Overlapping Functions of the Saccharomyces cerevisiae Mre11, Exo1 and Rad27 Nucleases in DNA Metabolism

Corresponding author: Lorraine S. Symington, Department of Microbiology and Institute of Cancer Research, Columbia University, 701 W. 168th St., Rm. 916, New York, NY 10032., lss5{at}columbia.edu (E-mail)

Communicating editor: M. LICHTEN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

MRE11 functions in several aspects of DNA metabolism, including meiotic recombination, double-strand break repair, and telomere maintenance. Although the purified protein exhibits 3' to 5' exonuclease and endonuclease activities in vitro, Mre11 is implicated in the 5' to 3' resection of duplex ends in vivo. The mre11-H125N mutation, which eliminates the nuclease activities of Mre11, causes an accumulation of unprocessed double-strand breaks (DSBs) in meiosis, but no defect in processing HO-induced DSBs in mitotic cells, suggesting the existence of redundant activities. Mutation of EXO1, which encodes a 5' to 3' exonuclease, was found to increase the ionizing radiation sensitivity of both mre11 and mre11-H125N strains, but the exo1 mre11-H125N strain showed normal kinetics of mating-type switching and was more radiation resistant than the mre11 strain. This suggests that other nucleases can compensate for loss of the Exo1 and Mre11 nucleases, but not of the Mre11-Rad50-Xrs2 complex. Deletion of RAD27, which encodes a flap endonuclease, causes inviability in mre11 strains. When mre11-H125N was combined with the leaky rad27-6, the double mutants were viable and no more -ray sensitive than the mre11-H125N strain. This suggests that the double mutant defect is unlikely to be due to defective DSB processing.

DNA double-strand breaks (DSBs) are potentially lethal lesions that arise spontaneously during normal cellular processes, such as replication, or by treatment of cells with DNA damaging agents. DSBs act to initiate several programmed genetic rearrangements, including mating-type switching in Saccharomyces cerevisiae (STRATHERN et al. 1982 ), meiotic recombination (SUN et al. 1989 ; CAO et al. 1990 ), and V(D)J rearrangement in B and T cells (FUGMANN et al. 2000 ). DSBs are repaired either by homologous recombination or by nonhomologous end joining. Homologous recombination is considered to be an error-free process that requires the presence of a chromosome homolog or sister chromatid to template repair, whereas end-joining repair is homology independent and is potentially mutagenic. In yeast, DSBs are primarily repaired by homologous recombination and this process requires genes of the RAD52 epistasis group (PAQUES and HABER 1999 ).

Mating-type switching, which is initiated by cleavage of the MAT locus by HO endonuclease, and meiotic recombination can be studied in synchronous populations of cells to identify DNA intermediates and follow the kinetics of repair. After the formation of HOinduced or meiosis-specific DSBs, the ends are processed to form long 3' single-stranded tails (WHITE and HABER 1990 ; SUN et al. 1991 ). The single-stranded tails are substrates for the pairing protein Rad51 (or Rad51 and Dmc1 in meiotic cells) to initiate strand invasion (SUNG 1994 ; SHINOHARA et al. 1997 ). The Mre11-Rad50-Xrs2 (MRX) complex is thought to participate in the initial resection step because null alleles of any of the genes encoding these proteins result in reduced processing of HO-induced DSBs (IVANOV et al. 1994 ; TSUBOUCHI and OGAWA 1998 ). Meiosis-specific DSBs are not formed in mre11, rad50, and xrs2 null mutants (ALANI et al. 1990 ; IVANOV et al. 1992 ; JOHZUKA and OGAWA 1995 ). However, several separation-of-function alleles of MRE11 and RAD50 have been isolated that allow formation, but not processing, of meiosis-specific DSBs (ALANI et al. 1990 ; NAIRZ and KLEIN 1997 ; FURUSE et al. 1998 ; TSUBOUCHI and OGAWA 1998 ; USUI et al. 1998 ; MOREAU et al. 1999 ). In rad50S mutants, the Spo11 protein remains covalently bound to the 5' ends at meiotic break sites, preventing resection (KEENEY et al. 1997 ). In vitro, Mre11 protein exhibits single-stranded endonuclease and 3' to 5' exonuclease activities. As the exonuclease is of the opposite polarity to that expected if Mre11 were the major resection activity, it seems more likely that the endonuclease activity of Mre11 is important for DSB processing and is targeted to the 5' strand by an unknown mechanism. Mutations that abolish the endo- and exonuclease activities of Mre11 have been generated and shown to block processing of meiosis-specific DSBs (FURUSE et al. 1998 ; USUI et al. 1998 ; MOREAU et al. 1999 ). Strains containing the nuclease-deficient allele, mre11-H125N, show normal kinetics of mating-type switching, but the mre11-58 strain, which is also Mre11 nuclease defective, is delayed for mating-type switching (TSUBOUCHI and OGAWA 1998 ; MOREAU et al. 1999 ). The more severe phenotype of the mre11-58 strain could be due to failure of the mutant protein to interact with Rad50 and Xrs2 (USUI et al. 1998 ). It has been suggested that the MRX complex unwinds ends, providing a substrate for the endonuclease activity of Mre11 to remove Spo11 from meiosis-specific DSBs (KEENEY et al. 1997 ; NAIRZ and KLEIN 1997 ; FURUSE et al. 1998 ; USUI et al. 1998 ; MOREAU et al. 1999 ). In the absence of a covalently bound protein, such as at HO-induced breaks, the 5' ends could be processed by other nucleases (MOREAU et al. 1999 ).

Exonucleases that act with a 5' to 3' polarity would appear to be the best candidates for factors redundant with Mre11 in mitotic cells. S. cerevisiae has five putative 5' to 3' nucleases with homology to the RNase H family of nucleases: Exo1, Din7, Rad2, Rad27 (FEN-1), and Yen1 (MUESER et al. 1996 ; HOSFIELD et al. 1998 ; JOHNSON et al. 1998 ). Rad2 and Rad27 act preferentially as structure-specific endonucleases with weak 5' to 3' exonuclease activity (HABRAKEN et al. 1994 ; HARRINGTON and LIEBER 1994 ). Rad2 generates the endonucleolytic cleavage 3' to bulky lesions and rad2 mutants show high sensitivity to UV light, but not to ionizing radiation (PRAKASH and PRAKASH 2000 ). Rad27 functions during DNA synthesis to remove RNA primers from Okazaki fragments (HOSFIELD et al. 1998 ). Although rad27 null mutants are viable, they are unable to grow at 37°, are hypermutagenic and hyperrecombinogenic, and are synthetically lethal with mutations of genes in the RAD52 epistasis group (TISHKOFF et al. 1997B ; SYMINGTON 1998 ). Exo1 is a 5' to 3' exonuclease with a twofold preference for double-stranded over single-stranded DNA and also exhibits flap endonuclease activity (SZANKASI and SMITH 1992 ; FIORENTINI et al. 1997 ; LEE and WILSON 1999 ). Exo1 interacts with Msh2 and exo1 mutants exhibit a mutator phenotype as well as defects in mitotic and meiotic recombination (SZANKASI and SMITH 1995 ; FIORENTINI et al. 1997 ; TISHKOFF et al. 1997A ; KHAZANEHDARI and BORTS 2000 ; KIRKPATRICK et al. 2000 ; TSUBOUCHI and OGAWA 2000 ). The Din7 protein localizes to mitochondria and has no obvious role in nuclear DNA metabolism (FIKUS et al. 2000 ). Yen1 is the least conserved member of the family and no DNA repair defects have been reported for yen1 mutants (JOHNSON et al. 1998 ).

EXO1 present in high copy suppresses the methyl methanesulfonate (MMS) sensitivity of mre11, rad50, and xrs2 null mutants, suggesting that EXO1 is able to take over some functions of the MRX complex (CHAMANKHAH et al. 2000 ; TSUBOUCHI and OGAWA 2000 ). Furthermore, an exo1 mutation increases the MMS sensitivity of mre11 and rad50 strains, and mre11 exo1 double mutants show an even longer delay in processing an HO-induced DSB than mre11 mutants (TSUBOUCHI and OGAWA 2000 ). EXO1 in high copy also suppresses the mutator phenotype of rad27 and certain msh2 mutants (TISHKOFF et al. 1997A ; SOKOLSKY and ALANI 2000 ). In efforts directed at identifying the nuclease activity redundant with the Mre11 nuclease, we constructed strains deficient for MRE11 and genes encoding members of the Rad2 family. Consistent with two recent reports, we find that exo1 mutations intensify the DNA repair defect of mre11 deletion strains (mre11), and EXO1 present in high copy suppresses the DNA repair defect of a mre11 strain (CHAMANKHAH et al. 2000 ; TSUBOUCHI and OGAWA 2000 ). However, mre11-H125N exo1 strains are more repair proficient than mre11 strains and show no defect in HO-induced break processing, suggesting that there are other nucleases that can compensate for loss of the Exo1 and Mre11 nucleases, but not of the MRX complex.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Media and growth conditions:
Rich medium (YPD) and synthetic complete (SC) medium lacking the appropriate amino acid or nucleic acid base were prepared as described previously (SHERMAN et al. 1986 ). Sporulation medium contained 1% potassium acetate and the appropriate amino acids or nucleic acid bases at one-fifth of the concentration used in SC medium. Yeast cells were grown at 30°. Strains containing the conditional rad27-6 allele were grown at the semipermissive temperature of 30°. Strains containing the rad27 allele were grown at room temperature.

Yeast strains and plasmids:
All of the strains used for this study are derivatives of W303-1A or W303-1B and are listed in Table 1 (THOMAS and ROTHSTEIN 1989 ). The MRE11 locus of strain LSY716, described previously as containing the mre11-H125N::URA3::mre11-D56N allele, was amplified from genomic DNA, directly sequenced, and shown to be mre11-H125N:: URA3::mre11-D56N, H125N. Thus all strains derived from LSY716 (LSY726, LSY967, LSY985, LSY845-2A, LSY845-5B, LSY865-7C, and LSY865-8D) contain the mre11-H125N::URA3:: mre11-D56N, H125N allele. Where indicated, Ura- derivatives containing the mre11-H125N allele were used. Strains LSY716 and LSY716A have identical phenotypes in all of the assays described. Standard methods were used for crosses and tetrad dissection to generate the strains described in Table 1 (SHERMAN et al. 1986 ). Yeast transformation was by the lithium acetate method (ITO et al. 1983 ).

The EXO1 gene was amplified by PCR from genomic DNA using two primers, one containing an XhoI site (5' CCGCTCGAGACAACATCACAGTTCATTGC 3') and the second one containing a SacII site (5' TCCCCGCGGCATCTACTTTTAATCTTTTC 3'). The restriction enzyme sites are underlined. The resulting PCR fragment was digested with XhoI and SacII and cloned into the CEN vector, pRS414 (SIKORSKI and HIETER 1989 ), generating the plasmid pSM464. Plasmid pSM502 was generated by cloning the KpnI-SacII fragment from plasmid pSM464 into the high-copy-number 2µ vector, pRS424 (CHRISTIANSON et al. 1992 ). The plasmid pSM502 was used for the construction of EXO1 mutations with the Quick Change Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). The oligonucleotides 5' GCTATTTGGTCTTCGCTGGTGATGCCATTCC 3' and 5' GGAATGGCATCACCAGCGAAGACCAAATACG 3' were used to generate the exo1-D78A mutation, and oligonucleotides 5' TATCCGAAGATTCTGCCCTCCTCGTCTTCGG 3' and 5' CCGAAGACGAGGAGGGCAGAATCTTCGGATA 3' were used to generate the exo1-D173A mutation. The resulting plasmids were named pSM506 (exo1-D78A) and pSM638 (exo1-D173A).

The RAD27 gene was amplified by PCR from genomic DNA using two primers, one containing a SacI site 5' TAGCGAGCTCTACGATGGTTCCGATATGCCA 3' and the second one containing an EcoRI site 5' CCGGAATTCCTTGTGAAATTGCAAATATGG 3'. The resulting PCR fragment was digested with EcoRI/SacI and cloned into the high-copy-number 2µ vector, pRS423 (CHRISTIANSON et al. 1992 ), generating the plasmid pSM476.

-Irradiation survival assays:
Cells were grown in liquid medium to midlog phase. The cultures were serially diluted and aliquots of each dilution were plated on solid medium. The plates were irradiated in a Gammacell-220 containing ⁶⁰Co (Atomic Energy of Canada) for the designated dose. The dose rate of the Gammacell-220 was 50 rad/sec. The plates were incubated for 3–4 days before survivors were counted. Each strain was assayed at least three times and mean values are presented.

Physical analysis of mating-type switching and telomere length:
Physical analyses of mating-type switching and telomere length were performed as described previously (MOREAU et al. 1999 ).

End-joining assay:
Yeast strains containing a GAL-HO plasmid were grown in SC medium to midlog phase and dilutions were plated on medium containing either 2% glucose or 2% galactose. The number of colonies obtained from growth on galactose divided by the number of colonies obtained from growth on glucose provides a measure of the efficiency of end joining of the chromosomal HO-induced break (MOORE and HABER 1996 ).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Mutation of EXO1 increases the radiation sensitivity of the mre11 and mre11-H125N strains:
Genetic analysis of yeast strains lacking the Mre11 nuclease activity (mre11-H125N) revealed weak sensitivity to ionizing radiation and no defects in processing HO-induced DSBs, telomere maintenance, or end-joining repair (MOREAU et al. 1999 ). However, the mre11-H125N strain was sporulation defective due to the accumulation of unprocessed meiosis-specific DSBs (MOREAU et al. 1999 ). This observation led to the idea that redundant nucleases in mitotic cells can process ends in the absence of the Mre11 nuclease, but are unable to act on Spo11-bound breaks generated during meiotic recombination. To determine whether any member of the Rad2 family of nucleases is redundant with Mre11, we performed crosses to generate haploid progeny containing either the mre11 or mre11-H125N allele with mutations in RAD2 family genes (rad2, rad27, exo1, din7, and yen1). The resulting strains were then tested for increased radiation sensitivity compared to the mre11 strains. The rad2, din7, and yen1 mutations caused no increase in radiation sensitivity to mre11 or mre11-H125N strains (data not shown). We have previously shown lethality caused by combining the rad27 and mre11 or rad27 and mre11-H125N mutations. However, viable spores were recovered from a cross between a strain containing the rad27-6 allele and mre11-H125N. Even using the leaky rad27-6 allele we were unable to recover double mutants with mre11. The rad27-6 mre11-H125N strain showed no increase in ionizing radiation sensitivity compared to the mre11-H125N strain (data not shown). The addition of rad2 and yen1 mutations to the mre11-H125N rad27-6 strain caused no additional increase in ionizing radiation sensitivity (data not shown). A high-copy-number plasmid containing the RAD27 gene was unable to suppress the ionizing radiation sensitivity, growth, or sporulation defects of mre11 or mre11-H125N strains.

Consistent with results of TSUBOUCHI and OGAWA 2000 , we found the exo1 mutation increased the radiation sensitivity of the mre11 strain and caused a growth defect more severe than that observed for the mre11 mutation alone (Fig 1A). The exo1 mutation alone caused no increase in radiation sensitivity, even at 70 krad (Fig 1A). The exo1 mre11-H125N strains showed near normal growth rates, but an increased sensitivity to ionizing radiation compared to the mre11-H125N strain. However, the exo1 mre11-H125N double mutant was still more resistant to ionizing radiation than the mre11 strain. Because Din7 and Exo1 are the most closely related members of the Rad2 family, a din7 exo1 mre11-H125N triple mutant was also tested, but was found to be as radiation sensitive as the exo1 mre11-H125N double mutant (data not shown). We constructed an exo1 mre11-H125N rad27-6 triple mutant by crossing a mre11-H125N rad27-6 strain to an exo1 strain, but found that its poor viability prevented further study. Preliminary tests showed similar -ray sensitivity to the exo1 mre11-H125N double mutant, suggesting that the severe growth defect of the triple mutant is not due to elimination of redundant DSB-processing activities. The growth deficiency of the triple mutant is primarily due to the combination of exo1 and rad27-6 mutations; the exo1 mre11-H125N and rad27-6 mre11-H125N double mutants grow reasonably well, whereas the exo1 rad27-6 double mutant forms small heterogeneously sized colonies. This growth defect presents in diploids as well as haploids, suggesting that it is not due to the accumulation of recessive mutations.

View larger version (39K): In this window In a new window Download PPT slide   Figure 1. Genetic interaction between mre11 and exo1 in the repair of ionizing radiation-induced DNA damage. (A) Radiation sensitivity of wild type (W303-1A), exo1 (LSY968), mre11-H125N (LSY716A), mre11 (LSY568), and double mutants (LSY615-1A and LSY967). () Wild type, () exo1, () mre11-H125N, () mre11-H125N exo1, () mre11, and (•) mre11 exo1. (B) EXO1 on either a centromere (CEN) or 2µ plasmid, but not the exo1-D78A or exo1-D173A alleles, suppresses the DNA repair defect of the mre11 strain (LSY568). () Wild type + pRS424, () wild type + 2µ EXO1, () wild type + 2µ exo1-D173A, (•) mre11 + 2µ EXO1, () mre11 + CEN EXO1, (x) mre11 + pRS424, () mre11 + 2µ exo1-D78A, and () mre11 + 2µ exo1-D173A.

EXO1 present in high copy reduces the ionizing radiation sensitivity but not the telomere length or end-joining defects of the mre11 strain:
EXO1 was identified in a screen for high-copy suppressors of the MMS sensitivity of mre11 mutants (TSUBOUCHI and OGAWA 2000 ). When present on a high-copy-number plasmid, EXO1 could reduce the ionizing radiation sensitivity of the mre11 strain (Fig 1B), but not the mre11-H125N strain. Even when present on a CEN plasmid, EXO1 reduced the ionizing radiation sensitivity of the mre11 strain, indicating that just one extra copy of EXO1 is sufficient to improve the radiation resistance of this strain. This result provides further support for the hypothesis that Exo1 is partially redundant with Mre11 in DNA repair. To confirm the requirement for the Exo1 nuclease, two point mutations, exo1-D78A and exo1-D173A, were constructed within the putative catalytic site of Exo1 (on the basis of mutational studies of FEN-1; SHEN et al. 1996 ; HOSFIELD et al. 1998 ) and tested for suppression of the mre11 repair defect. In this case the exo1 mutant alleles were unable to reduce the ionizing radiation sensitivity of the mre11 strain (Fig 1B) or exo1 mre11 strain (data not shown) when introduced on a high-copy-number plasmid. The exo1-D173A mutation expressed from a high-copy plasmid was previously shown to be unable to suppress the temperature sensitivity of a msh2-L560S pol3-01 double mutant, but was shown to be stably expressed in yeast and to retain interaction with Msh2 (SOKOLSKY and ALANI 2000 ).

We have previously demonstrated normal telomere length in mre11-H125N strains. This finding contrasts with observations in the rad50S strain, in which telomeres are slightly longer than the wild-type strain (KIRONMAI and MUNIYAPPA 1997 ; Fig 2). The exo1 mutation by itself, or in combination with mre11-H125N, had no effect on telomere length (Fig 2). However, we did note a slight decrease in telomere length in the exo1 mre11 strain, which could be restored to the length characteristic of the mre11 strain by introduction of EXO1 on a high-copy plasmid. In agreement with other published studies, EXO1 present in high copy did not suppress the short telomere defect of the mre11 strain (CHAMANKHAH et al. 2000 ; TSUBOUCHI and OGAWA 2000 ) or have any effect on telomere length of wild-type or mre11-H125N strains. The rad27-6 mutation alone, or with mre11-H125N, caused no defect in telomere length (data not shown). The high-copy EXO1 plasmid was also tested for suppression of the sporulation block imposed by the mre11-H125N mutation, but, as expected, was unable to restore sporulation to mre11-H125N homozygous diploids.

View larger version (65K): In this window In a new window Download PPT slide   Figure 2. EXO1 present in high copy is unable to suppress the telomere length defect of the mre11 strain. Genomic DNA isolated from each strain was digested with XhoI, separated on a 0.8% agarose gel, transferred to a nylon membrane, and hybridized with a telomere-specific probe. The Y' telomeres of the wild-type strain form a heterogeneous band of 1.3 kb. Strains were W303-1A (wild type), LSY568 (mre11), LSY615-1A (mre11 exo1), LSY716A (mre11-H125N), LSY739 (rad50S), LSY968 (exo1), and LSY967A (mre11-H125N exo1). Where indicated, the wild-type and mre11 strains were transformants containing the 2µ EXO1 plasmid.

In previous studies we found no defect in end-joining repair in mre11-H125N strains, using a plasmid ligation assay (MOREAU et al. 1999 ). As the plasmid assay monitors faithful ligation of cohesive ends to regenerate the restriction enzyme site originally used to digest the plasmid, the lack of requirement for a nuclease is not surprising. Therefore, we tested the requirement for the Mre11 nuclease, and suppression by EXO1, in an assay that involves imprecise end joining (MOORE and HABER 1996 ). In this method, the HO endonuclease cleaves the MAT locus in a rad52 strain, which precludes repair by homologous recombination, but not by other means. Precise end joining regenerates the HO cleavage site, which will then be recut under conditions of continuous HO expression. However, if imprecise end joining occurs as a result of deletion or addition of nucleotides, the junction will be insensitive to HO cleavage and the cells will resume growth to form a colony. By placing the HO gene under the control of the GAL1 promoter, the efficiency of end joining is a measure of the ratio of colonies formed on medium containing galactose compared to glucose. By this assay there was a >1000-fold decrease in end-joining efficiency in the mre11 strain and a 10-fold reduction in the mre11-H125N strain compared to the rad52 control (Table 2). The high-copy-number EXO1-containing plasmid was unable to suppress the end-joining defect of the mre11 strain.

mre11-H125N exo1 strains exhibit normal kinetics of mating-type switching:
Yeast strains with null mutations of MRE11, RAD50, or XRS2 exhibit reduced resection of HO-induced DSBs and a delay in mating-type switching (IVANOV et al. 1994 ; TSUBOUCHI and OGAWA 1998 ). TSUBOUCHI and OGAWA 2000 demonstrated greater stability of the HO-cut fragment and an even greater delay in switching in the exo1 mre11 strain, assumed to occur as a result of even slower resection of HO-induced breaks. If Exo1 were the nuclease redundant with Mre11 we would have expected the exo1 mre11-H125N double mutant to also show delayed kinetics of mating-type switching. As shown previously, the exo1 and mre11-H125N strains exhibited normal kinetics of switching to MATa (MOREAU et al. 1999 ; TSUBOUCHI and OGAWA 2000 ), but the same kinetics were also found for the exo1 mre11-H125N strain (Fig 3). EXO1 present in high copy increased the rate of switching to MATa of the mre11 strain (Fig 4), but had no discernible effect on the kinetics of mating-type switching in the wild-type or mre11-H125N strains. The EXO1 high-copy plasmid partially complemented the delay in mating-type switching of the exo1 mre11 strain, but switching efficiency was not restored to wild-type levels.

View larger version (30K): In this window In a new window Download PPT slide   Figure 3. Mating-type switching shows normal kinetics in the exo1 mre11-H125N strain. (A) Schematic representation of the MAT locus. StyI sites and the expected fragments before and after HO cutting are indicated. Repair of the HO-induced break by conversion from the HMRa donor yields a novel 0.9-kb StyI fragment. (B) Time course of repair in wild-type (W303-1B), exo1 (LSY496-20A), exo1 mre11-H125N (LSY967A), and exo1 mre11 (LSY615-1D) strains. All strains contain the pGAL-HO plasmid. Galactose was added to the cultures at time 0, for 1 hr, to induce expression of HO endonuclease and samples were removed at 1-hr intervals for DNA analysis.

View larger version (114K): In this window In a new window Download PPT slide   Figure 4. EXO1 in high copy partially suppresses the delay in mating-type switching of the mre11 strain. (A) On the left are strains without the EXO1 high-copy-number plasmid and on the right are the same strains containing the EXO1 high-copy-number plasmid. Strains are wild type (W303-1B), mre11-H125N (LSY716A), mre11 (LSY568), and exo1 mre11 (LSY615-1D), and all contain the pGAL-HO plasmid. Galactose was added to the cultures at time 0, for 1 hr, to induce expression of HO endonuclease and samples were removed at 1-hr intervals for DNA analysis. (B) Densitometric analyses of the data presented in A. For each strain the relative intensities of the () uncut (MAT), () cut, and () product bands (MATa) are shown with (shaded lines) and without (solid lines) the 2µ EXO1 plasmid.

High-copy suppression of the synthetic lethality of rad27 with RAD52 group mutations by EXO1:
Deletion of RAD27 is lethal in combination with mutation of any one the RAD52 group genes, including mre11 and mre11-H125N (SYMINGTON 1998 ; MOREAU et al. 1999 ; DEBRAUWERE et al. 2001 ). A diploid heterozygous for MRE11 and RAD27 was transformed with the high-copy-number EXO1 plasmid and sporulated, and the resulting tetrads were dissected to determine whether viable mre11 rad27 spores could be obtained. EXO1 did suppress the lethality, but the spore colonies were very small (Fig 5). This suppression is most likely due to suppression of the rad27 defect because the EXO1 plasmid also suppressed the lethality of rad27 rad57 and rad27 rad59 double mutants (Fig 5 and data not shown). The suppression was not observed using the plasmid containing the exo1-D173A mutation, indicating a requirement for the nuclease activity of Exo1.

View larger version (31K): In this window In a new window Download PPT slide   Figure 5. EXO1 in high copy suppresses the inviability of rad27 mre11 and rad27 rad57 double mutants. (A) Spores derived from a diploid heterozygous for RAD27 and MRE11 (LSY568 x LSY702-3B). (B) Spores from a diploid heterozygous for RAD27 and MRE11 (LSY568 x LSY702-3B) containing the 2µ plasmid expressing EXO1 (pSM502). (C) Spores derived from a diploid heterozygous for RAD27 and MRE11 (LSY568 x LSY702-3B) containing the 2µ plasmid expressing the exo1D173A allele (pSM638). (D) Spores derived from a diploid heterozygous for RAD27 and RAD57 (LSY702-3B x LSY543). (E) Spores derived from a diploid heterozygous for RAD27 and RAD57 (LSY702-3B x LSY543) containing the 2µ plasmid expressing EXO1 (pSM502). In each case, the grid below the tetrad dissection indicates the genotype of each spore: +, wild type; -, mutant locus; 0, dead spore.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Mre11 complex of S. cerevisiae, consisting of Mre11, Rad50, and Xrs2, functions in several aspects of DNA metabolism, including meiotic recombination, DNA repair, telomere maintenance, and nonhomologous end joining (PAQUES and HABER 1999 ). Although the Mre11 protein exhibits 3' to 5' exonuclease and endonuclease activities in vitro (FURUSE et al. 1998 ; PAULL and GELLERT 1998 ; USUI et al. 1998 ; MOREAU et al. 1999 ), the Mre11 complex is implicated in resection of HO-induced and meiosis-specific DSBs to produce 3' single-stranded tails (IVANOV et al. 1994 ; TSUBOUCHI and OGAWA 1998 ). To explain this paradox, it has previously been suggested that the MRX complex unwinds ends to provide a single-stranded substrate for the Mre11 endonuclease activity. Alternatively, there may be an as yet unknown cofactor or associated protein that reverses the polarity of the Mre11 exonuclease. The polarity of the Escherichia coli RecBCD nuclease is reversed after interaction with a Chi site (ANDERSON and KOWALCZYKOWSKI 1997 ). The human Mre11/Rad50/Nbs1 complex also shows 3' to 5' polarity, indicating that the other components of the complex are insufficient to reverse the polarity (TRUJILLO et al. 1998 ; PAULL and GELLERT 1999 ). Although point mutations eliminating the Mre11 nuclease activity result in the accumulation of meiosis-specific DSBs, the processing of HO-induced DSBs is unaffected by the mre11-H125N mutation (FURUSE et al. 1998 ; USUI et al. 1998 ; MOREAU et al. 1999 ). Because meiosis-specific DSBs retain Spo11 covalently bound to the 5' termini, but HO-induced breaks have free ends, it seems likely that other nucleases are redundant with Mre11 in mitotic cells. To explain the inability of these redundant nucleases to process meiosis-specific DSBs, we suggest these activities are exonucleases that require a free 5' end or possibly endonucleases that are excluded from the meiotic DSB forming/processing complex.

Exo1 appeared to be a likely candidate for the redundant activity because the polarity of degradation is 5' to 3' and EXO1 has been identified as a high-copy suppressor of the MMS sensitivity of mre11 mutants (TSUBOUCHI and OGAWA 2000 ). Furthermore, exo1 mre11 double mutants grow very poorly (30% plating efficiency) and show higher sensitivity to MMS and ionizing radiation than mre11 single mutants (TSUBOUCHI and OGAWA 2000 ; Fig 1). The greater synergism observed between mre11 and exo1 for MMS sensitivity than we observe for -ray sensitivity could be due to the different lesions generated by these DNA damaging agents. exo1 mutants show no sensitivity to ionizing radiation, but are sensitive to high concentrations of MMS. Because EXO1 in high copy also reduces the MMS sensitivity conferred by rad50 and xrs2 mutations (TSUBOUCHI and OGAWA 2000 ), it appears to bypass the requirement for the MRX complex rather than simply substitute for the nuclease function of Mre11. We suggest that, in the absence of the MRX complex, the 5' to 3' exonuclease activity of Exo1 inefficiently resects DSBs (Fig 6). This can occur with greater efficiency, and hence the partial suppression, if EXO1 is present in high copy. Consistent with this hypothesis, the putative nuclease-defective alleles of EXO1, exo1-D78A and exo1-D173A, are unable to suppress the mre11 DNA repair defect when introduced in high copy.

View larger version (12K): In this window In a new window Download PPT slide   Figure 6. Model for end processing in mre11 and mre11-H125N strains. (A) MRE11, (B) mre11, (C) mre11-H125N. The MRX complex unwinds ends to produce single-stranded tails for cleavage by the Mre11 endonuclease. In mre11 strains the MRX complex is absent and ends can be resected only by a 5' to 3' double-stranded exonuclease, such as Exo1. This is normally inefficient, but can occur if EXO1 is present in high copy. In mre11-H125N cells, the ends are still unwound by the M*RX complex (M* refers to the Mre11-H125N subunit) to produce single-stranded tails that can be removed by other nucleases in the absence of the Mre11 nuclease activity. This can occur through the activity of Exo1 or by another single-strand exonuclease.

The exo1 mre11-H125N strain was modestly more -ray sensitive than the mre11-H125N strain and considerably more resistant than the mre11 strain. If Exo1 were the only activity redundant with Mre11, then we would have expected the exo1 mre11 and exo1 mre11-H125N strains to exhibit similar phenotypes. The Mre11-H125N protein interacts normally with Rad50 and Xrs2 by the two-hybrid system (data not shown), suggesting the complex is still present in this strain. If the MRX complex processes DSBs by coupled unwinding and endonuclease activities then the formation of single-stranded DNA in mre11-H125N strains would be expected, whereas duplex ends should be present in mre11 strains (Fig 6). The observation that Exo1 has activity on both single- and double-stranded DNA could account for the weak synergism observed for -ray sensitivity of the exo1 mre11 and exo1 mre11-H125N double mutants (FIORENTINI et al. 1997 ). The mre11-H125N and exo1 mre11-H125N strains are sensitive to high doses of ionizing radiation, but have no apparent defect in the repair of a single HO-induced DSB. We consider two possible interpretations of these results. First, a nuclease redundant with Mre11 may be present in limiting amounts and able to process one DSB made by HO endonuclease, but not multiple breaks in the same cell. Second, the high doses of irradiation that are required to sensitize mre11-H125N mutants may cause severe base and sugar damage in addition to strand breaks and the Mre11 nuclease may be required to endonucleolytically remove damaged nucleotides or to remove phosphate or phosphoglycolate groups from damaged termini. Thus, the major function of the Mre11 nuclease could be to remove end-blocking lesions to provide a substrate for the resection nuclease. The weak synergism between the exo1 and mre11-H125N mutations suggests the existence of at least one other redundant 5' to 3' exonuclease for the resection of DSBs.

We have previously shown no defect in telomere length or end joining in the mre11-H125N strain and concluded that the Mre11 nuclease activity of the MRX complex is either unimportant for these functions or fully redundant. EXO1 present in high copy is unable to suppress the telomere maintenance and end-joining defect of mre11 strains, indicating that Exo1 is not the redundant activity for these functions of the complex or that 5' to 3' processing is not required. Alternatively, the specialized protein/DNA structures present at telomeres and as intermediates in end joining may be inaccessible to Exo1, but accessible to the hypothetical single-strand 5' to 3' exonuclease.

	ACKNOWLEDGMENTS

We thank W. K. Holloman and L. Langston for critical reading of the manuscript. This work was supported by a grant from the National Institutes of Health (GM41784).

Manuscript received February 23, 2001; Accepted for publication September 11, 2001.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALANI, E., R. PADMORE, and N. KLECKNER, 1990  Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61:419-436[Medline].

ANDERSON, D. G. and S. C. KOWALCZYKOWSKI, 1997  The recombination hot spot Chi is a regulatory element that switches the polarity of DNA degradation by the RecBCD enzyme. Genes Dev. 11:571-581[Abstract/Free Full Text].

BÄRTSCH, S., L. E. KANG, and L. S. SYMINGTON, 2000  RAD51 is required for the repair of plasmid double-stranded gaps from either plasmid or chromosomal templates. Mol. Cell. Biol. 20:1194-1205[Abstract/Free Full Text].

CAO, L., E. ALANI, and N. KLECKNER, 1990  A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae. Cell 61:1089-1101[Medline].

CHAMANKHAH, M., T. FONTANIE, and W. XIAO, 2000  The Saccharomyces cerevisiae mre11(ts) allele confers a separation of DNA repair and telomere maintenance functions. Genetics 155:569-576[Abstract/Free Full Text].

CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992  Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].

DEBRAUWERE, H., S. LOEILLET, W. LIN, J. LOPES, and A. NICOLAS, 2001  Links between replication and recombination in Saccharomyces cerevisiae: a hypersensitive requirement for homologous recombination in the absence of Rad27 activity. Proc. Natl. Acad. Sci. USA 98:8263-8269[Abstract/Free Full Text].

FIKUS, M. U., P. A. MIECZKOWSKI, P. KOPROWSKI, J. RYTKA, and E. SLEDZIEWSKA-GOJSKA et al., 2000  The product of the DNA damage-inducible gene of Saccharomyces cerevisiae, DIN7, specifically functions in mitochondria. Genetics 154:73-81[Abstract/Free Full Text].

FIORENTINI, P., K. N. HUANG, D. X. TISHKOFF, R. D. KOLODNER, and L. S. SYMINGTON, 1997  Exonuclease I of Saccharomyces cerevisiae functions in mitotic recombination in vivo and in vitro. Mol. Cell. Biol. 17:2764-2773[Abstract].

FUGMANN, S. D., A. I. LEE, P. E. SHOCKETT, I. J. VILLEY, and D. G. SCHATZ, 2000  The RAG proteins and V(D)J recombination: complexes, ends, and transposition. Annu. Rev. Immunol. 18:495-527[Medline].

FURUSE, M., Y. NAGASE, H. TSUBOUCHI, K. MURAKAMI-MUROFUSHI, and T. SHIBATA et al., 1998  Distinct roles of two separable in vitro activities of yeast Mre11 in mitotic and meiotic recombination. EMBO J. 17:6412-6425[Medline].

HABRAKEN, Y., P. SUNG, L. PRAKASH, and S. PRAKASH, 1994  A conserved 5' to 3' exonuclease activity in the yeast and human nucleotide excision repair proteins RAD2 and XPG. J. Biol. Chem. 269:31342-31345[Abstract/Free Full Text].

HARRINGTON, J. J. and M. R. LIEBER, 1994  The characterization of a mammalian DNA structure-specific endonuclease. EMBO J. 13:1235-1246[Medline].

HOSFIELD, D. J., C. D. MOL, B. SHEN, and J. A. TAINER, 1998  Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity. Cell 95:135-146[Medline].

ITO, H., Y. FUKUDA, K. MURATA, and A. KIMURA, 1983  Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168[Abstract/Free Full Text].

IVANOV, E. L., V. G. KOROLEV, and F. FABRE, 1992  XRS2, a DNA repair gene of Saccharomyces cerevisiae, is needed for meiotic recombination. Genetics 132:651-664[Abstract].

IVANOV, E. L., N. SUGAWARA, C. I. WHITE, F. FABRE, and J. E. HABER, 1994  Mutations in XRS2 and RAD50 delay but do not prevent mating-type switching in Saccharomyces cerevisiae. Mol. Cell. Biol. 14:3414-3425[Abstract/Free Full Text].

JOHNSON, R. E., G. K. KOVVALI, L. PRAKASH, and S. PRAKASH, 1998  Role of yeast Rth1 nuclease and its homologs in mutation avoidance, DNA repair, and DNA replication. Curr. Genet. 34:21-29[Medline].

JOHZUKA, K. and H. OGAWA, 1995  Interaction of Mre11 and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae. Genetics 139:1521-1532[Abstract].

KEENEY, S., C. N. GIROUX, and N. KLECKNER, 1997  Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88:375-384[Medline].

KHAZANEHDARI, K. A. and R. H. BORTS, 2000  EXO1 and MSH4 differentially affect crossing-over and segregation. Chromosoma 109:94-102[Medline].

KIRKPATRICK, D., J. FERGUSON, T. D. PETES, and L. S. SYMINGTON, 2000  Decreased meiotic intergenic recombination and increased meiosis I nondisjunction in exo1 mutants of Saccharomyces cerevisiae.. Genetics 156:1549-1557[Abstract/Free Full Text].

KIRONMAI, K. M. and K. MUNIYAPPA, 1997  Alteration of telomeric sequences and senescence caused by mutations in RAD50 of Saccharomyces cerevisiae. Genes Cells 2:443-455[Abstract].

LEE, B. I. and D. M. WILSON, III, 1999  The RAD2 domain of human exonuclease 1 exhibits 5' to 3' exonuclease and flap structure-specific endonuclease activities. J. Biol. Chem. 274:37763-37769[Abstract/Free Full Text].

MOORE, J. K. and J. E. HABER, 1996  Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:2164-2173[Abstract].

MOREAU, S., J. R. FERGUSON, and L. S. SYMINGTON, 1999  The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol. Cell. Biol. 19:556-566[Abstract/Free Full Text].

MUESER, T. C., N. G. NOSSAL, and C. C. HYDE, 1996  Structure of bacteriophage T4 RNase H, a 5' to 3' RNA-DNA and DNA-DNA exonuclease with sequence similarity to the RAD2 family of eukaryotic proteins. Cell 85:1101-1112[Medline].

NAIRZ, K. and F. KLEIN, 1997  mre11S—a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis. Genes Dev. 11:2272-2290[Abstract/Free Full Text].

PAQUES, F. and J. E. HABER, 1999  Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404[Abstract/Free Full Text].

PAULL, T. T. and M. GELLERT, 1998  The 3' to 5' exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol. Cell 1:969-979[Medline].

PAULL, T. T. and M. GELLERT, 1999  Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13:1276-1288[Abstract/Free Full Text].

PRAKASH, S. and L. PRAKASH, 2000  Nucleotide excision repair in yeast. Mutat. Res. 451:13-24[Medline].

SHEN, B., J. P. NOLAN, L. A. SKLAR, and M. S. PARK, 1996  Essential amino acids for substrate binding and catalysis of human flap endonuclease 1. J. Biol. Chem. 271:9173-9176[Abstract/Free Full Text].

SHERMAN, F., G. FINK and J. HICKS, 1986 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHINOHARA, A., S. GASIOR, T. OGAWA, N. KLECKNER, and D. K. BISHOP, 1997  Saccharomyces cerevisiae recA homologues RAD51 and DMC1 have both distinct and overlapping roles in meiotic recombination. Genes Cells 2:615-629[Abstract].

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27[Abstract/Free Full Text].

SOKOLSKY, T. and E. ALANI, 2000  EXO1 and MSH6 are high-copy suppressors of conditional mutations in the MSH2 mismatch repair gene of Saccharomyces cerevisiae. Genetics 155:589-599[Abstract/Free Full Text].

STRATHERN, J. N., A. J. KLAR, J. B. HICKS, J. A. ABRAHAM, and J. M. IVY et al., 1982  Homothallic switching of yeast mating type cassettes is initiated by a double-stranded cut in the MAT locus. Cell 31:183-192[Medline].

SUN, H., D. TRECO, N. P. SCHULTES, and J. W. SZOSTAK, 1989  Double-strand breaks at an initiation site for meiotic gene conversion. Nature 338:87-90[Medline].

SUN, H., D. TRECO, and J. W. SZOSTAK, 1991  Extensive 3'-overhanging, single-stranded DNA associated with the meiosis-specific double-strand breaks at the ARG4 recombination initiation site. Cell 64:1155-1161[Medline].

SUNG, P., 1994  Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science 265:1241-1243[Abstract/Free Full Text].

SYMINGTON, L. S., 1998  Homologous recombination is required for the viability of rad27 mutants. Nucleic Acids Res. 26:5589-5595[Abstract/Free Full Text].

SZANKASI, P. and G. R. SMITH, 1992  A DNA exonuclease induced during meiosis of Schizosaccharomyces pombe. J. Biol. Chem. 267:3014-3023[Abstract/Free Full Text].

SZANKASI, P. and G. R. SMITH, 1995  A role for exonuclease I from S. pombe in mutation avoidance and mismatch correction. Science 267:1166-1169[Abstract/Free Full Text].

THOMAS, B. J. and R. ROTHSTEIN, 1989  The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene. Genetics 123:725-738[Abstract/Free Full Text].

TISHKOFF, D. X., A. L. BOERGER, P. BERTRAND, N. FILOSI, and G. M. GAIDA et al., 1997a  Identification and characterization of Saccharomyces cerevisiae EXO1, a gene encoding an exonuclease that interacts with MSH2. Proc. Natl. Acad. Sci. USA 94:7487-7492[Abstract/Free Full Text].

TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997b  A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263[Medline].

TRUJILLO, K. M., S. S. YUAN, E. Y. LEE, and P. SUNG, 1998  Nuclease activities in a complex of human recombination and DNA repair factors Rad50, Mre11, and p95. J. Biol. Chem. 273:21447-21450[Abstract/Free Full Text].

TSUBOUCHI, H. and H. OGAWA, 1998  A novel mre11 mutation impairs processing of double-strand breaks of DNA during both mitosis and meiosis. Mol. Cell. Biol. 18:260-268[Abstract/Free Full Text].

TSUBOUCHI, H. and H. OGAWA, 2000  Exo1 roles for repair of DNA double-strand breaks and meiotic crossing over in Saccharomyces cerevisiae. Mol. Biol. Cell 11:2221-2233[Abstract/Free Full Text].

USUI, T., T. OHTA, H. OSHIUMI, J. TOMIZAWA, and H. OGAWA et al., 1998  Complex formation and functional versatility of Mre11 of budding yeast in recombination. Cell 95:705-716[Medline].

WHITE, C. I. and J. E. HABER, 1990  Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. EMBO J. 9:663-673[Medline].

This article has been cited by other articles:

				T. K. Pandita and C. Richardson Chromatin remodeling finds its place in the DNA double-strand break response Nucleic Acids Res., April 1, 2009; 37(5): 1363 - 1377. [Abstract] [Full Text] [PDF]

				S. Liao, T. Toczylowski, and H. Yan Identification of the Xenopus DNA2 protein as a major nuclease for the 5'->3' strand-specific processing of DNA ends Nucleic Acids Res., November 1, 2008; 36(19): 6091 - 6100. [Abstract] [Full Text] [PDF]

				S. Raynard, H. Niu, and P. Sung DNA double-strand break processing: the beginning of the end Genes & Dev., November 1, 2008; 22(21): 2903 - 2907. [Abstract] [Full Text] [PDF]

				S. Gravel, J. R. Chapman, C. Magill, and S. P. Jackson DNA helicases Sgs1 and BLM promote DNA double-strand break resection Genes & Dev., October 15, 2008; 22(20): 2767 - 2772. [Abstract] [Full Text] [PDF]

				A. Kish and J. DiRuggiero Rad50 Is Not Essential for the Mre11-Dependent Repair of DNA Double-Strand Breaks in Halobacterium sp. Strain NRC-1 J. Bacteriol., August 1, 2008; 190(15): 5210 - 5216. [Abstract] [Full Text] [PDF]

				M. Segurado and J. F.X. Diffley Separate roles for the DNA damage checkpoint protein kinases in stabilizing DNA replication forks Genes & Dev., July 1, 2008; 22(13): 1816 - 1827. [Abstract] [Full Text] [PDF]

				H.-S. Kim, S. Vijayakumar, M. Reger, J. C. Harrison, J. E. Haber, C. Weil, and J. H. J. Petrini Functional Interactions Between Sae2 and the Mre11 Complex Genetics, February 1, 2008; 178(2): 711 - 723. [Abstract] [Full Text] [PDF]

				R. Capper, B. Britt-Compton, M. Tankimanova, J. Rowson, B. Letsolo, S. Man, M. Haughton, and D. M. Baird The nature of telomere fusion and a definition of the critical telomere length in human cells Genes & Dev., October 1, 2007; 21(19): 2495 - 2508. [Abstract] [Full Text] [PDF]

				K. Lee and S. E. Lee Saccharomyces cerevisiae Sae2- and Tel1-Dependent Single-Strand DNA Formation at DNA Break Promotes Microhomology-Mediated End Joining Genetics, August 1, 2007; 176(4): 2003 - 2014. [Abstract] [Full Text] [PDF]

				Y. Hirano and K. Sugimoto Cdc13 Telomere Capping Decreases Mec1 Association but Does Not Affect Tel1 Association with DNA Ends Mol. Biol. Cell, June 1, 2007; 18(6): 2026 - 2036. [Abstract] [Full Text] [PDF]

				T. Toczylowski and H. Yan Mechanistic Analysis of a DNA End Processing Pathway Mediated by the Xenopus Werner Syndrome Protein J. Biol. Chem., November 3, 2006; 281(44): 33198 - 33205. [Abstract] [Full Text] [PDF]

				J. Lopes, C. Ribeyre, and A. Nicolas Complex Minisatellite Rearrangements Generated in the Total or Partial Absence of Rad27/hFEN1 Activity Occur in a Single Generation and Are Rad51 and Rad52 Dependent. Mol. Cell. Biol., September 1, 2006; 26(17): 6675 - 6689. [Abstract] [Full Text] [PDF]

				D. Thermic Functions of Multiple Exonucleases Are Essential for Cell Viability, DNA Repair and Homologous Recombination in recD Mutants of Escherichia coli Genetics, April 1, 2006; 172(4): 2057 - 2069. [Abstract] [Full Text] [PDF]

				B. O. Krogh, B. Llorente, A. Lam, and L. S. Symington Mutations in Mre11 Phosphoesterase Motif I That Impair Saccharomyces cerevisiae Mre11-Rad50-Xrs2 Complex Stability in Addition to Nuclease Activity Genetics, December 1, 2005; 171(4): 1561 - 1570. [Abstract] [Full Text] [PDF]

				K. Kikuchi, Y. Taniguchi, A. Hatanaka, E. Sonoda, H. Hochegger, N. Adachi, Y. Matsuzaki, H. Koyama, D. C. van Gent, M. Jasin, et al. Fen-1 Facilitates Homologous Recombination by Removing Divergent Sequences at DNA Break Ends Mol. Cell. Biol., August 15, 2005; 25(16): 6948 - 6955. [Abstract] [Full Text] [PDF]

				K. M. Doherty, S. Sharma, L. A. Uzdilla, T. M. Wilson, S. Cui, A. Vindigni, and R. M. Brosh Jr. RECQ1 Helicase Interacts with Human Mismatch Repair Factors That Regulate Genetic Recombination J. Biol. Chem., July 29, 2005; 280(30): 28085 - 28094. [Abstract] [Full Text] [PDF]

				D. Nakada, Y. Hirano, and K. Sugimoto Requirement of the Mre11 Complex and Exonuclease 1 for Activation of the Mec1 Signaling Pathway Mol. Cell. Biol., November 15, 2004; 24(22): 10016 - 10025. [Abstract] [Full Text] [PDF]

				B. Llorente and L. S. Symington The Mre11 Nuclease Is Not Required for 5' to 3' Resection at Multiple HO-Induced Double-Strand Breaks Mol. Cell. Biol., November 1, 2004; 24(21): 9682 - 9694. [Abstract] [Full Text] [PDF]

				L. Maringele and D. Lydall Telomerase- and recombination-independent immortalization of budding yeast Genes & Dev., November 1, 2004; 18(21): 2663 - 2675. [Abstract] [Full Text] [PDF]

				M. K. Zubko, S. Guillard, and D. Lydall Exo1 and Rad24 Differentially Regulate Generation of ssDNA at Telomeres of Saccharomyces cerevisiae cdc13-1 Mutants Genetics, September 1, 2004; 168(1): 103 - 115. [Abstract] [Full Text] [PDF]

				S. E. Liberti and L. J. Rasmussen Is hEXO1 a Cancer Predisposing Gene? Mol. Cancer Res., August 1, 2004; 2(8): 427 - 432. [Full Text] [PDF]

				L. Maringele and D. Lydall EXO1 Plays a Role in Generating Type I and Type II Survivors in Budding Yeast Genetics, April 1, 2004; 166(4): 1641 - 1649. [Abstract] [Full Text] [PDF]

				A. A. Bertuch and V. Lundblad EXO1 Contributes to Telomere Maintenance in Both Telomerase-Proficient and Telomerase-Deficient Saccharomyces cerevisiae Genetics, April 1, 2004; 166(4): 1651 - 1659. [Abstract] [Full Text] [PDF]

				L. K. Lewis, F. Storici, S. Van Komen, S. Calero, P. Sung, and M. A. Resnick Role of the Nuclease Activity of Saccharomyces cerevisiae Mre11 in Repair of DNA Double-Strand Breaks in Mitotic Cells Genetics, April 1, 2004; 166(4): 1701 - 1713. [Abstract] [Full Text] [PDF]

				D. Lydall Hiding at the ends of yeast chromosomes: telomeres, nucleases and checkpoint pathways J. Cell Sci., October 15, 2003; 116(20): 4057 - 4065. [Abstract] [Full Text] [PDF]

				C. Spiro and C. T. McMurray Nuclease-Deficient FEN-1 Blocks Rad51/BRCA1-Mediated Repair and Causes Trinucleotide Repeat Instability Mol. Cell. Biol., September 1, 2003; 23(17): 6063 - 6074. [Abstract] [Full Text] [PDF]

				K. Tomita, A. Matsuura, T. Caspari, A. M. Carr, Y. Akamatsu, H. Iwasaki, K.-i. Mizuno, K. Ohta, M. Uritani, T. Ushimaru, et al. Competition between the Rad50 Complex and the Ku Heterodimer Reveals a Role for Exo1 in Processing Double-Strand Breaks but Not Telomeres Mol. Cell. Biol., August 1, 2003; 23(15): 5186 - 5197. [Abstract] [Full Text] [PDF]

				E. Larsen, C. Gran, B. E. Saether, E. Seeberg, and A. Klungland Proliferation Failure and Gamma Radiation Sensitivity of Fen1 Null Mutant Mice at the Blastocyst Stage Mol. Cell. Biol., August 1, 2003; 23(15): 5346 - 5353. [Abstract] [Full Text] [PDF]

				S. Sharma, J. A. Sommers, H. C. Driscoll, L. Uzdilla, T. M. Wilson, and R. M. Brosh Jr. The Exonucleolytic and Endonucleolytic Cleavage Activities of Human Exonuclease 1 Are Stimulated by an Interaction with the Carboxyl-terminal Region of the Werner Syndrome Protein J. Biol. Chem., June 20, 2003; 278(26): 23487 - 23496. [Abstract] [Full Text] [PDF]

				Z. Dong and M. Fasullo Multiple recombination pathways for sister chromatid exchange in Saccharomyces cerevisiae: role of RAD1 and the RAD52 epistasis group genes Nucleic Acids Res., May 15, 2003; 31(10): 2576 - 2585. [Abstract] [Full Text] [PDF]

				Y. Aylon, B. Liefshitz, G. Bitan-Banin, and M. Kupiec Molecular Dissection of Mitotic Recombination in the Yeast Saccharomyces cerevisiae Mol. Cell. Biol., February 15, 2003; 23(4): 1403 - 1417. [Abstract] [Full Text] [PDF]

				L. S. Symington Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 630 - 670. [Abstract] [Full Text] [PDF]

				T. E. Wilson A Genomics-Based Screen for Yeast Mutants With an Altered Recombination/End-Joining Repair Ratio Genetics, October 1, 2002; 162(2): 677 - 688. [Abstract] [Full Text] [PDF]

				L. Maringele and D. Lydall EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants Genes & Dev., August 1, 2002; 16(15): 1919 - 1933. [Abstract] [Full Text] [PDF]

				M. Kucherlapati, K. Yang, M. Kuraguchi, J. Zhao, M. Lia, J. Heyer, M. F. Kane, K. Fan, R. Russell, A. M. C. Brown, et al. Haploinsufficiency of Flap endonuclease (Fen1) leads to rapid tumor progression PNAS, July 23, 2002; 99(15): 9924 - 9929. [Abstract] [Full Text] [PDF]