- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hofmann, A. F.
- Articles by Harris, S. D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hofmann, A. F.
- Articles by Harris, S. D.
The Aspergillus nidulans musN Gene Encodes a RecQ Helicase That Interacts With the PI-3K-Related Kinase UVSB
Amy F. Hofmanna and Steven D. Harrisa,ba Department of Microbiology, University of Connecticut Health Center, Farmington, Connecticut 06030-3205
b Plant Science Initiative, University of Nebraska, Lincoln, Nebraska 68588-0660
Corresponding author: Steven D. Harris, Plant Science Initiative, University of Nebraska, Lincoln, NE 68588-0660., sharri1{at}unlnotes.unl.edu (E-mail)
Communicating editor: J. J. LOROS
| ABSTRACT |
|---|
In Aspergillus nidulans, the uvsB gene encodes a member of the PI-3K-related kinase family of proteins. We have recently shown that UVSB is required for multiple aspects of the DNA damage response. Since the musN227 mutation is capable of partially suppressing defects caused by uvsB mutations, we sought to understand the mechanism underlying the suppression by cloning the musN gene. Here, we report that musN encodes a RecQ helicase with homology to S. pombe rqh1, S. cerevisiae sgs1, and human BLM and WRN. Phenotypic characterization of musN mutant alleles reveals that MUSN participates in the response to a variety of genotoxic agents. The slow growth and genotoxin sensitivity of a musN null mutant can be partially suppressed by a defect in homologous recombination caused by the uvsC114 mutation. In addition, we present evidence suggesting that MUSN may promote recovery from the DNA damage response. We suggest that a block to recovery caused by the musN227 mutation, coupled with the modest accumulation of recombination intermediates, can suppress defects caused by uvsB mutations. Finally, we report that another RecQ helicase, ORQA, performs a function that partially overlaps that of MUSN.
CELL cycle checkpoints play an integral role in the maintenance of genome integrity. During the past decade, research in yeasts and humans has revealed that cell cycle checkpoints function at the G1/S transition, the G2/M transition, and during S phase to prevent potentially catastrophic attempts to replicate or segregate damaged or incompletely replicated DNA (reviewed by ![]()
![]()
![]()
![]()
![]()
The A. nidulans musN227 and musP234 mutations were isolated in a screen for mutants sensitive to the alkylating agent methyl methanesulfonate (MMS; ![]()
![]()
![]()
Here, we demonstrate that MUSN is a member of the RecQ family of DNA helicases that have been implicated in maintenance of genome integrity. Our results indicate that MUSN is involved in the response to both DNA damage and incomplete replication. Deletion of musN results in more severe genotoxin hypersensitivity compared to musN227, indicating that musN227 is a hypomorphic mutation. The slow growth and genotoxin sensitivity of a musN null mutant can be partially suppressed by a reduction in homologous recombination caused by the uvsC114 mutation. We suggest that MUSN, like the other RecQ helicases, may be involved in preventing promiscuous recombination. Moreover, on the basis of our analysis of septation in musN mutants, we propose that MUSN promotes recovery from the DDR. Accordingly, the suppression of uvsB mutants by musN227 may be related to the involvement of MUSN in promoting recovery from the DDR by regulating recombination. Furthermore, we indicate that, unlike S. cerevisiae and S. pombe, which possess only a single RecQ helicase, A. nidulans possesses a second family member (orqA; ![]()
| MATERIALS AND METHODS |
|---|
Strains, media, and growth conditions:
The following strains were used to carry out this study: AAH13 (musP234; pyrG89 yA2), AAH14 (
uvsB; pyrG89 yA2), AAH16 (
musN; pabaA1 yA2), AAH17 (
uvsB; musN227; yA2), AAH18 (uvsB110;
musN; yA2), AAH19 (uvsB110;
musN; yA2), AAH22 (pabaA1 yA2 pyrG89; Pyr+ [pRGAMA1]), AAH23 (pabaA1 yA2 pyrG89; Pyr+ [pAH22]), AAH27 (uvsB110; pabaA1 yA2 pyrG89; Pyr+ [pRGAMA1]), AAH28 (uvsB110; pabaA1 yA2 pyrG89; Pyr+ [pAH22]), AAH31 (musP234; pyrG89 yA2; Pyr+ [pRGAMA1]), AAH32 (musP234; pyrG89 yA2; Pyr+ [pAH22]), AAS211 (musN227; pyrG89; chaA1), AAS315 (uvsB110; musN227; pabaA1; acrA1; actA1; riboB2 chaA1), AML8 (pyrG89 pabaA1; argB2; yA2), ASH162 (pyrG89 pabaA1 yA2), ASH201 (uvsB110; chaA1), ASH270 (uvsB110; pyrG89 pabaA1 yA2), ASH383 (musN227; chaA1), ASH581 (
musN; uvsC114; yA2), ASH582, (
musN; uvsC114; wA2), ASH583 (
musN; uvsC114; yA2), ASH587 (
musN; wA2), and ASH588 (
musN; wA2). ASH581ASH588 may contain additional markers.
The media used in this study were as described previously (![]()
![]()
musN double mutants were identified as a class of Pyr+ segregants with increased sensitivity to MMS compared to uvsB110 mutants.
musNuvsC114 double mutants were identified as a class of Pyr+ segregants with decreased sensitivity to hydroxyurea (HU) and MMS compared to the
musN mutant. The genotypes of all double mutants were confirmed by backcrosses to wild type.
Cloning of the musN gene:
Strain AAS211 was transformed with a plasmid-based genomic library in the autonomously replicating, pyr-4-containing pRGAMA1 vector (![]()
![]()
![]()
Localization of the musN227 mutation:
Strain AAS211 was transformed with various small, linear fragments of the wild-type musN gene (EcoRV, 4.2 kb; EcoRV, 3 kb; EcoRV, 2.5 kb; EcoRV, 1.8 kb; EcoRV/HindIII, 3 kb; EcoRV/HindIII, 2.5 kb; EcoRV/HindIII, 2 kb; and EcoRV/HindIII, 1.7 kb). Transformants were recovered at 32° on MNV containing 0.01% MMS. The smallest fragment capable of producing MMS-resistant colonies was determined to be the 1.7-kb EcoRV/HindIII fragment. Total RNA was isolated from wild type and musN227 strains as described previously (![]()
Construction of the
musN strain:
To generate the musN replacement, the pAH49 plasmid was constructed as follows: Plasmid pAH1, which contains the entire musN gene, was digested with ClaI to remove a 2.4-kb fragment of the coding sequence. The remaining ClaI fragment, containing vector sequences and flanking musN sequences, was ligated to a 2-kb ClaI-digested PCR fragment of the Neurospora crassa pyr-4 gene. This pyr-4 fragment was generated using the primers oAH37 (5' CCATCGATCTCCTTACGCATCTGTGCGG 3') and oAH38 (5' CCATCGATGCATCAGAGCAGATTGTACTG 3') and the pyr-4-containing pRG3 plasmid as template. This construct was transformed into the wild-type strain ASH162. Pyr+ transformants were selected on MNV and subsequently tested for sensitivity to various concentrations of MMS and HU. Genomic DNA from transformants of interest was analyzed by Southern analysis to confirm that the desired double crossover integration had occurred.
Overexpression of musN:
pRGAMA1 and pAH22 were transformed into strains ASH162, ASH270, and AAH13. ASH162 and ASH270 transformants were selected on MNV at 32°. Transformants were tested for sensitivity to MMS and HU. Transformants that received the pRGAMA1 plasmid served as a control to which the sensitivities of all other transformants were compared. AAH13 transformants were selected on MNV at 32° and tested for sensitivity to 0.015% MMS. AAH13 transformants were then struck on 5-FOA to force loss of the plasmid. Single FOA-resistant colonies were then retested on 0.015% MMS for sensitivity.
Viability assays:
All viability assays were performed as previously described (![]()
Microscopy:
Conidiospores were grown, fixed, and stained on coverslips as previously described (![]()
![]()
![]()
![]()
orqA constructs and transformations:
Using the published sequence for recQ, primers oAH43 (5' GATGGCCTGGAGAGCCTATC 3') and oAH44 (5' CTGCTGTTAGCTCATCAGGTC 3') were designed to amplify the gene. PCR was performed on pools of cosmids from each A. nidulans chromosome (![]()
The musN sequence can be found at GenBank, accession no.
AF259396. The sequence that we refer to in this article as orqA has been previously described as recQ (![]()
![]()
| RESULTS |
|---|
musN encodes a RecQ helicase:
A screen of a plasmid-based genomic library (![]()
![]()
|
|
To verify that we had cloned the bona fide musN gene, and to determine the nature of the musN227 mutation, we transformed small, linear fragments of the gene into strain AAS211 and assessed their ability to repair the musN227 mutation. We identified a 1.7-kb EcoRV/HindIII fragment that generated MMS-resistant transformants at low frequency, indicating that this fragment had likely repaired the musN227 mutation via a gene conversion event. Comparison of RT-PCR products generated from this region of wild-type and musN227 strains revealed a missing thymine residue in musN227 just following the helicase domain. Deletion of this thymine residue results in a frameshift that introduces a stop codon after 26 amino acids (Fig 1A). Thus, the musN227 mutation generates a truncated protein that retains the entire helicase domain, but is missing
27% of the protein at the carboxy terminus.
The musN null mutant has a more severe phenotype than musN227:
The phenotype of the musN227 mutant is relatively modest compared to those caused by mutations in other RecQ helicases. Accordingly, to test the possibility that the musN227 mutation does not represent the null phenotype, we created a strain containing a gene replacement. A plasmid was constructed in which
50% of the musN coding sequence was deleted and replaced with the N. crassa pyr-4 gene as a selectable marker. The region deleted includes all of the conserved helicase domains, with the exception of domain VI (Fig 1A). Transformation of a wild-type strain with this plasmid generated the desired replacement strain as confirmed by Southern analysis and PCR. Phenotypic characterization revealed that
musN has a more severe phenotype than musN227.
musN displays much greater sensitivity to MMS and bleomycin compared to musN227 (Fig 2A and Fig B). Unlike musN227, the
musN allele also causes sensitivity to HU and UV irradiation (Fig 2A and Fig B). In addition,
musN displays slower growth and poorer conidiation when compared to either wild type or musN227 (Fig 2B). We have also noted that conidiospore polarization is delayed in
musN mutants compared to wild type (data not shown).
|
The slow growth of the
musN mutant could conceivably be caused by defects in cell cycle progression. In S. cerevisiae, sgs1srs2 double mutants arrest during mitosis as large, budded cells (![]()
5' helicase that displays partial overlap in function with Sgs1p; ![]()
![]()
musN mutants and found that there was a severe delay compared to wild type (Fig 3). In fact,
musN divides with kinetics similar to that of wild type grown in the presence of the genotoxic agent diepoxyoctane (DEO). A comparison of the CMI in wild type vs.
musN revealed a similar percentage of mitotic nuclei in both populations of cells (4%; n = 200). This suggests that mitotic progression is not affected by the
musN mutation. Instead,
musN mutants are presumably delayed in progression through S phase or G2. Since the
musN phenotype is more severe than that caused by the musN227 mutation, we conclude that the musN227 gene product is partially functional.
|
musN does not suppress uvsB110:
Since
musN is a much stronger allele than musN227, we reasoned that it might also be a stronger suppressor of uvsB110. To address this possibility, we generated a uvsB110
musN double mutant. Phenotypic analysis revealed that the double mutant exhibited increased sensitivity to MMS and HU compared to either single mutant (data not shown). Thus, instead of acting as a suppressor,
musN enhances the defects caused by the uvsB110 mutation. Furthermore, this observation implies that the suppression of uvsB110 may be dependent on some function of the truncated musN227 protein. We also noted that the uvsB110
musN double mutant exhibits a phenotype similar to the
musN mutant with respect to its nuclear division kinetics and septation in response to DNA damage (data not shown), which suggests that the defects caused by
musN are not caused by activation of the DNA damage checkpoint.
A defect in homologous recombination partially rescues the genotoxin sensitivity of
musN:
The A. nidulans uvsC gene encodes a RecA-like protein homologous to Rad51p from S. cerevisiae (![]()
![]()
srs2
sgs1 double mutants (![]()
musN mutants, we constructed a
musNuvsC114 double mutant. Phenotypic analysis revealed that the double mutant was significantly less sensitive to MMS and HU than
musN (Fig 4). Furthermore, whereas 90% of
musN germlings arrested with one nucleus in the presence of 5 mM HU, 82% of
musNuvsC114 double mutants recovered and completed nuclear division (as did 83% of wild-type spores). These observations suggest that the slow growth and genotoxin sensitivity of the
musN mutant are caused by the accumulation of recombination intermediates.
|
Septation is delayed in musN227 mutants exposed to DNA damage:
Since inhibition of septation is one of the effects triggered by activation of the DDR, we have used the percentage of septated hyphae in a population to measure the ability of a strain to recover and resume proliferation. After a prolonged exposure to DNA damage, wild-type hyphae eventually resume nuclear division and form septa (Table 2). In contrast, under identical conditions, fewer musN227 hyphae underwent septum formation (Table 2). Notably, the musN227 hyphae were longer than identically treated wild-type hyphae [average hyphal length (in micrometers): 108 ± 33 for wild type (n = 32) and 213 ± 56 for musN227 (n = 42)] and had accumulated the same number of nuclei (modal average = 8), suggesting that the effect on septation was most likely not due to a general physiological defect. Furthermore, since uvsB110musN227 double mutants also fail to undergo septation under these conditions, the inability of musN227 mutants to septate following exposure to genotoxic agents is not caused by activation of the DNA damage checkpoint (![]()
|
Increased expression of musN enhances the genotoxin sensitivity of both wild-type and uvsB110 mutants:
If MUSN is involved in promoting recovery from the DDR, increasing its expression may cause sensitivity to DNA-damaging agents by terminating the response before the completion of DNA repair. To determine if presence of additional copies of musN had any affect on MMS sensitivity, a plasmid containing musN on the autonomously replicating pRGAMA1 vector was transformed into appropriately marked wild-type and uvsB110 strains. Both wild-type and uvsB110 transformants containing the musN plasmid exhibited a modest increase in sensitivity to MMS compared to control transformants containing the empty pRGAMA1 vector (Fig 5). Similarly, when tested for their response to HU, both sets of transformants were more sensitive (Fig 5). However, since the transformants were able to restrain septation in the presence of MMS or HU (data not shown), we conclude that neither the DNA damage nor replication checkpoints were abrogated. In contrast, overexpression of rqh1 in fission yeast causes a defect in the replication checkpoint, as cells exhibit premature segregation of chromosomes in the presence of HU (![]()
|
The two A. nidulans RecQ helicases may have overlapping functions:
A. nidulans possesses a second RecQ helicase that consists essentially of only the helicase domain and is more similar to human RecQL5 (Fig 1B; Table 1; ![]()
|
Expression of musN partially complements musP234:
Since the musN227 and musP234 mutants display similar phenotypes, including the ability to suppress uvsB mutations (![]()
|
Since the musN and musP genes appear to control related functions, and orqA encodes a RecQ helicase whose function may overlap with that of musN, we tested the possibility that musP234 may be a mutation in orqA. However, transformation of musP234 mutants with orqA on an autonomously replicating plasmid did not result in complementation. In addition, we were able to amplify the orqA gene from a musP234 strain as a single, intact PCR product of the appropriate size. Since the musP234 mutation is presumably caused by a translocation breakpoint (![]()
| DISCUSSION |
|---|
A. nidulans possesses multiple RecQ helicases:
We have shown here that MUSN is a member of the RecQ family of DNA helicases. It possesses several features characteristic of RecQ helicases (![]()
Surprisingly, A. nidulans possesses a second RecQ helicase, ORQA, that consists of the seven conserved helicase motifs flanked by short N-terminal and C-terminal extensions (![]()
![]()
![]()
The yeast RecQ helicases Sgs1p and Rqh1p appear to function in several aspects of chromosomal DNA metabolism (![]()
![]()
![]()
![]()
The role of MUSN in the DNA damage response:
The sensitivity of the
musN mutant to a diverse range of DNA-damaging agents implies that MUSN performs a critical function during the DNA damage response. We have previously reported that septum formation is an accurate readout for the status of the DNA damage response in A. nidulans (![]()
![]()
![]()
![]()
![]()
![]()
The sensitivity of the
musN mutant to several DNA-damaging agents is suppressed by a mutation in uvsC, which encodes a Rad51 ortholog required for homologous recombination (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Homologous recombination is a preferred mechanism for the repair of double-strand breaks (DSBs; ![]()
![]()
![]()
![]()
![]()
![]()
In addition to its role in the DNA damage response, the HU sensitivity of the
musN mutant suggests that MUSN is required when DNA replication is perturbed. In S. cerevisiae, Sgs1p appears to perform a critical signaling function in the response to stalled replication forks (![]()
musN mutant does not septate in the presence of low concentrations of HU (data not shown) suggests that the S phase checkpoint is intact. In contrast, checkpoint mutants such as uvsB, uvsD, and sntA form septa under similar conditions (![]()
![]()
![]()
![]()
![]()
![]()
Suppression of uvsB defects by the musN227 mutation:
The ability of the musN227 mutation to suppress the genotoxin sensitivity of uvsB and uvsD mutants initially suggested that suppression was caused by inactivation of a pathway that normally antagonizes the functions(s) of UVSB and UVSD (![]()
![]()
Understanding the basis of the genetic interaction between uvsB and musN is further complicated by the observation that the
musN mutation does not suppress, but instead enhances, the sensitivity of uvsB mutants to MMS and HU. Accordingly, since musN227 appears to be a hypomorphic mutation, we suggest that MUSN function can be compromised only to a certain extent to allow suppression of uvsB defects. For example, a modest decrease in MUSN function (i.e., musN227) may suppress uvsB mutations by causing a small increase in the number of Holliday junctions, but a more severe decrease in function (i.e.,
musN) may trigger a potentially lethal increase in promiscuous recombination.
We propose two related models to explain the suppression of uvsB defects by the musN227 mutation. In the first model, suppression is an indirect effect of a block to recovery. By prolonging the DNA damage response, the musN227 mutation could allow more time for the repair of potentially lethal genotoxic damage. Indeed, since the level of homologous recombination associated with crossing over is elevated in musN227 mutants (![]()
![]()
![]()
Our observation that a mutation in a RecQ helicase partially suppresses the growth defects and genotoxin sensitivity of an ATM homolog may have clinical relevance. For example, mutations in human RecQ helicases such as BLM, WRN, or RecQL5 could serve as phenotypic modifiers (![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Greg May for providing the pRG3-AMA genomic library. We also thank Peter Kraus and Tom Wolkow for providing helpful comments that improved this manuscript. This work was supported by awards from the A-T Children's Project and the American Cancer Society (RPG-99-214-01-MBC).
Manuscript received June 18, 2001; Accepted for publication October 1, 2001.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
APPLEYARD, M. V., W. L. MCPHEAT, and M. J. STARK, 2000 A recQ family DNA helicase gene from Aspergillus nidulans. DNA Seq. 11:315-319[Medline].
BASHKIROV, V. I., J. S. KING, E. V. BASHKIROVA, J. SCHMUCKLI-MAURER, and W. D. HEYER, 2000 DNA repair protein Rad55 is a terminal substrate of the DNA damage checkpoints. Mol. Cell. Biol. 20:4393-4404
BRODY, H., J. GRIFFITH, A. J. CUTICCHIA, J. ARNOLD, and W. E. TIMBERLAKE, 1991 Chromosome-specific recombinant DNA libraries from the fungus Aspergillus nidulans. Nucleic Acids Res. 19:3105-3109
COGONI, C. and G. MACINO, 1999 Posttranscriptional gene silencing in Neurospora by a RecQ DNA helicase. Science 286:2342-2344
DAVEY, S., C. S. HAN, S. A. RAMER, J. C. KLASSEN, and A. JACOBSON et al., 1998 Fission yeast rad12+ regulates cell cycle checkpoint control and is homologous to the Bloom's syndrome disease gene. Mol. Cell. Biol. 18:2721-2728
ELLEDGE, S. J., 1996 Cell cycle checkpoints: preventing an identity crisis. Science 274:1664-1672
FITZGERALD, M. G., J. M. BEAN, S. R. HEGDE, H. UNSAL, and D. J. MACDONALD et al., 1997 Heterozygous ATM mutations do not contribute to early onset of breast cancer. Nat. Genet. 15:307-310[Medline].
FREI, C. and S. M. GASSER, 2000 RecQ-like helicases: the DNA replication checkpoint connection. J. Cell Sci. 113:2641-2646[Abstract].
GANGLOFF, S., C. SOUSTELLE, and F. FABRE, 2000 Homologous recombination is responsible for cell death in the absence of the Sgs1 and Srs2 helicases. Nat. Genet. 25:192-194[Medline].
HARMON, F. G. and S. C. KOWALCZYKOWSKI, 1998 RecQ helicase, in concert with RecA and SSB proteins, initiates and disrupts DNA recombination. Genes Dev. 12:1134-1144
HARRIS, S. D. and P. R. KRAUS, 1998 Regulation of septum formation in Aspergillus nidulans by a DNA damage checkpoint pathway. Genetics 148:1055-1067
HARRIS, S. D., J. L. MORRELL, and J. E. HAMER, 1994 Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136:517-532[Abstract].
HARTMAN, J. L. T., B. GARVIK, and L. HARTWELL, 2001 Principles for the buffering of genetic variation. Science 291:1001-1004
HOFMANN, A. F. and S. D. HARRIS, 2000 The Aspergillus nidulans uvsB gene encodes an ATM-related kinase required for multiple facets of the DNA damage response. Genetics 154:1577-1586
ICHIOKA, D., T. ITOH, and Y. ITOH, 2001 An Aspergillus nidulans uvsC null mutant is deficient in homologous DNA integration. Mol. Gen. Genet. 264:709-715[Medline].
KAFER, E. and S. K. CHAE, 1994 Phenotypic and epistatic grouping of hypo- and hyper-rec mus mutants in Aspergillus. Curr. Genet. 25:223-232[Medline].
KAFER, E., and G. MAY, 1998 Toward repair pathways in Aspergillus nidulans, pp. 477502 in DNA Damage and Repair: DNA Repair in Prokaryotes and Lower Eukaryotes, edited by J. A. NICKOLOFF and M. F. HOEKSTRA Humana Press, Totowa, NJ.
KAFER, E. and O. MAYOR, 1986 Genetic analysis of DNA repair in Aspergillus: evidence for different types of MMS-sensitive hyperrec mutants. Mutat. Res. 161:119-134[Medline].
KAROW, J. K., A. CONSTANTINOU, J. L. LI, S. C. WEST, and I. D. HICKSON, 2000a The Bloom's syndrome gene product promotes branch migration of Holliday junctions. Proc. Natl. Acad. Sci. USA 97:6504-6508
KAROW, J. K., L. WU, and I. D. HICKSON, 2000b RecQ family helicases: roles in cancer and aging. Curr. Opin. Genet. Dev. 10:32-38[Medline].
KIM, S. T., D. S. LIM, C. E. CANMAN, and M. B. KASTAN, 1999 Substrate specificities and identification of putative substrates of ATM kinase family members. J. Biol. Chem. 274:37538-37543
KRAUS, P. K. and S. D. HARRIS, 2001 The Aspergillus nidulans snt genes are required for the regulation of septum formation and cell cycle checkpoints. Genetics 159:557-569
MCVEY, M., M. KAEBERLEIN, H. A. TISSENBAUM, and L. GUARENTE, 2001 The short life span of Saccharomyces cerevisiae sgs1 and srs2 mutants is a composite of normal aging processes and mitotic arrest due to defective recombination. Genetics 157:1531-1542
MOHAGHEGH, P. and I. D. HICKSON, 2001 DNA helicase deficiencies associated with cancer predisposition and premature ageing disorders. Hum. Mol. Genet. 10:741-746
MYUNG, K., A. DATTA, C. CHEN, and R. D. KOLODNER, 2001 SGS1, the Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome instability and homeologous recombination. Nat. Genet. 27:113-116[Medline].
OAKLEY, B. O., and S. A. OSMANI, 1993 Cell-cycle analysis using the filamentous fungus Aspergillus nidulans, pp. 127142 in The Cell Cycle: A Practical Approach, edited by P. FANTES and R. BROOKS. IRL Press, Oxford.
OSHEROV, N. and G. MAY, 2000 Conidial germination in Aspergillus nidulans requires RAS signaling and protein synthesis. Genetics 155:647-656
PAQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404
PARAG, Y. and G. PARAG, 1975 Mutations affecting mitotic recombination frequency in haploids and diploids of the filamentous fungus Aspergillus nidulans. Mol. Gen. Genet. 137:109-123[Medline].
RHIND, N. and P. RUSSELL, 2000 Checkpoints: It takes more than time to heal some wounds. Curr. Biol. 10:R908-R911[Medline].
RONG, N. and H. L. KLEIN, 1993 Purification and characterization of the SRS2 DNA helicase of the yeast Saccharomyces cerevisiae. J. Biol. Chem. 268:1252-1259
SANCHEZ-ALONSO, P. and P. GUZMAN, 1998 Organization of chromosome ends in Ustilago maydis: RecQ-like helicase motifs at telomeric regions. Genetics 148:1043-1054
SAVITSKY, K., A. BAR-SHIRA, S. GILAD, G. ROTMAN, and Y. ZIV et al., 1995 A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science 268:1749-1753
STEWART, E., C. R. CHAPMAN, F. AL-KHODAIRY, A. M. CARR, and T. ENOCH, 1997 rqh1+, a fission yeast gene related to the Bloom's and Werner's syndrome genes, is required for reversible S phase arrest. EMBO J. 16:2682-2692[Medline].
SUNG, P., 1997 Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes Dev. 11:1111-1121
SWIFT, M., P. J. REITNAUER, D. MORRELL, and C. L. CHASE, 1987 Breast and other cancers in families with ataxia-telangiectasia. N. Engl. J. Med. 316:1289-1294[Abstract].
SWIFT, M., C. L. CHASE, and D. MORRELL, 1990 Cancer predisposition of ataxia-telangiectasia heterozygotes. Cancer Genet. Cytogenet. 46:21-27[Medline].
TATUSOVA, T. A. and T. L. MADDEN, 1999 BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174:247-250[Medline].
VAN HEEMST, D., K. SWART, E. F. HOLUB, R. VAN DIJK, and H. H. OFFENBERG et al., 1997 Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51. Mol. Gen. Genet. 254:654-664[Medline].
WANG, Y., D. CORTEZ, P. YAZDI, N. NEFF, and S. J. ELLEDGE et al., 2000 BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev. 14:927-939
WOLKOW, T. D., P. M. MIRABITO, S. VENKATRAM, and J. E. HAMER, 2000 Hypomorphic bimA(APC3) alleles cause errors in chromosome metabolism that activate the DNA damage checkpoint blocking cytokinesis in Aspergillus nidulans. Genetics 154:167-179
ZHAO, P. and E. KAFER, 1992 Effects of mutagen-sensitive mus mutations on spontaneous mitotic recombination in Aspergillus. Genetics 130:717-728[Abstract].
This article has been cited by other articles:
![]() |
I. Malavazi, C. P. Semighini, M. R. von Zeska Kress, S. D. Harris, and G. H. Goldman Regulation of Hyphal Morphogenesis and the DNA Damage Response by the Aspergillus nidulans ATM Homolog AtmA Genetics, May 1, 2006; 173(1): 99 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Gygax, C. P. Semighini, G. H. Goldman, and S. D. Harris SepBCTF4 Is Required for the Formation of DNA-Damage-Induced UvsCRAD51 Foci in Aspergillus nidulans Genetics, March 1, 2005; 169(3): 1391 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Hammond and N. P. Keller RNA Silencing in Aspergillus nidulans Is Independent of RNA-Dependent RNA Polymerases Genetics, February 1, 2005; 169(2): 607 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Z. K. Fagundes, L. Fernandes, M. Savoldi, S. D. Harris, M. H. S. Goldman, and G. H. Goldman Identification of a Topoisomerase I Mutant, scsA1, as an Extragenic Suppressor of a Mutation in scaANBS1, the Apparent Homolog of Human Nibrin in Aspergillus nidulans Genetics, July 1, 2003; 164(3): 935 - 945. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hofmann, A. F.
- Articles by Harris, S. D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hofmann, A. F.
- Articles by Harris, S. D.



; ASH383), and
; AAH16). (B) A total of 104 conidia from wild type (A28), musN227 (ASH383), and 
; A28), msuN227 (
; ASH383), and
; AAH16) strains.

; AAH27) and uvsB110 + pAH22 (
; AAH28).

