 50, 75, 95, and 2x 100% ethanol. They were left in 100% ethanol and taken to the Northeastern Electron Microscopy facility to be critical point dried and sputter coated for scanning electron microscopy (SEM).
Germline clone:
The y w sbrmgln chromosome was recombined onto a FRT101 chromosome to incorporate the FRT sites to be used for the germline clone. Females of the genotype y w sbrmgln FRT101/FM7cß were then mated to males of the genotype ovoD1 FRT101/Y; hsFLP. When wandering third instar larvae were observed the vials were heat-shocked at 37° for 2 hr and then again for 2 hr, 24 hr later. A subset of these vials was not heat-shocked and served as the non-heat-shock control. As a wild-type germline clone control we crossed the original y w FRT101 females to males of the genotype ovoD1 FRT101/Y; hsFLP and followed the same procedure as outlined for the sbrmgln chromosome. When the adults from the heat-shocked and non-heat-shocked vials eclosed, females of the genotype y w sbrmgln FRT101/ ovoD1 FRT101 (experimental) or y w FRT101/ ovoD1 FRT101 (wild-type control) were collected. Four crosses were set up to determine the result of the germline clone induction: y w sbrmgln FRT101/ ovoD1 FRT101 x FM7cß/Y (one for heat shock and one for non-heat-shock control) and y w FRT101/ ovoD1 FRT101 x FM7cß/Y (one for wild-type heat-shock control and one for wild-type non-heat-shock control).
Fly stock maintenance:
All fly strains were raised at 25°.
Genetic mapping:
Three multiply marked X chromosomes were used to genetically map the sbrmgln lesion in relation to the chosen visual markers. The genotypes of the chromosomes were as follows: sc ec cv ct g, y m wy sd os, and y cv v f car (abbreviations according to ![]()
The full deficiency kit for the X chromosome was obtained from the Bloomington Drosophila Stock Center. In addition, all chromosomal duplications that contained duplicated segments of the X chromosome were also obtained. These stocks were then independently crossed to the sbrmgln line to obtain a duplication that rescued the lethality. Once we had identified such a duplication, Dp(1;Y)v+y+, we used rescued males (yw mgln/Y- Dp(1;Y)v+y+) to map sbrmgln using the deficiency collection.
Deficiency breakpoint mapping:
Df(1)HC133:
Southern blots were done on genomic DNA preparations of three different genotypes: wild-type genomic DNA to view the normal digestion patterns; Df(1)HC133 to look for signs of a chromosomal breakpoint; and Df(1)v-L15, a deficiency that removes the entire region as a control for 50% DNA content. The PCR-amplified probe that identified the breakpoint, 929IJ (forward primer 5' GAGGGGCAAACTTCATGTTAT 3'; reverse primer 5' GCTTCAACAGCAGAAAAGAAC 3'), covered the 5'-most section of the dIMP. Analysis of the hybridization pattern showed a band shift indicative of a chromosomal lesion with four different restriction enzymes: HindIII, EcoRI, BamHI, and BglII. The bandshifts predicted that the breakpoint resided in the
1.3 kb between a BamHI site and HindIII site in the 5' untranslated region (UTR) of dIMP. Further Southern analysis with probes within the predicted deficiency region showed a 50% reduction in signal in flies heterozygous for the deficiency.
Df(1)vL4:
We probed genomic blots with a PCR-amplified DNA fragment, 912QP (forward primer 5' CGGATTGCACAGGAGATTCTGC 3'; reverse primer 5' GGAAAACTCTGTTCAGCTCTG 3'), which contained the genomic DNA
5 kb from the 3' end of sbr. Analysis of this hybridization showed a band shift indicative of a chromosomal lesion with five different enzymes, HindIII, EcoRI, BamHI, BglII, and SalI. The band shifts predict that the breakpoint resides within a 2.5-kb EcoRI fragment. This implies that Df(1)v-L4 removes the sbr coding region. We confirmed this prediction by probing Southern blots with a genomic fragment that contained sbr coding sequence to show a 50% reduction in Df(1)v-L4/Fm7cß signal as compared to wild type.
Df(1)vL3: Genomic Southern blots were probed with a DNA fragment from the K3.18.7 phage that contained the genomic DNA that included the 5' end of sbr. Analysis of the hybridization pattern showed a band shift indicative of a chromosomal lesion with two different enzymes, SalI and HindIII. The band shifts predict that the breakpoint resides within a 7.5-kb SalI fragment. Further Southern analysis confirmed that the break was within the 4.7-kb HindIII-SalI fragment that covers the 5' end of sbr.
Restriction fragment length mapping:
Restriction fragment length polymorphism (RFLP) mapping was performed as described by ![]()
![]()
![]()
Sequencing the sbr alleles:
Examination of sbr1, sbrts148, and sbr10 for possible sequence alterations was accomplished by sequencing the sbr cDNA obtained from homozygous adults of each genotype. For sbrts148 and sbr10, adults were obtained by raising the cultures at the permissive temperature of 18°. In addition to the sequence changes reported in RESULTS, there are also sequence polymorphisms that do not alter the protein sequence: a C to T change at nucleotide 1465, C to G at nucleotide 1479, and A to G at nucleotide 1503. To sequence the sbrmgln lesion, we were forced to obtain the sbr cDNA from adult females heterozygous for sbrmgln and another mutation, sbrts148. This was done because sbrmgln's lethality prevented us from obtaining homozygous adults, so we had to obtain the sbrmgln cDNA from a mixed population of chromosomes. sbrts148 was used as the second chromosome because the sequence lesion from this mutant had been identified first and it permitted the unequivocal identification of sbr cDNAs transcribed from the sbrts148 chromosome. Any cDNA that did not carry the sbrts148 mutation was considered to be from the sbrmgln chromosome. We purified mRNA from 30 adult females of the genotype sbrmgln/sbrts148, using a mRNA micropurification kit (Amersham, Arlington Heights, IL). Total adult cDNA was made from this mRNA preparation, using a first-strand synthesis kit (Amersham). PCR primers were designed within the 5' and 3' UTR (CBS11-Xho, 5' CCTCGAGGAAGTTGGCAGCAGTTTGTG 3'; CBS11-R1, 5' GGAATTCCATTATGTGGATGTGGCACGC 3') of sbr and used to amplify the full-length cDNA. The resulting PCR products were cloned into the pCRII vector [Invitrogen (San Diego) TOPO TA kit] and sequenced with a primer (CBS11-2970, 5' CGATGGGACGAGGATGATGAC 3') that read through the T to A mutation at nucleotide 461 in the sbrts148 cDNA. Two cDNAs from independent PCR reactions were shown not to contain the sbrts148 mutation. These were fully sequenced to identify the lesion in sbr from the sbrmgln chromosome.
| RESULTS |
|---|
We identified a new allele of sbr in a screen for X chromosome mutations that affect the pathfinding of embryonic motor neurons (![]()
Axonal defects in small bristles:
The neuromuscular system of the Drosophila embryo has been well characterized at the cell biological level (![]()
![]()
|
In sbr mutant embryos, we observe guidance defects in all motor axon pathways. With the exception of a viable hypomorph, sbr1, lethal sbr alleles can be organized in an alleleic series of increasing severity of embryonic phenotypes. In general, sbr mutant axons extend but fail to follow the correct pathway to their targets (Fig 1). The most penetrant axonal defects are seen in the ISNb motor pathway, ranging from 54% of segments in weaker alleles to 80% of segments in the strongest alleles (Fig 1E). ISNd is also routinely absent from its target muscles, presumably due to failed defasciculation from the ISN. In addition, we see a low penetrance crossing of the segment boundary by ISN in the dorsal regions of the embryo and variable defects in SN motor axon bundles. The alleles sbrmgln and sbr12 display severity equivalent to a complete deletion of the gene, suggesting that they are functional nulls; although no antibody is available to confirm this prediction, sequence of sbrmgln reveals a truncation of the predicted protein (see below). Careful examination of muscle cells in these strong alleles also reveals defects in muscle morphogenesis (see below). Although the peripheral motor axon pathfinding problems in sbr mutants could be secondary to these muscle defects, we also observe axonal defects within the CNS neuropil where muscle cell morphogeneisis is unlikely to affect axonogenesis.
The ventral nerve cords of sbr mutants show highly penetrant defects in the development of the longitudinal axon scaffold as revealed by mAb 1D4 (Fig 1C and Fig D). This antibody highlights three parallel Fasciclin II-positive fascicles on either side of the ventral midline. In sbr embryos, the outermost fascicle contains frequent gaps or is thinner than normal, a phenotype common to many mutations in axon guidance genes (e.g. integrin subunits, ![]()
![]()
Since axonal phenotypes can represent secondary consequences of defective cell fate determination, we also examined the pattern of embryonic CNS cell fates. We stained sbr embryos with several nuclear markers including antibodies to Engrailed (data not shown) and Even-skipped proteins (Fig 2). Our analysis demonstrates that the number and position of cells expressing each of these markers appears normal in sbrmgln embryos, suggesting that the axon guidance phenotypes we observe are a result of later defects in differentiation and morphogenesis.
|
Embryonic muscle defects:
After examining the defects in motor axon and CNS pathfinding, we noted that there also appeared to be defects in the morphology of the body wall muscles in the strongest alleles. The embryonic musculature begins to develop as the germ band shortens around stage 12 of embryonic development (![]()
![]()
In sbr embryos, we find that the muscles appear to have initially differentiated correctly, forming the correct number of muscles in the right positions in each segment. However, at stage 16, these muscles have an aberrant morphology including long drawn out fibers (Fig 3) and in some cases muscles appear to have pulled out of their epidermal attachment site (Fig 3D). These phenotypes are consistent with problems associated with late muscle morphogenesis suggestive of defects in cytoskeletal and other structural components that form the fully functional contractile apparatus. Consistent with this hypothesis, staining with an antibody that recognizes the myosin heavy chain reveals a disrupted pattern of myosin localization and reduced levels of the antigen (Fig 3). It is possible that, given the described defects of the musculature, problems in the target field could explain the motor axon pathfinding errors, but not those within the CNS.
|
Germline clones of sbr are germline lethal:
While sbr zygotic mutations affect the development of both the motor neurons and the body wall muscles, this does not address whether sbr has an earlier role in embryonic development. It is likely that maternal expression of sbr allows embryos to reach late stages of embryonic development (see below). To address this question, we made germline clones with the sbrmgln allele using the FLP/FRT recombination system and the dominant female sterile mutation ovoD1.
Germline clones with the sbrmgln chromosome produce sterile females (n = 180 females) that fail to lay eggs. The wild-type chromosome control was completely fertile (n = 150 females), laying eggs that hatched into adults. We dissected the ovaries from heat-shock-treated y w sbrmgln FRT101/ ovoD1 FRT101 females (mutant, n = 67) and y w FRT101/ ovoD1 FRT101 females (control) and found that the sbrmgln clones had no discernible egg chambers present, suggesting that there is probably an earlier defect in ovary development. This result prevents us from addressing the early embryonic role of sbr.
sbr mutations affect macrocheate development:
The small bristles mutation was named for its affect on the large sensory bristles present on the thorax and head of the Drosophila adult (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The adult viable sbr1 mutation was first isolated on the basis of its bristle phenotype (![]()
|
Genetic mapping of the small bristles locus:
We began the initial mapping with the strong EMS-induced allele sbrmgln that we obtained in a screen for axon guidance mutants. Recombination mapping with a y m wy sd os chromosome placed sbrmgln approximately one chromosomal division from miniature (m, 10E12) while mapping with a y cv v f car chromosome suggested that the lesion was extremely close to vermilion (v, 10A12). On the basis of these initial results, we performed a high-resolution recombination mapping analysis between the sbrmgln lesion and vermilion. This analysis produced a recombination distance of 0.28 cM, which translated into a physical distance of
94.2 kb between sbrmgln and v (based on 0.01 cM = 3.3 kb in this region; ![]()
![]()
![]()
In parallel to the recombination mapping and the previous work on this locus, duplication and deficiency chromosomes were also used to identify the region of the X chromosome affected by the sbrmgln lesion. We identified a duplication, Dp(1;y)v+y+ (![]()
![]()
![]()
Molecular mapping of small bristles:
To identify the sbr open reading frame, we took two parallel approaches to correlate the genetic and physical maps: recombination mapping with RFLP markers and deficiency breakpoint mapping. The high-resolution recombination mapping between the sbrmgln allele and vermilion (v) produced 23 lines with independent recombination events between the sbrmgln lesion and v (representing a total of 72 recombinants out of 25,276 F2 progeny). Using genomic phage clones from the Zhimulev walk, we identified three RFLP markers in the 100-kb interval between v and sbrmgln (see MATERIALS AND METHODS). The recombinant lines were then screened for the enzyme cutting pattern characteristic of either sbrmgln or v. The frequency at each site was plotted vs. the physical distance on the chromosome to predict the intercept at 0% recombination and therefore the location of the sbrmgln lesion (Fig 5A). An approximate degree of accuracy was estimated by dividing the approximate sbrmgln to v physical distance of 100 kb by the 23 independent recombinant lines, giving a resolution of nearly 5 kb on either side of the intercept.
|
The intercept bisected the 3' end of an open reading frame encoding the DmNXF1 protein, but it was also close to an open reading frame encoding the Drosophila homolog of the RNA-binding protein Vera (dIMP; Fig 5B). To obtain independent evidence that sbr encodes the DmNXF1 protein, we mapped the deficiency breakpoints that most closely defined the sbr locus. The complementing Df(1)HC133 was found to break in the 5' UTR of dIMP and remove the complete open reading frame (Fig 5B). Consistent with the mapping, this deficiency also eliminates the embryonic expression of the dIMP gene (data not shown). We then found that the proximal breakpoint of the complementing deletion Df(1)vL3 lies within a 5-kb fragment that includes the 5' end of DmNXF1 (Fig 5B). Since identified mutations in DmNXF1 [sbrts148, sbr10 (G. WILKIE and I. DAVIS, personal communication), and sbrmgln (this article)] complement this deficiency, Df(1)vL3 does not remove sbr. Finally, we found that Df(1)v-L4 breaks just outside of the DmNXF1 3' end and removes the entire DmNXF1 coding region (Fig 5B). Thus, the three techniques we used, recombination mapping, deficiency mapping, and RFLP mapping, all strongly and independently point to DmNXF1 as the protein encoded by small bristles.
In light of this we identified a cDNA encoding the full-length sbr open reading frame from a mixed-stage poly(A)+ selected embryonic cDNA library. After sequencing the full-length cDNA and comparing it to the Berkeley Drosophila Genome Project genomic sequence, we found that the sbr genomic region has 10 exons and encodes a 672-amino-acid protein, DmNXF1 (accession numbers: protein, CAB64382; nucleotide, AJ251947), which retains the conserved domain structure when aligned with the human and yeast homologs (Fig 6A; ![]()
![]()
|
Sequencing small bristles lesions:
Sequencing the hypomorphic sbr1 allele revealed no sequence changes within the DmNXF1 open reading frame, suggesting that the defects we see may be due to a hypomorphic mutation within a promoter or enhancer for this gene. This is consistent with the weak nature of the allele and the limitation of the phenotype to sensory bristles. sbrts148 has a T to A mutation at nucleotide 461, causing a valine to glutamic acid change at residue 154 within the RNA-binding domain of the protein (see solid box in Fig 6A). sbr10 has a C to T mutation at nucleotide 416, causing a proline to leucine change at residue 139, also within the RNA-binding domain of the protein. There are also two mutations in sbr10 that produce conservative changes: threonine to serine at position 493 (A to T at nucleotide 1477) and methionine to isoleucine at residue 499 (G to T at nucleotide 1497; see solid circles in Fig 6A; also see MATERIALS AND METHODS).
The initial amplification of the sbrmgln cDNA showed an upward band shift of the cDNA in relation to the wild-type sequence, indicating that the mutant form was larger. Sequencing of the sbrmgln cDNA reveals a 67-bp insertion within the coding region of DmNXF1. When further analyzed, the inserted sequence was identified as the intron between exons 7 and 8. The failure to splice out the intron is due to a point mutation that changes the conserved 5' splice site of intron 7 from GT to AT (Fig 6B). The retention of the intron produces a premature stop codon that terminates the protein at amino acid 417 (see asterisk in Fig 6A) and removes the conserved C terminus of the protein, including part of the NTF2-like domain and the UBA-like domain (Fig 6). Sequencing of the genetic background that was used to produce this mutant does not show this sequence alteration. This mutation does not prevent transcription of the gene since we were able to obtain full-length mutant cDNA. Thus, the mutation affects sbr post-transcriptionally by producing an unstable mRNA, a truncated form of the protein that is unstable and degraded, or a form of the protein that is unable to perform its normal cellular functions.
| DISCUSSION |
|---|
The analysis of small bristles mutants and our subsequent cloning of the locus provides a unique opportunity to analyze the in vivo role of mRNA export during Drosophila development. We found that mutations in small bristles affect the morphogeneis of embryonic neurons, embryonic muscle, and adult sensory bristles. We have shown that sbr encodes the DmNXF1 protein, the Drosophila homolog of a mRNA export protein that has been characterized in human (TAP/NXF1) and yeast (Mex67p). In these systems, this family of proteins has been shown to play a major role in the export of mRNA from the nucleus to the cytoplasm. We have shown that DmNXF1 has similar domain structure to its homologs (Fig 6A), and sbr embryos display defects in the export of mRNA out of the nucleus (G. WILKIE, C. A. KOREY, D. VAN VACTOR and I. DAVIS, unpublished results). Furthermore, DmNXF1 is required for mRNA export in SL2 cells (A. HEROLD and E. IZARRAULDE, personal communication). Together these studies show that function of the Drosophila homolog is consistent with its role as a major mRNA export protein in other systems.
Our analysis of developmental defects in sbr mutants suggests that the phenotypes we observe are not the result of cell fate problems, but rather are due to problems in late-stage differentiation and cell morphogenesis. The following question remains: Knowing the cellular function of sbr, how are the pathfinding of neurons, the structural integrity of muscles, and the development of the bristle related? Given that a global decrease in mRNA export in these mutants is likely, the phenotypes suggest that certain tissues are more sensitive to the lower levels of mRNA and the resultant decrease in protein synthesis. This hypothesis is consistent with work on the Minute syndrome in Drosophila. This collection of phenotypes is associated with >50 different loci throughout the genome. The Minutes are usually haploinsufficient and produce a variety of phenotypes, including delayed larval development, recessive lethality, short and thin bristles, and reduced fertility and viability (reviewed by ![]()
![]()
It has been proposed that the specific cell types affected represent tissues that require large amounts of protein synthesis during development (![]()
![]()
The development of the bristle is thought to require a rapid synthesis of proteins (![]()
![]()
![]()
![]()
Similar to bristle cells, muscle cells also require large amounts of protein to construct a fully functional contractile apparatus. The cytoplasm of a fully developed muscle is filled with actin, myosin, and other supporting structural proteins. To address the genetic requirements of a developing muscle, several laboratories have done dominant flightless screens (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The defects in morphology of the muscles as well as the possible decrease in relevant muscle-derived guidance factors could be the cause of the misdirected motor axons. This is seen in abrupt embryos, where ISNb pathfinding errors and a low frequency of muscle insertion site pullouts are observed. Abrupt's identity as a muscle-expressed zinc finger protein that potentially functions as a transcription factor suggests that the loss of certain muscle proteins can produce both axon and muscle defects (![]()
As with muscles, a general decrease in specific guidance molecules in the developing embryo could impair growth cone navigation. However, it also could disrupt the machinery required to drive the growth cone forward. Treating growth cones with drugs that disrupt the actin cytoskeleton disrupts the structure of the growth cone and causes navigational errors in vivo (![]()
![]()
![]()
![]()
Work on neurites in vitro has shown that actin mRNA is transported along axons in particles to the growth cone (![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Andrea Herold and Elisa Izaurralde for communicating unpublished data and commenting on our manuscript. We also thank Igor Zhimulev for genomic phage clones and fly lines, William Fowle for technical assistance with SEM, and the members of the Van Vactor and Flanagan Labs for helpful discussions at all stages of this work. This work was supported by a National Institutes of Mental Health Predoctoral NRSA (C.A.K.), National Institutes of Health grants NS40043 and NS35909, a Wellcome Trust career development fellowship (I.D.), a Lister Institute senior fellowship (I.D.), and an MRC studentship (G.S.W.). C.A.K. was a National Science Foundation predoctoral fellow and D.V.V. is a Leukemia and Lymphoma Society scholar.
Manuscript received July 12, 2001; Accepted for publication October 1, 2001.
| LITERATURE CITED |
|---|
BACHI, A., I. C. BRAUN, J. P. RODRIGUES, N. PANTÈ, and K. RIBBECK et al., 2000 The C-terminal domain of TAP interacts with the nuclear pore complex and promotes export of specific CTE-bearing RNA substrates. RNA 6:136-158[Abstract].
BASSELL, G. J., H. ZHANG, A. L. BYRD, A. M. FEMINO, and R. SINGER et al., 1998 Sorting of ß-actin mRNA and protein to neurites and growth cones in culture. J. Neurosci. 18:251-265
BATE, M., 1990 The embryonic development of larval muscles in Drosophila. Development 110:791-804
BATE, M. and K. BROADIE, 1995 Wiring by fly: the neuromuscular system of the Drosophila embryo. Neuron 15:513-525[Medline].
BATEMAN, J., H. SHU, and D. VAN VACTOR, 2000 The guanine nucleotide exchange factor trio mediates axonal development in the Drosophila embryo. Neuron 26:93-106[Medline].
BEAR, J., W. TAN, A. S. ZOLOTUKHIN, C. TABERNERO, and E. A. HUDSON et al., 1999 Identification of novel import and export signals of human TAP, the protein that binds to the CTE element of the type D retrovirus mRNAs. Mol. Cell. Biol. 19:6306-6317
BENTLEY, D. and A. TOROIAN-RAYMOND, 1986 Disoriented pathfinding by pioneer neurone growth cones deprived of filopodia by cytochalasin treatment. Nature 323:712-715[Medline].
BRAUN, I. C., A. HEROLD, M. RODE, E. CONTI, and E. IZAURRALDE, 2001 Overexpression of TAP/p15 heterodimers bypasses nuclear retention and stimulates nuclear mRNA export. J. Biol. Chem. 276:20536-20543
BRAY, M., S. PRASAD, J. W. DUBAY, E. HUNTER, and K.-T. JEANG et al., 1994 A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc. Natl. Acad. Sci. USA 91:1256-1260
BUNCH, T. A., M. W. GRANER, L. I. FESSLER, J. H. FESSLER, and K. D. SCHNEIDER et al., 1998 The PS2 integrin ligand tiggrin is required for proper muscle function in Drosophila. Development 125:1679-1689[Abstract].
CHIEN, C. B., D. E. ROSENTHAL, W. A. HARRIS, and C. E. HOLT, 1993 Navigational errors made by growth cones without filopodia in the embryonic Xenopus brain. Neuron 11:237-251[Medline].
CRIPPS, R. M., E. BALL, M. STARK, A. LAWN, and J. C. SPARROW, 1994 Recovery of dominant, autosomal flightless mutants of Drosophila melanogaster and identification of a new gene required for normal muscle structure and function. Genetics 137:151-164[Abstract].
DYBAS, L. K., K. K. HARDEN, J. L. MACHNICKI, and B. W. GEER, 1983 Male fertility in Drosophila melanogaster: lesions of spermatogenesis associated with male sterile mutations of the vermilion region. J. Exp. Zool. 226:293-302.
GRÜTER, P., C. TABERNERO, C. VON KOBBE, C. SCHMITT, and C. SAAVEDRA et al., 1998 TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol. Cell 1:649-659[Medline].
HEROLD, A., M. SUYAMA, J. P. RODRIGUES, I. C. BRAUN, and U. KUTAY et al., 2000 TAP (NXF1) belongs to a multigene family of putative RNA export factors with a conserved modular architecture. Mol. Cell. Biol. 20:8996-9008
HOANG, B. and A. CHIBA, 1998 Genetic analysis on the role of Integrin during axon guidance in Drosophila. J. Neurosci. 18:7847-7855
HU, S., D. FAMBROUGH, J. R. ATASHI, C. S. GOODMAN, and S. T. CREWS, 1995 The Drosophila abrupt gene encodes a BTB-zinc finger regulatory protein that controls the specificity of neuromuscular connections. Genes Dev. 9:2936-2948
HURT, E., K. STRABER, A. SEGREF, S. BAILER, and N. SCHLAICH et al., 2000 Mex67p mediates nuclear export of a variety of RNA polymerase II transcripts. J. Biol. Chem. 275:8361-8368
KATAHIRA, J., K. STRABER, A. PODTELEJNIKOV, M. MANN, and J. U. JUNG et al., 1999 The Mex67p-mediated nuclear mRNA export is conserved from yeast to human. EMBO J. 18:2593-2609[Medline].
KAUFMANN, N., Z. P. WILLS, and D. VAN VACTOR, 1998 Drosophila Rac1 controls motor axon guidance. Development 125:453-461[Abstract].
KIEHART, D. P. and R. FEGHALI, 1986 Cytoplasmic myosin from Drosophila melanogaster. J. Cell Biol. 103:1517-1525
KISLAUSKIS, E. H., X.-C. ZHU, and R. H. SINGER, 1997 ß-Actin messenger RNA localization and protein synthesis augment cell motility. J. Cell Biol. 136:1263-1270
KOREY, C., C. BASCOM-SLACK, D. SCALICE, B. PERCIVAL and D. VAN VACTOR, 1997 X-chromosome genes provide further insight into embryonic motor axon guidance (Abstr). Soc. Neurosci.
KOZLOVA, T. Y., V. F. SEMESHIN, I. V. TRETYAKOVA, E. B. KOKOZA, and V. PIRROTTA et al., 1994 Molecular and cytogenetical characterization of the 10A12 band and adjoining region in the Drosophila melanogaster polytene X chromosome. Genetics 136:1063-1073[Abstract].
LAMBERTSSON, A., 1998 The Minute genes in Drosophila and their molecular functions. Adv. Genet. 38:69-134[Medline].
LIKER, E., E. FERNANDEZ, E. IZAURRALDE, and E. CONTI, 2000 The structure of the mRNA export factor TAP reveals a cis arrangement of a non-canonical RNP domain and an LRR domain. EMBO J. 19:5587-5598[Medline].
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.
MITCHELL, H. K., L. S. LIPPS, and U. M. TRACEY, 1977 Transcriptional changes in pupal hypoderm in Drosophila melanogaster. Biochem. Genet. 15:575-587[Medline].
MOGAMI, K. and Y. HOTTA, 1981 Isolation of Drosophila flightless mutants which affect myofibrillar proteins of insect flight muscle. Mol. Gen. Genet. 183:409-417[Medline].
MOGAMI, K., P. T. O'DONNELL, S. I. BERNSTEIN, T. R. F. WRIGHT, and C. P. EMERSON, JR., 1986 Mutations of the Drosophila myosin heavy chain gene: effects on transcription, myosin accumulation and muscle function. Proc. Natl. Acad. Sci. USA 83:1393-1397
PASQUINELLI, A. E., R. K. ERNST, E. LUND, C. GRIMM, and M. L. ZAPP et al., 1997 The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 16:7500-7510[Medline].
PATEL, N. H., B. G. CONDRON, and K. ZINN, 1994 Pair-rule expression patterns of even-skipped are found in both short- and long-germ beetles. Nature 367:429-434[Medline].
ROSENBERG-HASSON, Y., M. RENERT-PASCA, and T. VOLK, 1996 A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis. Mech. Dev. 65:83-94.
SAAVEDRA, C., B. FELBER, and E. IZAURRALDE, 1997 The simian retrovirus-1 constitutive transport element, unlike the HIV-1 RRE, uses factors required for cellular mRNA export. Curr. Biol. 7:619-628[Medline].
SANTOS-ROSA, H., H. MORENO, G. SIMOS, A. SEGREF, and B. FAHRENKROG et al., 1998 Nuclear mRNA export requires complex formation between Mex67p and Mtr2p at the nuclear pores. Mol. Cell. Biol. 18:6826-6838
SEARLES, L. L., R. S. RUTH, A.-M. PRET, R. A. FRIDELL, and A. J. ALI, 1990 Structure and transcription of the Drosophila melanogaster vermilion gene and several mutant alleles. Mol. Cell. Biol. 10:1423-1433
SEGREF, A., K. SHARMA, V. DOYE, A. HELLWIG, and J. HUBER et al., 1997 Mex67p, a novel factor for nuclear mRNA export, binds to both poly (A)+ RNA and nuclear pores. EMBO J. 16:3256-3271[Medline].
SIMPSON, P., R. WOEHL, and K. USUI, 1999 The development and evolution of bristle patterns in Diptera. Development 126:1349-1364[Abstract].
STRÄSSER, K. and E. HURT, 2000 Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export. EMBO J. 19:410-420[Medline].
STRÄSSER, K., J. BASSLER, and E. HURT, 2000 Binding of Mex67p/Mtr2p heterodimer to FXFG, GLFG, and FG repeat nucleoporins is essential for nuclear mRNA export. J. Cell Biol. 150:695-706
STUTZ, F., A. BACHI, T. DOERKS, I. C. BRAUN, and B. SÈRAPHIN et al., 2000 REF, an evolutionarily conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA 6:638-650[Abstract].
SUYAMA, M., T. DOERKS, I. C. BRAUN, M. SATTLER, and E. IZAURRALDE et al., 2000 Prediction of structural domains of TAP reveals details of its interaction with p15 and nucleoporins. EMBO Rep. 1:53-58[Medline].
TABERNERO, C., A. S. ZOLOTUKHIN, A VALENTIN, G. N. PAVLAKIS, and B. K. FELBER, 1996 The posttranscriptional control element of the Simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J. Virol. 70:5998-6011[Abstract].
TAN, W., A. S. ZOLOTUKHIN, J. BEAR, D. J. PATENAUDE, and B. K. FELBER, 2000 The mRNA export in Caenorhabditis elegans is mediated by Ce-NXF-1, an ortholog of human TAP/NXF and Saccharomyces cerevisiae Mex67p. RNA 6:1762-1772[Abstract].
TILNEY, L. G., P. CONNELLY, S. SMITH, and G. M. GUILD, 1996 F-actin bundles in Drosophila bristles are assembled from modules composed of short actin filaments. J. Cell Biol. 135:1291-1308
TILNEY, L. G., P. S. CONNELLY, K. A. VRANICH, M. K. SHAW, and G. M. GUILD, 2000 Regulation of actin filament cross-linking and bundle shape in Drosophila bristles. J. Cell Biol. 148:87-99
VAN DER BLIEK, A. M. and E. M. MEYEROWITZ, 1991 Dynamin-like protein encoded by the Drosophila shibire gene associated with vesicular traffic. Nature 351:411-414[Medline].





