Genetics, Vol. 159, 1659-1670, December 2001, Copyright © 2001

small bristles Is Required for the Morphogenesis of Multiple Tissues During Drosophila Development

Christopher A. Koreya, Gavin Wilkieb, Ilan Davisb, and David Van Vactora
a Department of Cell Biology, The Program in Neuroscience and The Dana Farber Cancer Institute/Harvard Cancer Center, Harvard Medical School, Boston, Massachusetts 02115
b Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, Edinburgh EH9 3JR, Scotland

Corresponding author: David Van Vactor, Department of Cell Biology, Harvard Medical School, 240 Longwood Ave.-LHRRB Rm. 401A, Boston, MA 02115., davie{at}hms.harvard.edu (E-mail)

Communicating editor: A. J. LOPEZ


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We found that mutations in small bristles (sbr) affect several tissues during the development of the fruit fly. In sbr embryos, neurons have defects in pathfinding and the body wall muscles have defective morphology. As adults, sbr flies have smaller and thinner bristles with a reduced diameter, suggesting a defective cytoskeleton within. The phenotypes we observe are consistent with defects in cell morphogenesis. We identified DmNXF1, the Drosophila homolog of a mRNA export protein that has been characterized in human (NXF1/TAP) and yeast (Mex67p) as the protein encoded by the small bristles locus. Given that a global decrease in mRNA export in these mutants is likely, the phenotypes we observe suggest that certain tissues are acutely sensitive to lower levels of cytoplasmic mRNA and the resultant decrease in protein synthesis during key stages of cellular morphogenesis.


THE development of a multicellular organism requires that cells undergo a complex and sometimes rapid morphogenesis to form the distinct tissues that are required for normal function. To accomplish this, genes are expressed and translated into the proteins that orchestrate the formation of each tissue type. The coordination of this process entails a complex communication between the extracellular milieu, the cytoplasm, and the nucleus. This results in the production of the signaling and structural proteins required for the formation and function of the resultant tissues and organs. While this process may be gradual in different cell types, certain cells undergo very rapid and complex morphogenesis such as the gametes, flight muscles, and sensory bristles of adult Drosophila. It has been postulated that such cells require higher levels of protein synthesis to accommodate their rapid rate of development (LAMBERTSSON 1998 Down). While high levels of protein synthesis put heavy demands on ribosomal function, rapid synthesis will also require the expeditious export of mRNA to supply the translation machinery. While the mechanisms of mRNA export are being rapidly elucidated in yeast and higher eukaryotes, the pathways underlying this phenomenon and their functions in metazoan development are still poorly understood.

One important step toward understanding RNA export in higher eukaryotes was the discovery of how retroviruses, particularly Mason-Pfizer monkey virus (MPMV), get their spliced and unspliced viral RNA into the cytoplasm of infected cells. In a normal cellular context, unspliced preRNAs are retained within the nucleus. Retroviruses require that their full-length unspliced RNA be exported from the nucleus to produce viral proteins and to be packaged into new viral particles. To accomplish this the MMPV viral RNA contains a constitutive transport element (CTE) that mediates efficient export of unspliced RNA out of the cell nucleus (BRAY et al. 1994 Down; TABERNERO et al. 1996 Down). Unlike the HIV retrovirus's Rev protein, the simple MPMV does not encode for an equivalent protein, suggesting that a cellular protein must provide this service. Tip associating protein/nuclear export factor 1 (TAP/NXF1) was identified as a protein that specifically binds the CTE and mediates efficient export of CTE-containing RNA out of the nucleus (GRUTER et al. 1998 Down). Further experiments in Xenopus oocytes showed that injecting saturating amounts of CTE RNA prevented the export of mRNA, implying that TAP/NXF1's true cellular role lies in mRNA export (PASQUINELLI et al. 1997 Down; SAAVEDRA et al. 1997 Down; GRUTER et al. 1998 Down).

Previous to the identification of human TAP (TAP/NXF1), work in Saccharomyces cerevisiae identified the yeast homolog, mex67, in a screen for genes required for the export of poly(A)+ RNA (SEGREF et al. 1997 Down). Mex67p localizes to the nuclear rim and was shown to bind and mediate the export of RNA polymerase II transcripts (SEGREF et al. 1997 Down; HURT et al. 2000 Down). Subsequent work in both systems has clearly identified four functional domains within the TAP/NXF1 protein. At the N terminus, TAP/NXF1 has a noncanonical ribonucleoprotein (RNP)-type RNA binding domain and a leucine-rich repeat region (LRR; LIKER et al. 2000 Down). Together these domains mediate the specific binding of TAP/NXF1 to the viral CTE (LIKER et al. 2000 Down), while only the LRR is required for the export of mRNA in TAP/NXF1 (BRAUN et al. 2001 Down). The next domain is an NTF-2-like domain that serves as the binding site for its partner protein p-15 (human, HEROLD et al. 2000 Down; SUYAMA et al. 2000 Down)/ Mtr2p (S. cerevisiae, SANTOS-ROSA et al. 1998 Down; STRASER et al. 2000 Down). Efficient export of mRNA into the cytoplasm requires the formation of Mex67p-Mtr2p and TAP/NXF1-p15 complexes (STRASER et al. 2000 Down; BRAUN et al. 2001 Down). Importantly, TAP/NXF1-p15 can substitute for Mex67p-Mtr2p in yeast cells, indicating a conserved mRNA export function for the complex (KATAHIRA et al. 1999 Down).

The C termini of TAP/NXF1 and Mex67p have been shown to bind to nucleoporins through a domain similar to a ubiquitin-associated (UBA) domain (SUYAMA et al. 2000 Down). Studies have shown that the C terminus, which includes the UBA-like domain and part of the NTF2-like domain, is necessary and sufficient to localize TAP/NXF1 to the nuclear rim (BEAR et al. 1999 Down; BACHI et al. 2000 Down; HEROLD et al. 2000 Down). Finally, consistent with its role in the export of mature mRNAs out of the nucleus, several TAP/NXF1 binding proteins that associate with mRNA during and after splicing is completed have been identified, for example, Yra1p/REF (STRASER and HURT 2000 Down; STUTZ et al. 2000 Down). Along with TAP/Mex67p's general affinity for mRNA, these proteins may also help recruit TAP/Mex67p to fully processed and spliced mRNA.

The recent identification of the Caenorhabditis elegans homolog, CeNXF1, showed that this protein is essential for viability of embryos and adults (TAN et al. 2000 Down). However, the consequence of CeNXF1 loss-of-function on cellular development was not examined. Here we describe the developmental characterization of small bristles (sbr). We identified a new allele of sbr in an axon guidance screen and report that small bristles is required for a diverse set of morphogenetic events including motor-axon pathfinding, embryonic muscle development, and normal adult bristle formation. Our subsequent cloning of sbr identified DmNXF1, the Drosophila homolog of TAP/NXF1, as the protein encoded by this locus. Preliminary studies confirm that this gene is required for efficient export of mRNAs out of Drosophila nuclei (G. WILKIE, C. A. KOREY, D. VAN VACTOR and I. DAVIS, unpublished observations). In light of our findings and this protein's role in mRNA export, we suggest that the developmental phenotypes observed indicate that cells undergoing rapid morphogenesis have an acute sensitivity to the loss of cytoplasmic mRNA and the resultant decrease in protein synthesis.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Histology:
Embryos were processed as described (VAN VACTOR and KOPCZYNSKI 1999 Down). The following antibodies were used: mAb FMM5 (anti-myosin heavy chain, 1:10; KIEHART and FEGHALI 1986 Down), mAb 2B8 (anti-Even-skipped, 1:50; PATEL et al. 1994 Down), mAb 1D4 (anti-fasciclin II, 1:4; VAN VACTOR et al. 1993 Down), and mAb anti-ß-galactosidase (1:500; Sigma, St. Louis; VAN VACTOR and KOPCZYNSKI 1999 Down). mAb anti-ß-galactosidase was used to recognize the ß-galactosidase protein being produced by a transgene on the Fm7cß balancer chromosome (ß signifies the transgene). This transgene allowed for the identification of male embryos that would be hemizygous for small bristles.

Scanning electron microscopy:
Newly eclosed female adults of the specified genotypes were collected and aged for several days in a yeast-free food vial. These flies were then taken through a series of ethanol dehydration steps. They were first placed in 25% ethanol and after a 12-hr incubation time they were moved to 50% ethanol. This process continued, moving through the following dilutions: 50, 75, 95, and 2x 100% ethanol. They were left in 100% ethanol and taken to the Northeastern Electron Microscopy facility to be critical point dried and sputter coated for scanning electron microscopy (SEM).

Germline clone:
The y w sbrmgln chromosome was recombined onto a FRT101 chromosome to incorporate the FRT sites to be used for the germline clone. Females of the genotype y w sbrmgln FRT101/FM7cß were then mated to males of the genotype ovoD1 FRT101/Y; hsFLP. When wandering third instar larvae were observed the vials were heat-shocked at 37° for 2 hr and then again for 2 hr, 24 hr later. A subset of these vials was not heat-shocked and served as the non-heat-shock control. As a wild-type germline clone control we crossed the original y w FRT101 females to males of the genotype ovoD1 FRT101/Y; hsFLP and followed the same procedure as outlined for the sbrmgln chromosome. When the adults from the heat-shocked and non-heat-shocked vials eclosed, females of the genotype y w sbrmgln FRT101/ ovoD1 FRT101 (experimental) or y w FRT101/ ovoD1 FRT101 (wild-type control) were collected. Four crosses were set up to determine the result of the germline clone induction: y w sbrmgln FRT101/ ovoD1 FRT101 x FM7cß/Y (one for heat shock and one for non-heat-shock control) and y w FRT101/ ovoD1 FRT101 x FM7cß/Y (one for wild-type heat-shock control and one for wild-type non-heat-shock control).

Fly stock maintenance:
All fly strains were raised at 25°.

Genetic mapping:
Three multiply marked X chromosomes were used to genetically map the sbrmgln lesion in relation to the chosen visual markers. The genotypes of the chromosomes were as follows: sc ec cv ct g, y m wy sd os, and y cv v f car (abbreviations according to LINDSLEY and ZIMM 1992 Down). On the basis of the recombinant classes and numbers of each class obtained, the sbrmgln lesion's location was determined in relation to the experimental markers. On the basis of the results of the initial mapping, this analysis was done again with the vermilion eye marker alone. The high number of progeny counted for this analysis allowed us to calculate a map distance between vermilion and sbrmgln.

The full deficiency kit for the X chromosome was obtained from the Bloomington Drosophila Stock Center. In addition, all chromosomal duplications that contained duplicated segments of the X chromosome were also obtained. These stocks were then independently crossed to the sbrmgln line to obtain a duplication that rescued the lethality. Once we had identified such a duplication, Dp(1;Y)v+y+, we used rescued males (yw mgln/Y- Dp(1;Y)v+y+) to map sbrmgln using the deficiency collection.

Deficiency breakpoint mapping:
Df(1)HC133: Southern blots were done on genomic DNA preparations of three different genotypes: wild-type genomic DNA to view the normal digestion patterns; Df(1)HC133 to look for signs of a chromosomal breakpoint; and Df(1)v-L15, a deficiency that removes the entire region as a control for 50% DNA content. The PCR-amplified probe that identified the breakpoint, 929IJ (forward primer 5' GAGGGGCAAACTTCATGTTAT 3'; reverse primer 5' GCTTCAACAGCAGAAAAGAAC 3'), covered the 5'-most section of the dIMP. Analysis of the hybridization pattern showed a band shift indicative of a chromosomal lesion with four different restriction enzymes: HindIII, EcoRI, BamHI, and BglII. The bandshifts predicted that the breakpoint resided in the ~1.3 kb between a BamHI site and HindIII site in the 5' untranslated region (UTR) of dIMP. Further Southern analysis with probes within the predicted deficiency region showed a 50% reduction in signal in flies heterozygous for the deficiency.

Df(1)vL4: We probed genomic blots with a PCR-amplified DNA fragment, 912QP (forward primer 5' CGGATTGCACAGGAGATTCTGC 3'; reverse primer 5' GGAAAACTCTGTTCAGCTCTG 3'), which contained the genomic DNA ~5 kb from the 3' end of sbr. Analysis of this hybridization showed a band shift indicative of a chromosomal lesion with five different enzymes, HindIII, EcoRI, BamHI, BglII, and SalI. The band shifts predict that the breakpoint resides within a 2.5-kb EcoRI fragment. This implies that Df(1)v-L4 removes the sbr coding region. We confirmed this prediction by probing Southern blots with a genomic fragment that contained sbr coding sequence to show a 50% reduction in Df(1)v-L4/Fm7cß signal as compared to wild type.

Df(1)vL3: Genomic Southern blots were probed with a DNA fragment from the K3.18.7 phage that contained the genomic DNA that included the 5' end of sbr. Analysis of the hybridization pattern showed a band shift indicative of a chromosomal lesion with two different enzymes, SalI and HindIII. The band shifts predict that the breakpoint resides within a 7.5-kb SalI fragment. Further Southern analysis confirmed that the break was within the 4.7-kb HindIII-SalI fragment that covers the 5' end of sbr.

Restriction fragment length mapping:
Restriction fragment length polymorphism (RFLP) mapping was performed as described by VAN DER BLIEK and MEYEROWITZ 1991 Down. Twenty-three recombinant lines were obtained from the vermilion-sbrmgln meiotic mapping cross. Each line had an independent recombination event between vermilion and the sbr locus. We obtained phage clones from the Zhimulev genomic walk that covered the region between vermillion and the putative location of the sbr locus (all clone names are stated as reported in KOZLOVA et al. 1994 Down). These two reagents were used to determine the precise location of the mutation by RFLP analysis. The parent vermilion and sbrmgln lines were cut with a battery of restriction enzymes and then screened for RFLPs by Southern hybridization with genomic fragments that spanned the region. The following three RFLPs were identified: a HindIII RFLP using a 700-bp PCR fragment from the vermilion coding sequence (SEARLES et al. 1990 Down; primers VerA, 5' GAACCGAGTGGTTCTGATTCT 3'; VerB, 5' AACGAGTCGATGTCCATGAG3'), a BglII RFLP using a 5-kb SalI fragment from the K4.8.1 genomic clone, and BamHI RFLP using a 4-kb BamHI fragment from the K3.18.2 genomic clone. Upon identification of an RFLP, each of the 23 recombinant lines were screened to determine which form of the RFLP, vermilion or sbrmgln, they carried.

Sequencing the sbr alleles:
Examination of sbr1, sbrts148, and sbr10 for possible sequence alterations was accomplished by sequencing the sbr cDNA obtained from homozygous adults of each genotype. For sbrts148 and sbr10, adults were obtained by raising the cultures at the permissive temperature of 18°. In addition to the sequence changes reported in RESULTS, there are also sequence polymorphisms that do not alter the protein sequence: a C to T change at nucleotide 1465, C to G at nucleotide 1479, and A to G at nucleotide 1503. To sequence the sbrmgln lesion, we were forced to obtain the sbr cDNA from adult females heterozygous for sbrmgln and another mutation, sbrts148. This was done because sbrmgln's lethality prevented us from obtaining homozygous adults, so we had to obtain the sbrmgln cDNA from a mixed population of chromosomes. sbrts148 was used as the second chromosome because the sequence lesion from this mutant had been identified first and it permitted the unequivocal identification of sbr cDNAs transcribed from the sbrts148 chromosome. Any cDNA that did not carry the sbrts148 mutation was considered to be from the sbrmgln chromosome. We purified mRNA from 30 adult females of the genotype sbrmgln/sbrts148, using a mRNA micropurification kit (Amersham, Arlington Heights, IL). Total adult cDNA was made from this mRNA preparation, using a first-strand synthesis kit (Amersham). PCR primers were designed within the 5' and 3' UTR (CBS11-Xho, 5' CCTCGAGGAAGTTGGCAGCAGTTTGTG 3'; CBS11-R1, 5' GGAATTCCATTATGTGGATGTGGCACGC 3') of sbr and used to amplify the full-length cDNA. The resulting PCR products were cloned into the pCRII vector [Invitrogen (San Diego) TOPO TA kit] and sequenced with a primer (CBS11-2970, 5' CGATGGGACGAGGATGATGAC 3') that read through the T to A mutation at nucleotide 461 in the sbrts148 cDNA. Two cDNAs from independent PCR reactions were shown not to contain the sbrts148 mutation. These were fully sequenced to identify the lesion in sbr from the sbrmgln chromosome.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We identified a new allele of sbr in a screen for X chromosome mutations that affect the pathfinding of embryonic motor neurons (KOREY et al. 1997 Down). After extensive mapping of this mutant, magellan (see below), we found that it was allelic to sbr and renamed the mutant sbrmgln.

Axonal defects in small bristles:
The neuromuscular system of the Drosophila embryo has been well characterized at the cell biological level (BATE and BROADIE 1995 Down). The intersegmental and segmental nerves (ISN and SN) are the two main motor nerve roots that exit the Drosophila central nervous system (CNS). In the periphery, these axon bundles divide into five branches that innervate the 30 body wall muscles in each hemisegment, as observed with the anti-Fasciclin II antibody mAb 1D4 (VAN VACTOR et al. 1993 Down). The ISN innervates dorsal muscles and generates the ISNb and ISNd branches that innervate ventral muscles, whereas the SN pathway divides into SNa and SNc, which innervate lateral and ventral muscles, respectively (Fig 1A).



View larger version (97K):
In this window
In a new window
Download PPT slide
 
Figure 1. Axon phenotypes in small bristles embryos. Images of a wild-type embryo and a small bristles embryo. Embryos were stained with mAb 1D4 and dissected to visualize the ventral muscle domain. Each image consists of two adjacent segments from stage 16–17 embryos with the arrow denoting the point at which ISNb enters the ventral muscle region. (A) Arrowheads identify the positions of the three stereotyped connections that are made by ISNb; two wild-type segments are shown. (B) An image of two sbrmgln segments in which ISNb axons have passed by the ventral muscle region. The ISNb fascicle is marked with an asterisk. Arrowheads identify the three stereotyped connections that are made by wild-type ISNb axons. (C and D) Images of the CNS from a St16-17 wild-type and sbrmgln embryo with arrows denoting breaks in the outermost fascicle. Embryos were stained with mAb 1D4 and dissected to visualize the ventral nerve cord. (C) Wild type; (D) sbrmgln; (E) a graph of the total percentage of ISNb pathfinding errors observed in sbr embryos compared to a wild-type control. Pathfinding errors included both bypassing the ventral target muscles and entering the ventral target region and then subsequently failing to make the appropriate connections. n, number of hemi-segments (A2–A7); Df(1) = Df(1)v-L4. Bar, 5 µm.

In sbr mutant embryos, we observe guidance defects in all motor axon pathways. With the exception of a viable hypomorph, sbr1, lethal sbr alleles can be organized in an alleleic series of increasing severity of embryonic phenotypes. In general, sbr mutant axons extend but fail to follow the correct pathway to their targets (Fig 1). The most penetrant axonal defects are seen in the ISNb motor pathway, ranging from 54% of segments in weaker alleles to 80% of segments in the strongest alleles (Fig 1E). ISNd is also routinely absent from its target muscles, presumably due to failed defasciculation from the ISN. In addition, we see a low penetrance crossing of the segment boundary by ISN in the dorsal regions of the embryo and variable defects in SN motor axon bundles. The alleles sbrmgln and sbr12 display severity equivalent to a complete deletion of the gene, suggesting that they are functional nulls; although no antibody is available to confirm this prediction, sequence of sbrmgln reveals a truncation of the predicted protein (see below). Careful examination of muscle cells in these strong alleles also reveals defects in muscle morphogenesis (see below). Although the peripheral motor axon pathfinding problems in sbr mutants could be secondary to these muscle defects, we also observe axonal defects within the CNS neuropil where muscle cell morphogeneisis is unlikely to affect axonogenesis.

The ventral nerve cords of sbr mutants show highly penetrant defects in the development of the longitudinal axon scaffold as revealed by mAb 1D4 (Fig 1C and Fig D). This antibody highlights three parallel Fasciclin II-positive fascicles on either side of the ventral midline. In sbr embryos, the outermost fascicle contains frequent gaps or is thinner than normal, a phenotype common to many mutations in axon guidance genes (e.g. integrin subunits, HOANG and CHIBA 1998 Down; dTrio, BATEMAN et al. 2000 Down). This phenotype may be the result of defective interaxon communication that obstructs axon extension or fasciculation in the longitudinal pathways.

Since axonal phenotypes can represent secondary consequences of defective cell fate determination, we also examined the pattern of embryonic CNS cell fates. We stained sbr embryos with several nuclear markers including antibodies to Engrailed (data not shown) and Even-skipped proteins (Fig 2). Our analysis demonstrates that the number and position of cells expressing each of these markers appears normal in sbrmgln embryos, suggesting that the axon guidance phenotypes we observe are a result of later defects in differentiation and morphogenesis.



View larger version (165K):
In this window
In a new window
Download PPT slide
 
Figure 2. Even-skipped cell fate analysis. Images of the dorsal and ventral focal planes of the ventral nerve cord of stage 16–17 embryos. (A and B) Images of a wild-type control embryo. In the dorsal view, RP2, aCC, and pCC are visible and labeled. In the ventral plane, the EL and CQ neurons are visible and labeled. The arrows in subsequent images reference the wild-type neurons labeled. (C and D) Images of sbrmgln ventral nerve cords. Bar in D, 10 µm.

Embryonic muscle defects:
After examining the defects in motor axon and CNS pathfinding, we noted that there also appeared to be defects in the morphology of the body wall muscles in the strongest alleles. The embryonic musculature begins to develop as the germ band shortens around stage 12 of embryonic development (BATE 1990 Down). Initially, muscle precursors or founder cells develop for each specific muscle, which then recruit surrounding myoblasts to fuse and form fully differentiated multinucleate muscle. As each muscle cell grows it also elongates and sends out processes to find and insert at a specialized epidermal muscle attachment site. By stage 15–16, all 30 of the individual abdominal muscles have been formed in each segment (BATE 1990 Down).

In sbr embryos, we find that the muscles appear to have initially differentiated correctly, forming the correct number of muscles in the right positions in each segment. However, at stage 16, these muscles have an aberrant morphology including long drawn out fibers (Fig 3) and in some cases muscles appear to have pulled out of their epidermal attachment site (Fig 3D). These phenotypes are consistent with problems associated with late muscle morphogenesis suggestive of defects in cytoskeletal and other structural components that form the fully functional contractile apparatus. Consistent with this hypothesis, staining with an antibody that recognizes the myosin heavy chain reveals a disrupted pattern of myosin localization and reduced levels of the antigen (Fig 3). It is possible that, given the described defects of the musculature, problems in the target field could explain the motor axon pathfinding errors, but not those within the CNS.



View larger version (141K):
In this window
In a new window
Download PPT slide
 
Figure 3. Embryonic muscle defects in small bristles mutants. Shown are muscles from stage 16 embryos stained with mAb FMM5, which recognizes the myosin heavy chain. (A) An image of one segment of a wild-type stage 16 embryo showing the ventral and oblique muscle fields. Muscles 6 and 7 are shown in this plane of focus. (B) An image similar to that shown in A from a sbrmgln/ sbr12 embryo. The image shows the change in myosin localization and the change in morphology of these muscles. (C) An image of muscles 6 and 7 from a sbrmgln/ sbr5 embryo showing the morphology defects in these muscles. (D) An image of a sbrmgln/ sbr6 embryo showing a muscle (likely to be muscle 7) that has pulled out of its insertion site (asterisk). Bar in D, 8 µm.

Germline clones of sbr are germline lethal:
While sbr zygotic mutations affect the development of both the motor neurons and the body wall muscles, this does not address whether sbr has an earlier role in embryonic development. It is likely that maternal expression of sbr allows embryos to reach late stages of embryonic development (see below). To address this question, we made germline clones with the sbrmgln allele using the FLP/FRT recombination system and the dominant female sterile mutation ovoD1.

Germline clones with the sbrmgln chromosome produce sterile females (n = 180 females) that fail to lay eggs. The wild-type chromosome control was completely fertile (n = 150 females), laying eggs that hatched into adults. We dissected the ovaries from heat-shock-treated y w sbrmgln FRT101/ ovoD1 FRT101 females (mutant, n = 67) and y w FRT101/ ovoD1 FRT101 females (control) and found that the sbrmgln clones had no discernible egg chambers present, suggesting that there is probably an earlier defect in ovary development. This result prevents us from addressing the early embryonic role of sbr.

sbr mutations affect macrocheate development:
The small bristles mutation was named for its affect on the large sensory bristles present on the thorax and head of the Drosophila adult (LINDSLEY and ZIMM 1992 Down). These bristle cells are part of a sensory system of small (microchaete) and large (macrochaete) bristles that cover the insect's exoskeleton. Along with the bristle cell, there are three associated cells: a supporting socket cell, a neuronal cell that extends a process into the bristle shaft, and a glial cell. These four cells differentiate from a single progenitor sensory organ precursor cell present in the larval imaginal wing discs (reviewed in SIMPSON et al. 1999 Down). Once the cell types have been specified, the bristle cell extends a process between 32 and 48 hr of pupal development, which will become the sensory bristle. Within each macrochaete, 16–25 hexagonally arrayed bundles of actin run the length of the bristle attached to the cell membrane (TILNEY et al. 1996 Down). These filaments, made of repeated modules of actin filaments (TILNEY et al. 1996 Down), are thought to play a key role in bristle extension because inhibitors of filament assembly slow growth in vitro while filament stabilizers accelerate growth (TILNEY et al. 2000 Down). The outward manifestation of the actin bundles in fully developed bristles is a distinct ridging pattern produced by the cell membrane protruding out between two actin bundles (TILNEY et al. 1996 Down). Upon full extenision of the bristle, the cuticle is secreted to support the cell and the actin filaments are degraded to produce a hollow bristle in which the sensory axon process extends. In contrast to the actin cytoskeleton, the microtubules that fill the cytoplasm of the bristle throughout development do not play a role in extension (TILNEY et al. 2000 Down). Instead, they may provide cytoplasmic bulk to the bristle, similar to the role intermediate filaments play in other systems (TILNEY et al. 2000 Down).

The adult viable sbr1 mutation was first isolated on the basis of its bristle phenotype (LINDSLEY and ZIMM 1992 Down), but a detailed analysis of the defects in bristle formation was not performed. In different alleleic combinations of the sbr1 allele with lethal sbr alleles, adults have smaller than normal macrochaetes when compared to wild type while the smaller microchaetes appear grossly normal (Fig 4, A–E). Scanning electron microscopy of the macrochaete surface shows that the bristles are smaller in diameter, while the external ridging is reduced in number and is less distinct in sbr mutants (Fig 4, F–H). The ridging is further reduced in stronger allelic combinations and in some cases the bristle cell does not extend out of the socket cell (Fig 4I) or occasionally the bristle and socket cells are absent altogether (Fig 4C). Furthermore, notal clones made with the sbrmgln chromosome, which behaves as a null, cause bristles to be severely reduced in size or absent (data not shown). Consistent with the ridging adding strength to the bristle structure (much like corrugated metal sheeting) we observe large numbers of broken bristle shafts in sbr adults (Fig 4J). In summary, the decreased bristle length and diameter, the loss of ridging, and the absence of bristles from socket cells suggest that there are defects in the underlying cytoskeleton. The common theme of defects in the structure and morphogenesis of neural, muscle, and epidermal tissues in sbr mutants encouraged us to identify the gene encoded by this locus.



View larger version (158K):
In this window
In a new window
Download PPT slide
 
Figure 4. SEM of sensory bristles from small bristles mutants. (A) A wild-type notum at 100x magnification showing the small microchaetes and the larger macrocheates. (B) A sbr1 notum showing shortened and missing (arrows) macrochaetes (100x magnification). (C) A sbr5/ sbr1 notum (100x magnification). The stronger allelic combination produces smaller bristles and causes more to be missing altogether (arrows). (D) An image of a wild-type scutellar bristle at 300x magnification. (E) An image of the same scutellar bristle in a sbr1 mutant showing the decrease in length. (F) A 2000x magnification image of the base of a wild-type macrochaete showing the distinct ridging present on the bristle cell surface. (G) An image of a sbr1 macrochaete (2000x) showing the decrease in external ridging and the decrease in diameter. (H) An image of a sbrmgln/ sbr1 macrochaete (2000x) showing an increased loss of ridging and the severe decrease in diameter present in this genetic combination. (I) A close-up of a sbrmgln/ sbr1 socket from which no bristle appears to have elongated. (J) An image of a broken bristle from an sbrmgln/ sbr1 adult. Bars: 100 µm (A), 50 µm (D), and 15 µm (F).

Genetic mapping of the small bristles locus:
We began the initial mapping with the strong EMS-induced allele sbrmgln that we obtained in a screen for axon guidance mutants. Recombination mapping with a y m wy sd os chromosome placed sbrmgln approximately one chromosomal division from miniature (m, 10E1–2) while mapping with a y cv v f car chromosome suggested that the lesion was extremely close to vermilion (v, 10A1–2). On the basis of these initial results, we performed a high-resolution recombination mapping analysis between the sbrmgln lesion and vermilion. This analysis produced a recombination distance of 0.28 cM, which translated into a physical distance of ~94.2 kb between sbrmgln and v (based on 0.01 cM = 3.3 kb in this region; KOZLOVA et al. 1994 Down). This distance implies that the sbrmgln lesion lies on or near the end of the previously published Zhimulev genomic walk through the vermilion region (Fig 3, KOZLOVA et al. 1994 Down). The mapping of our allele to this chromosomal position was consistent with previous genetic mapping of the sbr locus (ZHIMULEV et al. 1981B Down). Subsequent genetic complementation assays confirmed that our new lethal mutation is a strong allele of sbr.

In parallel to the recombination mapping and the previous work on this locus, duplication and deficiency chromosomes were also used to identify the region of the X chromosome affected by the sbrmgln lesion. We identified a duplication, Dp(1;y)v+y+ (ZHIMULEV et al. 1981A Down), which cleanly rescued normally lethal sbrmgln males to complete viability and fertility. This duplication permitted us to use deficiencies to locate the sbr interval on the X chromosome. Consistent with previous sbr work (ZHIMULEV et al. 1981B Down), we found that Df(1)v-L15 and Df(1)v-L4 failed to complement sbrmgln lethality, while Df(1)HC133 and Df(1)v-L3 were viable when heterozygous with the sbrmgln lethal. Consistent with the mapping of lethality, both Df(1)v-L15 and Df(1)v-L4 (Fig 1E) showed phenotypes specific to sbr, both alone and when heterozygous with sbr alleles. The deficiencies Df(1)HC133 and Df(1)v-L3 did not. On the basis of published breakpoint analysis of these deficiencies, the sbr locus was determined to be within the 9F5–9F10 interval of the X chromosome (ZHIMULEV et al. 1981A Down).

Molecular mapping of small bristles:
To identify the sbr open reading frame, we took two parallel approaches to correlate the genetic and physical maps: recombination mapping with RFLP markers and deficiency breakpoint mapping. The high-resolution recombination mapping between the sbrmgln allele and vermilion (v) produced 23 lines with independent recombination events between the sbrmgln lesion and v (representing a total of 72 recombinants out of 25,276 F2 progeny). Using genomic phage clones from the Zhimulev walk, we identified three RFLP markers in the 100-kb interval between v and sbrmgln (see MATERIALS AND METHODS). The recombinant lines were then screened for the enzyme cutting pattern characteristic of either sbrmgln or v. The frequency at each site was plotted vs. the physical distance on the chromosome to predict the intercept at 0% recombination and therefore the location of the sbrmgln lesion (Fig 5A). An approximate degree of accuracy was estimated by dividing the approximate sbrmgln to v physical distance of 100 kb by the 23 independent recombinant lines, giving a resolution of nearly 5 kb on either side of the intercept.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 5. RFLP and deficiency mapping of small bristles. (A) A graph of the RFLP data generated in this study. Each RFLP (shaded boxes) identified was plotted on a graph of the genomic distance from vermilion vs. the number of the 23 recombinant lines that showed the sbrmgln form of the RFLP. A best-fit line was produced using Cricket Graph with the x-intercept being the location of the lesion on the sbrmgln chromosome. The distance in kilobases is labeled according to KOZLOVA et al. 1994 Down, with the 0 point being the end of the walk described in that article. (B) A diagram of the sbr genomic region enlarged from the x-axis in A. The sbr and dIMP transcript maps are shown in relation to the identified deficiency breakpoints and the RFLP intercept. The DNA missing from the deficiency chromosomes is indicated by the solid horizontal lines, with the uncertainty in the breakpoints shown by the solid vertical lines. The RFLP intercept is placed on this genomic map bisecting the 3' end of sbr.

The intercept bisected the 3' end of an open reading frame encoding the DmNXF1 protein, but it was also close to an open reading frame encoding the Drosophila homolog of the RNA-binding protein Vera (dIMP; Fig 5B). To obtain independent evidence that sbr encodes the DmNXF1 protein, we mapped the deficiency breakpoints that most closely defined the sbr locus. The complementing Df(1)HC133 was found to break in the 5' UTR of dIMP and remove the complete open reading frame (Fig 5B). Consistent with the mapping, this deficiency also eliminates the embryonic expression of the dIMP gene (data not shown). We then found that the proximal breakpoint of the complementing deletion Df(1)vL3 lies within a 5-kb fragment that includes the 5' end of DmNXF1 (Fig 5B). Since identified mutations in DmNXF1 [sbrts148, sbr10 (G. WILKIE and I. DAVIS, personal communication), and sbrmgln (this article)] complement this deficiency, Df(1)vL3 does not remove sbr. Finally, we found that Df(1)v-L4 breaks just outside of the DmNXF1 3' end and removes the entire DmNXF1 coding region (Fig 5B). Thus, the three techniques we used, recombination mapping, deficiency mapping, and RFLP mapping, all strongly and independently point to DmNXF1 as the protein encoded by small bristles.

In light of this we identified a cDNA encoding the full-length sbr open reading frame from a mixed-stage poly(A)+ selected embryonic cDNA library. After sequencing the full-length cDNA and comparing it to the Berkeley Drosophila Genome Project genomic sequence, we found that the sbr genomic region has 10 exons and encodes a 672-amino-acid protein, DmNXF1 (accession numbers: protein, CAB64382; nucleotide, AJ251947), which retains the conserved domain structure when aligned with the human and yeast homologs (Fig 6A; HEROLD et al. 2000 Down). The RNA-binding domain, the leucine rich repeats, the NTF2-like domain, and the UBA-like domain including the 3-amino-acid nucleoporin binding NWD motif are all present in the Drosophila homolog (HEROLD et al. 2000 Down). Northern analysis on total embryonic RNA shows that it is maternally loaded (data not shown) and is expressed highly during embryonic development (Fig 6C). In situ analysis indicates that it is expressed ubiquitously at low levels throughout embryonic development (data not shown).



View larger version (94K):
In this window
In a new window
Download PPT slide
 
Figure 6. small bristles encodes DmNXF1. (A) An alignment of the protein sequences of human TAP/NXF1, the yeast Mex67p, and DmNXF1. Identical residues are shaded. The domain structure of DmNXF1 is labeled above the sequence alignment with each of the domains labeled according to HEROLD et al. 2000 Down. RBD, RNA-binding domain; LRR, Leucine rich repeat; UBA, ubiquitin associated. The solid box labels the position of the valine to glutamic acid change at residue 154 in sbrts148. The solid circles label the position of the proline to leucine change at residue 139 and the two conservative changes, threonine to serine at position 493 and methionine to isoleucine at residue 499, in sbr10. The asterisk labels the point in the sbrmgln allele where the protein is truncated by a premature stop codon. (B) A diagram of the point mutation identified in the sbrmgln allele. The parts of exons 7 and 8 shown are in uppercase letters while the intervening intron is lowercase. The G to A mutation is shown as a large A while the premature stop codon produced is labeled with an asterisk. The 5' and 3' splice sites are underlined. (C) A Northern blot indicating the expression of sbr during embryonic development, which shows its expression in embryos collected at 0–12 and 12–24 hr of embryonic development.

Sequencing small bristles lesions:
Sequencing the hypomorphic sbr1 allele revealed no sequence changes within the DmNXF1 open reading frame, suggesting that the defects we see may be due to a hypomorphic mutation within a promoter or enhancer for this gene. This is consistent with the weak nature of the allele and the limitation of the phenotype to sensory bristles. sbrts148 has a T to A mutation at nucleotide 461, causing a valine to glutamic acid change at residue 154 within the RNA-binding domain of the protein (see solid box in Fig 6A). sbr10 has a C to T mutation at nucleotide 416, causing a proline to leucine change at residue 139, also within the RNA-binding domain of the protein. There are also two mutations in sbr10 that produce conservative changes: threonine to serine at position 493 (A to T at nucleotide 1477) and methionine to isoleucine at residue 499 (G to T at nucleotide 1497; see solid circles in Fig 6A; also see MATERIALS AND METHODS).

The initial amplification of the sbrmgln cDNA showed an upward band shift of the cDNA in relation to the wild-type sequence, indicating that the mutant form was larger. Sequencing of the sbrmgln cDNA reveals a 67-bp insertion within the coding region of DmNXF1. When further analyzed, the inserted sequence was identified as the intron between exons 7 and 8. The failure to splice out the intron is due to a point mutation that changes the conserved 5' splice site of intron 7 from GT to AT (Fig 6B). The retention of the intron produces a premature stop codon that terminates the protein at amino acid 417 (see asterisk in Fig 6A) and removes the conserved C terminus of the protein, including part of the NTF2-like domain and the UBA-like domain (Fig 6). Sequencing of the genetic background that was used to produce this mutant does not show this sequence alteration. This mutation does not prevent transcription of the gene since we were able to obtain full-length mutant cDNA. Thus, the mutation affects sbr post-transcriptionally by producing an unstable mRNA, a truncated form of the protein that is unstable and degraded, or a form of the protein that is unable to perform its normal cellular functions.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The analysis of small bristles mutants and our subsequent cloning of the locus provides a unique opportunity to analyze the in vivo role of mRNA export during Drosophila development. We found that mutations in small bristles affect the morphogeneis of embryonic neurons, embryonic muscle, and adult sensory bristles. We have shown that sbr encodes the DmNXF1 protein, the Drosophila homolog of a mRNA export protein that has been characterized in human (TAP/NXF1) and yeast (Mex67p). In these systems, this family of proteins has been shown to play a major role in the export of mRNA from the nucleus to the cytoplasm. We have shown that DmNXF1 has similar domain structure to its homologs (Fig 6A), and sbr embryos display defects in the export of mRNA out of the nucleus (G. WILKIE, C. A. KOREY, D. VAN VACTOR and I. DAVIS, unpublished results). Furthermore, DmNXF1 is required for mRNA export in SL2 cells (A. HEROLD and E. IZARRAULDE, personal communication). Together these studies show that function of the Drosophila homolog is consistent with its role as a major mRNA export protein in other systems.

Our analysis of developmental defects in sbr mutants suggests that the phenotypes we observe are not the result of cell fate problems, but rather are due to problems in late-stage differentiation and cell morphogenesis. The following question remains: Knowing the cellular function of sbr, how are the pathfinding of neurons, the structural integrity of muscles, and the development of the bristle related? Given that a global decrease in mRNA export in these mutants is likely, the phenotypes suggest that certain tissues are more sensitive to the lower levels of mRNA and the resultant decrease in protein synthesis. This hypothesis is consistent with work on the Minute syndrome in Drosophila. This collection of phenotypes is associated with >50 different loci throughout the genome. The Minutes are usually haploinsufficient and produce a variety of phenotypes, including delayed larval development, recessive lethality, short and thin bristles, and reduced fertility and viability (reviewed by LAMBERTSSON 1998 Down). The recent identification of the genes encoded by several Minute loci has shown that many are mutations in ribosomal proteins (LAMBERTSSON 1998 Down), suggesting that the phenotypes observed are a result of defective protein synthesis.

It has been proposed that the specific cell types affected represent tissues that require large amounts of protein synthesis during development (LAMBERTSSON 1998 Down). For example, both the rapid extension of sensory bristles and gametogenesis are dependent on the precise synthesis of necessary proteins. Placed in this context, there is significant overlap between the phenotypes we observe in sbr mutants and the Minute mutations. While sbr does not appear to be haploinsufficient, we have shown that sbr loss-of-function mutants have smaller and thinner bristles and are defective in the development of the female germline. Other alleles of sbr have defects in spermatogenesis and decreased viability (sbr17, DYBAS et al. 1983 Down). This framework may explain the defects we see both in the embryo and the adult.

The development of the bristle is thought to require a rapid synthesis of proteins (MITCHELL et al. 1977 Down). The hypomorphic sbr1 allele permitted us to examine the effect of stronger sbr alleles in the adult. The loss of ridging and significantly reduced length in sbr mutants is consistent with a defect in the bristle cell actin cytoskeleton, while the decreased diameter of the bristles may indicate a decrease in the number of microtubules (TILNEY et al. 2000 Down). A defect in the export of actin, tubulin, and other required mRNAs could reduce the available pool of these proteins, thereby decreasing the bristle cells' ability to initiate and rapidly extend. Furthermore, we see gross defects only in the larger macrochaetes, while the much smaller microchaetes appear relatively normal. Although they are different in size (250 µm compared to 70 µm), they develop over the same period of time, indicating that macrochaetes grow at a significantly greater rate (TILNEY et al. 2000 Down). Consistent with their larger size, macrochaetes also have more actin bundles (16–25 bundles vs. 7–11 bundles in microchaetes) with each bundle containing more actin filaments (TILNEY et al. 2000 Down). Taken together this suggests that macrochaetes require a greater rate of protein synthesis and polymer assembly during development, possibly sensitizing them to a loss of essential mRNAs.

Similar to bristle cells, muscle cells also require large amounts of protein to construct a fully functional contractile apparatus. The cytoplasm of a fully developed muscle is filled with actin, myosin, and other supporting structural proteins. To address the genetic requirements of a developing muscle, several laboratories have done dominant flightless screens (MOGAMI and HOTTA 1981 Down; CRIPPS et al. 1994 Down). These screens have shown that mutations in myosin and actin are haploinsufficient for the correct development of the adult indirect flight muscles. Several of the recovered mutations are loss-of-function alleles (MOGAMI et al. 1986 Down; CRIPPS et al. 1994 Down), suggesting that development of these muscles is sensitive to gene dose. Although these mutations do not appear to be haploinsufficient in the embryo (MOGAMI et al. 1986 Down), the requirement for these proteins in the embryonic musculature is likely to be the same. We showed that zygotic mutations in sbr produce morphological defects in the body wall muscles that are similar to those reported in muscle protein loss-of-function mutants (i.e., MSP-300, ROSENBERG-HASSON et al. 1996 Down; Laminin, VOLK and YARNITZKY 1995 Down; and Tiggrin, BUNCH et al. 1998 Down). The defects we observe are consistent with a failure to develop a structurally sound contractile apparatus and insertion site. Supportive of this hypothesis, we show a failure to properly distribute myosin throughout the muscle cytoplasm. Similar to the bristle extension defect, this phenotype is consistent with a decrease in the available protein pools as a result of defective mRNA export from the nucleus to the cytoplasm.

The defects in morphology of the muscles as well as the possible decrease in relevant muscle-derived guidance factors could be the cause of the misdirected motor axons. This is seen in abrupt embryos, where ISNb pathfinding errors and a low frequency of muscle insertion site pullouts are observed. Abrupt's identity as a muscle-expressed zinc finger protein that potentially functions as a transcription factor suggests that the loss of certain muscle proteins can produce both axon and muscle defects (HU et al. 1995 Down). However, this would not explain the axon pathway defects we observe in the developing embryonic CNS.

As with muscles, a general decrease in specific guidance molecules in the developing embryo could impair growth cone navigation. However, it also could disrupt the machinery required to drive the growth cone forward. Treating growth cones with drugs that disrupt the actin cytoskeleton disrupts the structure of the growth cone and causes navigational errors in vivo (BENTLEY and TOROIAN-RAYMOND 1986 Down; CHIEN et al. 1993 Down; KAUFMANN et al. 1998 Down). In the Drosophila embryo, injection of cytochalasin at low doses where motility is preserved produces bypass phenotypes similar to those observed in sbr mutants (KAUFMANN et al. 1998 Down). Thus, the axon pathway defects in sbr mutants may reflect a partial decrease in actin assembly due to a reduced supply of certain key components.

Work on neurites in vitro has shown that actin mRNA is transported along axons in particles to the growth cone (BASSELL et al. 1998 Down). Furthermore, application of neurotrophin to growth cones in vitro produces an increase in actin polymerization at the leading edge as well as the localization of actin mRNA to the growth cone (ZHANG et al. 1999 Down). Consistent with a functional role for localization, inhibition of actin mRNA localization to the leading edge of chicken embryonic fibroblasts reduces the rate of cell motility (KISLAUSKIS et al. 1997 Down). On the basis of these data, a model is forming that suggests maximum rates of motility and directed outgrowth in neurons may require the localization of actin mRNA and local translation of actin protein within the growth cone (ZHANG et al. 1999 Down). Thus, a decrease in mRNA export in sbr mutants may not decrease only the available pool of actin monomers at the growth cone; it may also decrease the presence of actin mRNA available for local synthesis during pathfinding, which could significantly impair the growth cone's directed motility.


*  ACKNOWLEDGMENTS

We thank Andrea Herold and Elisa Izaurralde for communicating unpublished data and commenting on our manuscript. We also thank Igor Zhimulev for genomic phage clones and fly lines, William Fowle for technical assistance with SEM, and the members of the Van Vactor and Flanagan Labs for helpful discussions at all stages of this work. This work was supported by a National Institutes of Mental Health Predoctoral NRSA (C.A.K.), National Institutes of Health grants NS40043 and NS35909, a Wellcome Trust career development fellowship (I.D.), a Lister Institute senior fellowship (I.D.), and an MRC studentship (G.S.W.). C.A.K. was a National Science Foundation predoctoral fellow and D.V.V. is a Leukemia and Lymphoma Society scholar.

Manuscript received July 12, 2001; Accepted for publication October 1, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BACHI, A., I. C. BRAUN, J. P. RODRIGUES, N. PANTÈ, and K. RIBBECK et al., 2000  The C-terminal domain of TAP interacts with the nuclear pore complex and promotes export of specific CTE-bearing RNA substrates. RNA 6:136-158[Abstract].

BASSELL, G. J., H. ZHANG, A. L. BYRD, A. M. FEMINO, and R. SINGER et al., 1998  Sorting of ß-actin mRNA and protein to neurites and growth cones in culture. J. Neurosci. 18:251-265[Abstract/Free Full Text].

BATE, M., 1990  The embryonic development of larval muscles in Drosophila. Development 110:791-804[Abstract/Free Full Text].

BATE, M. and K. BROADIE, 1995  Wiring by fly: the neuromuscular system of the Drosophila embryo. Neuron 15:513-525[Medline].

BATEMAN, J., H. SHU, and D. VAN VACTOR, 2000  The guanine nucleotide exchange factor trio mediates axonal development in the Drosophila embryo. Neuron 26:93-106[Medline].

BEAR, J., W. TAN, A. S. ZOLOTUKHIN, C. TABERNERO, and E. A. HUDSON et al., 1999  Identification of novel import and export signals of human TAP, the protein that binds to the CTE element of the type D retrovirus mRNAs. Mol. Cell. Biol. 19:6306-6317[Abstract/Free Full Text].

BENTLEY, D. and A. TOROIAN-RAYMOND, 1986  Disoriented pathfinding by pioneer neurone growth cones deprived of filopodia by cytochalasin treatment. Nature 323:712-715[Medline].

BRAUN, I. C., A. HEROLD, M. RODE, E. CONTI, and E. IZAURRALDE, 2001  Overexpression of TAP/p15 heterodimers bypasses nuclear retention and stimulates nuclear mRNA export. J. Biol. Chem. 276:20536-20543[Abstract/Free Full Text].

BRAY, M., S. PRASAD, J. W. DUBAY, E. HUNTER, and K.-T. JEANG et al., 1994  A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc. Natl. Acad. Sci. USA 91:1256-1260[Abstract/Free Full Text].

BUNCH, T. A., M. W. GRANER, L. I. FESSLER, J. H. FESSLER, and K. D. SCHNEIDER et al., 1998  The PS2 integrin ligand tiggrin is required for proper muscle function in Drosophila. Development 125:1679-1689[Abstract].

CHIEN, C. B., D. E. ROSENTHAL, W. A. HARRIS, and C. E. HOLT, 1993  Navigational errors made by growth cones without filopodia in the embryonic Xenopus brain. Neuron 11:237-251[Medline].

CRIPPS, R. M., E. BALL, M. STARK, A. LAWN, and J. C. SPARROW, 1994  Recovery of dominant, autosomal flightless mutants of Drosophila melanogaster and identification of a new gene required for normal muscle structure and function. Genetics 137:151-164[Abstract].

DYBAS, L. K., K. K. HARDEN, J. L. MACHNICKI, and B. W. GEER, 1983  Male fertility in Drosophila melanogaster: lesions of spermatogenesis associated with male sterile mutations of the vermilion region. J. Exp. Zool. 226:293-302.

GRÜTER, P., C. TABERNERO, C. VON KOBBE, C. SCHMITT, and C. SAAVEDRA et al., 1998  TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol. Cell 1:649-659[Medline].

HEROLD, A., M. SUYAMA, J. P. RODRIGUES, I. C. BRAUN, and U. KUTAY et al., 2000  TAP (NXF1) belongs to a multigene family of putative RNA export factors with a conserved modular architecture. Mol. Cell. Biol. 20:8996-9008[Abstract/Free Full Text].

HOANG, B. and A. CHIBA, 1998  Genetic analysis on the role of Integrin during axon guidance in Drosophila. J. Neurosci. 18:7847-7855[Abstract/Free Full Text].

HU, S., D. FAMBROUGH, J. R. ATASHI, C. S. GOODMAN, and S. T. CREWS, 1995  The Drosophila abrupt gene encodes a BTB-zinc finger regulatory protein that controls the specificity of neuromuscular connections. Genes Dev. 9:2936-2948[Abstract/Free Full Text].

HURT, E., K. STRABER, A. SEGREF, S. BAILER, and N. SCHLAICH et al., 2000  Mex67p mediates nuclear export of a variety of RNA polymerase II transcripts. J. Biol. Chem. 275:8361-8368[Abstract/Free Full Text].

KATAHIRA, J., K. STRABER, A. PODTELEJNIKOV, M. MANN, and J. U. JUNG et al., 1999  The Mex67p-mediated nuclear mRNA export is conserved from yeast to human. EMBO J. 18:2593-2609[Medline].

KAUFMANN, N., Z. P. WILLS, and D. VAN VACTOR, 1998  Drosophila Rac1 controls motor axon guidance. Development 125:453-461[Abstract].

KIEHART, D. P. and R. FEGHALI, 1986  Cytoplasmic myosin from Drosophila melanogaster. J. Cell Biol. 103:1517-1525[Abstract/Free Full Text].

KISLAUSKIS, E. H., X.-C. ZHU, and R. H. SINGER, 1997  ß-Actin messenger RNA localization and protein synthesis augment cell motility. J. Cell Biol. 136:1263-1270[Abstract/Free Full Text].

KOREY, C., C. BASCOM-SLACK, D. SCALICE, B. PERCIVAL and D. VAN VACTOR, 1997 X-chromosome genes provide further insight into embryonic motor axon guidance (Abstr). Soc. Neurosci.

KOZLOVA, T. Y., V. F. SEMESHIN, I. V. TRETYAKOVA, E. B. KOKOZA, and V. PIRROTTA et al., 1994  Molecular and cytogenetical characterization of the 10A1–2 band and adjoining region in the Drosophila melanogaster polytene X chromosome. Genetics 136:1063-1073[Abstract].

LAMBERTSSON, A., 1998  The Minute genes in Drosophila and their molecular functions. Adv. Genet. 38:69-134[Medline].

LIKER, E., E. FERNANDEZ, E. IZAURRALDE, and E. CONTI, 2000  The structure of the mRNA export factor TAP reveals a cis arrangement of a non-canonical RNP domain and an LRR domain. EMBO J. 19:5587-5598[Medline].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.

MITCHELL, H. K., L. S. LIPPS, and U. M. TRACEY, 1977  Transcriptional changes in pupal hypoderm in Drosophila melanogaster. Biochem. Genet. 15:575-587[Medline].

MOGAMI, K. and Y. HOTTA, 1981  Isolation of Drosophila flightless mutants which affect myofibrillar proteins of insect flight muscle. Mol. Gen. Genet. 183:409-417[Medline].

MOGAMI, K., P. T. O'DONNELL, S. I. BERNSTEIN, T. R. F. WRIGHT, and C. P. EMERSON, JR., 1986  Mutations of the Drosophila myosin heavy chain gene: effects on transcription, myosin accumulation and muscle function. Proc. Natl. Acad. Sci. USA 83:1393-1397[Abstract/Free Full Text].

PASQUINELLI, A. E., R. K. ERNST, E. LUND, C. GRIMM, and M. L. ZAPP et al., 1997  The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 16:7500-7510[Medline].

PATEL, N. H., B. G. CONDRON, and K. ZINN, 1994  Pair-rule expression patterns of even-skipped are found in both short- and long-germ beetles. Nature 367:429-434[Medline].

ROSENBERG-HASSON, Y., M. RENERT-PASCA, and T. VOLK, 1996  A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis. Mech. Dev. 65:83-94.

SAAVEDRA, C., B. FELBER, and E. IZAURRALDE, 1997  The simian retrovirus-1 constitutive transport element, unlike the HIV-1 RRE, uses factors required for cellular mRNA export. Curr. Biol. 7:619-628[Medline].

SANTOS-ROSA, H., H. MORENO, G. SIMOS, A. SEGREF, and B. FAHRENKROG et al., 1998  Nuclear mRNA export requires complex formation between Mex67p and Mtr2p at the nuclear pores. Mol. Cell. Biol. 18:6826-6838[Abstract/Free Full Text].

SEARLES, L. L., R. S. RUTH, A.-M. PRET, R. A. FRIDELL, and A. J. ALI, 1990  Structure and transcription of the Drosophila melanogaster vermilion gene and several mutant alleles. Mol. Cell. Biol. 10:1423-1433[Abstract/Free Full Text].

SEGREF, A., K. SHARMA, V. DOYE, A. HELLWIG, and J. HUBER et al., 1997  Mex67p, a novel factor for nuclear mRNA export, binds to both poly (A)+ RNA and nuclear pores. EMBO J. 16:3256-3271[Medline].

SIMPSON, P., R. WOEHL, and K. USUI, 1999  The development and evolution of bristle patterns in Diptera. Development 126:1349-1364[Abstract].

STRÄSSER, K. and E. HURT, 2000  Yra1p, a conserved nuclear RNA-binding protein, interacts directly with Mex67p and is required for mRNA export. EMBO J. 19:410-420[Medline].

STRÄSSER, K., J. BASSLER, and E. HURT, 2000  Binding of Mex67p/Mtr2p heterodimer to FXFG, GLFG, and FG repeat nucleoporins is essential for nuclear mRNA export. J. Cell Biol. 150:695-706[Abstract/Free Full Text].

STUTZ, F., A. BACHI, T. DOERKS, I. C. BRAUN, and B. SÈRAPHIN et al., 2000  REF, an evolutionarily conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA 6:638-650[Abstract].

SUYAMA, M., T. DOERKS, I. C. BRAUN, M. SATTLER, and E. IZAURRALDE et al., 2000  Prediction of structural domains of TAP reveals details of its interaction with p15 and nucleoporins. EMBO Rep. 1:53-58[Medline].

TABERNERO, C., A. S. ZOLOTUKHIN, A VALENTIN, G. N. PAVLAKIS, and B. K. FELBER, 1996  The posttranscriptional control element of the Simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J. Virol. 70:5998-6011[Abstract].

TAN, W., A. S. ZOLOTUKHIN, J. BEAR, D. J. PATENAUDE, and B. K. FELBER, 2000  The mRNA export in Caenorhabditis elegans is mediated by Ce-NXF-1, an ortholog of human TAP/NXF and Saccharomyces cerevisiae Mex67p. RNA 6:1762-1772[Abstract].

TILNEY, L. G., P. CONNELLY, S. SMITH, and G. M. GUILD, 1996  F-actin bundles in Drosophila bristles are assembled from modules composed of short actin filaments. J. Cell Biol. 135:1291-1308[Abstract/Free Full Text].

TILNEY, L. G., P. S. CONNELLY, K. A. VRANICH, M. K. SHAW, and G. M. GUILD, 2000  Regulation of actin filament cross-linking and bundle shape in Drosophila bristles. J. Cell Biol. 148:87-99[Abstract/Free Full Text].

VAN DER BLIEK, A. M. and E. M. MEYEROWITZ, 1991  Dynamin-like protein encoded by the Drosophila shibire gene associated with vesicular traffic. Nature 351:411-414[Medline].

VAN VACTOR, D., and C. KOPCZYNSKI, 1999 Anatomical techniques for analysis of nervous system development in the Drosophila embryo, pp. 490–513 in A Comparative Methods Approach to the Study of Oocytes and Embryos, edited by J. RICHTER. Oxford University Press, New York.

VAN VACTOR, D., H. SINK, D. FAMBROUGH, R. TSOO, and C. S. GOODMAN, 1993  Genes that control neuromuscular specificity in Drosophila. Cell 73:1137-1153[Medline].

VOLK, T. and T. YARNITZKY, 1995  Laminin is required for heart, somatic muscles, and gut development in the Drosophila embryo. Dev. Biol. 169:609-618[Medline].

ZHANG, H. L., R. H. SINGER, and G. J. BASSELL, 1999  Neurotrophin regulation of ß-actin mRNA and protein localization within growth cones. J. Cell Biol. 147:59-70[Abstract/Free Full Text].

ZHIMULEV, I. F., V. F. SEMESHIN, and E. S. BELYAEVA, 1981a  Fine cytogenetical analysis of the band 10A1–2 and the adjoining regions in the Drosophila melanogaster X Chromosome. I. Cytology of the region and mapping of chromosome rearrangements. Chromosoma 82:9-23[Medline].

ZHIMULEV, I. F., A. V. POKHOLKOVA, V. F. BGATOV, V. F. SEMESHIN, and E. S. BELYAEVA, 1981b  Fine cytogenetical analysis of the band 10A1–2 and the adjoining regions in the Drosophila melanogaster X Chromosome. II. Genetical analysis. Chromosoma 82:25-40[Medline].




This article has been cited by other articles:


Home page
DMMHome page
J. A. Hurt and P. A. Silver
mRNA nuclear export and human disease
Dis. Model. Mech., September 1, 2008; 1(2-3): 103 - 108.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. F. Satterfield, S. M. Jackson, and L. J. Pallanck
A Drosophila Homolog of the Polyglutamine Disease Gene SCA2 Is a Dosage-Sensitive Regulator of Actin Filament Formation
Genetics, December 1, 2002; 162(4): 1687 - 1702.
[Abstract] [Full Text] [PDF]