- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ling, K.-Y.
- Articles by Saimi, Y.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ling, K.-Y.
- Articles by Saimi, Y.
K+-Channel Transgenes Reduce K+ Currents in Paramecium, Probably by a Post-translational Mechanism
Kit-Yin Ling1,a, W. John Haynes1,a, Laura Oesterle2,a, Ching Kunga,b, Robin R. Prestonc, and Yoshiro Saimiaa Laboratory of Molecular Biology, University of Wisconsin, Madison, Wisconsin 53706
b Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706
c Department of Pharmacology and Physiology, MCP Hahnemann University School of Medicine, Philadelphia, Pennsylvania 19102
Corresponding author: Yoshiro Saimi, Laboratory of Molecular Biology, University of Wisconsin, 1525 Linden Dr., Madison, WI 53706., ysaimi{at}facstaff.wisc.edu (E-mail)
Communicating editor: S. L. ALLEN
| ABSTRACT |
|---|
PAK11 is 1 of more than 15 members in a gene family that encodes K+-channel pore-forming subunits in Paramecium tetraurelia. Microinjection of PAK11 DNA into macronuclei of wild-type cells results in clonal transformants that exhibit hyperexcitable swimming behaviors reminiscent of certain loss-of-K+-current mutants. PAK2, a distant homolog of PAK11, does not have the same effect. But PAK1, a close homolog of PAK11, induces the same hyperexcitability. Cutting the PAK11 open reading frame (ORF) with restriction enzymes before injection removes this effect entirely. Microinjection of PAK11 ORF flanked by the calmodulin 5' and 3' UTRs also induces the same hyperexcitable phenotype. Direct examination of transformed cells under voltage clamp reveals that two different Ca2+-activated K+-specific currents are reduced in amplitude. This reduction does not correlate with a deficit of PAK11 message, since RNA is clearly produced from the injected transgenes. Insertion of a single nucleotide at the start of the PAK11 ORF does not affect the RNA level but completely abolishes the phenotypic transformation. Thus, the reduction of K+ currents by the expression of the K+-channel transgenes reported here is likely to be the consequence of a post-translational event. The complexity of behavioral changes, possible mechanisms, and implications in Paramecium biology are discussed.
ALL known K+ channels have similar features: each consists of four pore-forming subunits that form the K+ filter and aqueous pathway across the membrane (![]()
![]()
![]()
![]()
![]()
In an attempt to identify their role in vivo, we have examined the behavioral and electrophysiological effects of expressing individual K+-channel subunit transgenes in macronuclei of paramecia. In two out of the three transgenes studied, we have encountered a phenomenon resembling silencing. Injection of certain full-length Paramecium K+-channel genes (PAKs; ![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Stocks and cultures:
P. tetraurelia stocks 51s (+/+; ![]()
![]()
![]()
![]()
![]()
Preparation of total DNA and total RNA from Paramecium:
Standard molecular biology techniques were followed (![]()
![]()
![]()
![]()
![]()
Cloning of PAK1, PAK11, and PAK2:
A complete XbaI digest of total Paramecium DNA was probed with a 32P-labeled 0.85-kb fragment of PAK1 DNA (![]()
![]()
![]()
PCR and RT-PCR were performed using Advantage cDNA polymerase mix (Clontech, Palo Alto, CA). A SpeI- and KpnI-linker primer-pair specific for the PAK1 open reading frame (ORF) (5' oligo, GACTAGTATAAATGATACCCAAACTCCAAGGG; 3' oligo, GGGGTACCTCATATAATTTTTTACACGACTTATC), truncated PAK1
3' (the same 5' oligo and 3' oligo: GGGGTACCTCATTGGTATGATAAGCAGCCA), or PAK11 ORF (5' oligos, GACTAGTATAAATGATACCCGGACTCTAAAAG and GACTAGTATAAATGATAACCCGGACTCTAAAAGATTAGAT for in-frame and frameshift, respectively; and 3' oligo, GGGGTACCTCATATAATGTTTTATACCACTTATC for both; Operon, Alameda, CA) was used to amplify from total DNA or the first-strand cDNA. Additional primers up- and downstream of the ORFs had also been used in various RT-PCR experiments to finalize the boundaries of the ORFs. The first-strand cDNA was synthesized from purified 51s total RNA using oligo/poly(dT) with a SuperScript preamplification system (Life Technologies, Rockville, MD). All reactions were performed in a programmable thermal controller 100 (MJ Research, Watertown, MA). Reactions using genomic DNA as template yielded molecules of 2.4 kb. RT-PCRs yielded cDNAs, each with three introns spliced from their corresponding PAK1 and PAK11 genomic sequences, respectively.
The PCR-amplified genomic ORFs and RT-PCR-amplified cDNA ORFs of PAK1 and PAK11 were digested with the linker restriction enzymes and cloned into Paramecium expression vector pPXV at their corresponding sites (![]()
Preparation of plasmid DNAs for microinjection:
Plasmids were digested with various restriction enzymes to completion as judged by gel electrophoresis. After digestion the plasmids were phenol-chloroform extracted, ethanol precipitated, and washed twice with 75% ethanol. All samples were resuspended in Tris-EDTA buffer pH 8.0 at 0.55 µg/µl for macronuclear injection. Standard molecular-biological techniques were used (![]()
![]()
Microinjection for transgene expression in nd6 cells:
An aliquot of 510 pl of the above-mentioned linearized plasmid at various concentrations was microinjected into the macronucleus of each recipient cell as previously described (![]()
Behavioral assay:
Uninjected and microinjected cells were cultured for at least 2448 hr before their behavior was tested. Cells were transferred into an adaptation solution [4 mM KCl, 1 mM CaCl2, 1 mM N-(2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; HEPES), 0.01 mM EDTA, pH 7.2] for 10 min to 1 hr. Then they were individually transferred into various testing solutions, including a Na+-test solution (10 mM NaCl, 1 mM CaCl2, 1 mM HEPES, 0.01 mM EDTA, pH 7.2), where the duration of continuous backward swimming of each cell was monitored using a stereomicroscope and a stopwatch (![]()
Electrophysiology:
Membrane currents were recorded from cells under voltage clamp using the established techniques (![]()
. The cells were bathed in 1 mM KCl, 1 mM CaCl2, 1 mM HEPES, and 0.01 mM EDTA, pH 7.2. Currents shown were filtered at 1 kHz and have been corrected for linear leak current as described (![]()
![]()
Analysis of total DNA by Southern blot and total RNA by Northern blot:
Gel electrophoresis of total DNA isolated from descendant clones of uninjected nd6 controls and various microinjected transformants for Southern blots and their total RNA for Northern blots was performed as previously described (![]()
![]()
-32P]dCTP (Amersham Life Science, Arlington Heights, IL) as directed by the manufacturer. DNA marker was from GIBCO/Life Technologies (Alameda, CA) and RNA markers were from GIBCO/Life Technologies or Promega (Madison, WI). The radioactive signals were recorded on Phospho-Imager cassettes and then digitized and analyzed using ImageQuant 1.2 (Molecular Dynamics, Sunnyvale, CA).
Sequence comparison and secondary structure prediction:
The protein sequence from the expected ORFs of PAK1 and PAK11 were used to do a homology search in the most recent databases employing several algorithms available at the National Center for Biotechnology Information web site. Secondary structures were analyzed using the PROTEAN program (DNAStar).
The sequence data presented in this article have been submitted to the EMBL/GenBank Data Libraries under accession nos. AF424539 (PAK1), AF432226 (PAK2), and AF424540 (PAK11).
| RESULTS |
|---|
The sequences for two very closely related K+-channel genes, PAK11 and PAK1 (![]()
![]()
![]()
-helices, the PAKs studied here most closely resemble the AKT/EAG/ERG group of K+ channels that have potential cyclic nucleotide-binding sites in their C-terminal cytoplasmic domains (![]()
![]()
PAK11 transgenes cause hyperexcitable behaviors:
We transformed wild-type paramecia by microinjecting plasmids into individual macronuclei and examined the clonal descendants of the recipients (![]()
1 sec observed in uninjected cells. Repeated experiments with intact PAK11 consistently produce this effect in numerous separate injections. Usually this hyperexcitable phenotype was observed after the first post-injection fission. In cases where the first fission was delayed for a variety of reasons, the injected cells themselves showed hyperexcitability after
12 hr. The effect has complete penetrance, having been observed in all descendant cells in each clone and at all clonal ages up to
20 fissions, but was lost after autogamy. This hyperexcitable behavioral phenotype is striking but unexpected. K+ channels normally pass outward currents that repolarize the membrane after depolarization. Therefore, the overexpression of K+ channels is expected to terminate rather than to prolong membrane depolarization (excitation).
|
Intact PAK11 ORF in the transgene is required for the effect:
It is not necessary to release the PAK11 fragment from the vector to effect the clonal behavioral transformation. The same behavioral effect was observed by injecting pBS-PAK11 linearized with BamHI or HindIII, which left the
3-kb vector sequence still attached to the uncut PAK11 fragment (Fig 1). In contrast, pBS-PAK11 linearized with StyI or EarI, which have cut sites within the PAK11 ORF (Fig 1), was completely ineffective in the phenotypic transformation.
Artificially promoted PAK11 ORF is also effective, but frameshift PAK11 ORF is not:
The flanking sequences and UTRs of the PAK11 ORF may be involved in causing the peculiar phenotypic change described above. To test this possibility and to prevent possible multimerization of the ORF in the recipient macronucleus, we subcloned the PAK11 ORF into pPXV, a Paramecium expression plasmid with the constitutive calmodulin promoter (CAM 5' UTR) and CAM 3' UTR (![]()
![]()
![]()
|
A shift in the reading frame should allow us to discern whether it is the nucleotide sequence in the PAK11 RNA or the amino acid sequence of the translated PAK11 protein that causes the hyperexcitable phenotype. Accordingly, we engineered a pPXV plasmid with a single base-pair insertion downstream of the start codon of the PAK11 ORF, frameshifted (fs) pPXV-PAK11, and tested for its transformation effect. This insertion (5' ATGATAC ... to 5' ATGATAAC ...) was expected to shift the reading frame and to terminate the translation at amino acid residue 32. As shown in Fig 2, this plasmid, which was also linearized with SfiI, is entirely ineffective in producing hyperexcitability.
PAK2 does not have the same effect as PAK11 and PAK1:
While PAK1 and PAK11 are 96% identical, PAK2 and PAK1 have only 24% identity between their transmembrane amino acid sequences (![]()
3' (Fig 1), that encodes all of the six transmembrane domains, including the filter and the pore, as well as the first 179 amino acids of the cytoplasmic C-terminal end followed by a TGA stop. Injection of a SfiI digest of this construct was just as ineffective as the SfiI digest of frameshifted pPXV-PAK11 described above (data not shown).
Fate of the injected transgenes in PAK11 and PAK1:
Our previous work demonstrated that the linearized pPXV expression plasmid and its insert consistently replicate faithfully and autonomously in Paramecium macronuclei (![]()
![]()
|
PAK11 trangenes are transcribed and translated:
We also used the entire PAK11 ORF to probe total RNAs from the various descendant clones. A 2.4-kb hybridization signal is evident in the clones transformed with SfiI-linearized pPXV-PAK1 or pPXV-PAK11 that show the hyperexcitable phenotype (Fig 4, lanes 3 and 4, top). The same 2.4-kb Northern signal is present in the clones from cells injected with the pPXV bearing the frameshifted PAK11 ORF, which, as stated above, shows no hyperexcitability (Fig 4, lane 2, top). These signals match the expected size of the PAK1 and PAK11 RNA and indicate that the transgenes are being transcribed whether they are cloned in-frame or off-frame. Taking into consideration the loading control (Fig 4, bottom) and the Southern signals of PAK transgenes (Fig 3), the failure of the frameshifted pPXV-PAK11 to transform was clearly not because of underinjection. Clones transformed with an empty pPXV (Fig 4, lane 5, top) and those of uninjected cells (Fig 4, lane 1, top), which do not show any phenotypic changes, have no recognizable signal, 2.4-kb or otherwise. Thus, the transcripts from the endogenes are far fewer compared to those from the large number of transgenes.
|
PAK11 transformants have reduced K+ currents:
While swimming behaviors reflect the activities of multiple ion channels and pumps, currents through individual channels can be identified by their charge carrier, kinetics, and other biophysical characteristics. To determine which of the previously described activities might be responsible for the hyperexcitable phenotype of the pPXV-PAK11-transformed wild-type paramecia, we examined individual ion currents using a two-electrode voltage-clamp analysis. Membrane currents were examined under conditions optimal for Ca2+ and K+ conductance (see MATERIALS AND METHODS). Four principal K+ currents have been described to date (![]()
![]()
|
|
| DISCUSSION |
|---|
Transgene-induced loss of K+ currents is not a common "gene silencing" phenomenon:
One common strategy to study eukaryotic channels is to express them in Xenopus oocytes, which can be readily manipulated and examined using electrophysiological and other experimental techniques. Since Paramecium uses UAA and UAG to encode glutamines (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
2 kb of flanking UTR sequences. We therefore reason that the PAK11 endogene is also transcribed in the hyperexcitable transformants. Preliminary investigation with pPXV-PAK11-green fluorescent protein fusion constructs elicited both clonal hyperexcitability and a green fluorescent signal that are absent in the uninjected controls. While this indicates that the transgene message was actually translated, further study is underway to characterize the nature of this translated product.
The effects are likely due to the channel protein:
A single nucleotide insertion at the 5' end of the ORF should not greatly affect the structure and function of RNA. On the other hand, this insertion would shift the reading frame and abolish translation. Our frameshifted pPXV-PAK11 construct produces RNA of the same size as the in-frame plasmid (Fig 4). The fact that it is entirely ineffective in producing the hyperexcitable phenotype (Fig 2) supports the hypothesis that the effect is not due simply to the presence of transgenic PAK11 RNA but to the production of the protein. The possibility that the frameshifted RNA is somehow specifically destroyed is refuted because the level of plasmid-derived PAK11-specific RNA is approximately the same in both cases (Fig 4). We also found that the PAK ORF in the plasmids needs to be intact for the hyperexcitability to occur: truncating or bisecting the ORF invariably removes the phenotypic transformation. Furthermore, the effect does not depend on the specificity of the untranslated portions of the transgenic PAK gene since the ORF placed behind its own promoter and 3' UTR or the CAM promoter and 3' UTR have the same effect. These results indicate that the hyperexcitability is the consequence of the translational product of the PAK11 transgenes in the macronucleus. The failure of the truncated PAK1 transgenes to transform indicate that the C-terminal region of this K+-channel subunit could be critical in assembly and/or functioning. Direct localization and quantification of PAK11 proteins await further investigation with fusion constructs and antibodies.
Meanwhile, we have used the specific electric currents through these channel proteins to follow their individual activities. Because each type of channel has its own ion permeability, gating parameters, activation and inactivation kinetics, as well as its own set of specific blockers, each can be studied separately under a voltage clamp in vivo (![]()
![]()
Possible mechanism(s):
There are now over 15 known ORFs, each capable of specifying one type of K+-channel subunit, at least conceptually, in Paramecium. If we assume that Paramecium K+ channels are heterotetramers, and each type of channel has a different subunit composition, the overabundance of one type of subunit from the expression of a certain PAK transgene may disrupt tetramer assembly. Misassembled nonfunctional tetramers may compete with the functional ones and perturb channel production, secretion, and deployment into limited surface sites. In addition, nonfunctional proteins may trigger degradation that removes even the functional proteins. The observation that the two Ca2+-dependent K+ channels are strongly affected by the PAK1 or PAK11 transgenes but not by PAK2 indicates that these two channels are most sensitive to ill effects of overproduction of PAK1-like subunits. It seems possible that these two channels normally use PAK1 subfamily members as some or all of their subunits and the natural proclivity of accepting these subunits into the tetramers is being abused here by the excessive abundance of one type of subunit produced by the transgene. In Drosophila, both the Sh (shaker) and Eag (ether-a-go-go) loci encode different K+-channel subunits. ![]()
![]()
![]()
-helices, PAKs are most similar to the Eag group. It therefore seems possible that they also enter heterotetrameric assembly. The C-terminal cytoplasmic domain of the Eag subunit has a cyclic nucleotide-binding site (![]()
![]()
![]()
![]()
Gene silencing and reverse genetics in Paramecium:
In most cases of sequence-specific gene silencing currently under study in other species, the loss of the activity is due to a reduction in the targeted mRNA. This occurs either by reducing the amount of the gene being transcribed (transcriptional silencing) or by degrading the RNAs produced (post-transciptional silencing; ![]()
![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 These authors contributed equally to this article. ![]()
2 Present address: Laura Oesterle, USDA-ARS, CCRU, Barley and Malt Laboratory, 501 N. Walnut St., Madison, WI 53705. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Lynn Haynes for critical comments on the manuscript. We also thank Franziska Brendt, Benjamin B. Smalley, and Brian Vaillant for technical assistance. This research was funded by National Institutes of Health grants GM-22714 (C.K.), GM-36386 (Y.S.), and GM-51498 (R.R.P.).
Manuscript received April 13, 2001; Accepted for publication July 5, 2001.
| LITERATURE CITED |
|---|
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1999 Current Protocols in Molecular Biology. Greene Publishing Associates & Wiley-Interscience, New York.
BAULCOMBE, D. C., 2000 Molecular biology: unwinding RNA silencing. Science 290:1108-1109
BETERMIER, M., S. DUHARCOURT, H. SEITZ, and E. MEYER, 2000 Timing of developmentally programmed excision and circularization of Paramecium internal eliminated sequences. Mol. Cell. Biol. 20:1553-1561
BRUGGEMANN, A., L. A. PARDO, W. STUHMER, and O. PONGS, 1993 Ether-a-go-go encodes a voltage-gated channel permeable to K+ and Ca2+ and modulated by cAMP. Nature 365:445-448[Medline].
CHEN, M. L., T. HOSHI, and C. F. WU, 2000 Sh and eag K+ channel subunit interaction in frog oocytes depends on level and time of expression. Biophys. J. 79:1358-1368[Medline].
COGONI, C. and G. MACINO, 2000 Post-transcriptional gene silencing across kingdoms. Curr. Opin. Genet. Dev. 10:638-643[Medline].
DESSEN, P., M. ZAGULSK, R. DROMADKA, H. PLATTNER, and R. KISSMEHL et al., 2001 Paramecium genome survey: a pilot project. Trends Genet. 17:306-308[Medline].
DOYLE, D. A., J. MORAIS-CABRAL, R. A. PFUETZNER, A. KUO, and J. M. GULBIS et al., 1998 The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science 280:69-77
GANETZKY, B., G. A. ROBERTSON, G. F. WILSON, M. C. TRUDEAU, and S. A. TITUS, 1999 The Eag family of K+ channels in Drosophila and mammals. Ann. NY Acad. Sci. 868:356-369[Medline].
GUY, H. R., S. R. DURELL, J. WARMKE, R. DRYSDALE, and B. GANETZKY, 1991 Similarities in amino acid sequences of Drosophila eag and cyclic nucleotide-gated channels. Science 254:730
HAYNES, W. J., K.-Y. LING, Y. SAIMI, and C. KUNG, 1995 Induction of antibiotic resistance in Paramecium tetraurelia by the bacterial gene APH-3'-II. J. Eukaryot. Microbiol. 42:83-91[Medline].
HAYNES, W. J., B. VAILLANT, R. R. PRESTON, Y. SAIMI, and C. KUNG, 1998 The cloning by complementation of the pawn-A gene in Paramecium. Genetics 149:947-957
HAYNES, W. J., K.-Y. LING, R. R. PRESTON, Y. SAIMI, and C. KUNG, 2000 The cloning and molecular analysis of pawn-B in Paramecium tetraurelia. Genetics 155:1105-1117
HILLE, B., 1992 Ionic Channels of Excitable Membranes, Ed. 2. Sinauer Associates, Sunderland, MA.
HINRICHSEN, R. D., A. BURGESS-CASSLER, B. C. SOLTVEDT, T. HENNESSEY, and C. KUNG, 1986 Restoration by calmodulin of a Ca2+-dependent K+ current missing in a mutant of Paramecium. Science 232:503-506
JEGLA, T. and L. SALKOFF, 1995 A multigene family of novel K+ channels from Paramecium tetraurelia. Receptors Channels 3:51-60[Medline].
KIM, C. S., J. R. PREER, and B. POLISKY, 1992 Bacteriophage lambda DNA fragments replicate in the Paramecium macronucleus: absence of active copy number control. Dev. Genet. 13:97-102[Medline].
KINK, J. A., M. E. MALEY, R. R. PRESTON, K.-Y. LING, and M. A. WALLEN-FRIEDMAN et al., 1990 Mutations in Paramecium calmodulin indicate functional differences between the C-terminal and N-terminal lobes in vivo. Cell 62:165-174[Medline].
KUNG, C., S. Y. CHANG, Y. SATOW, J. VAN HOUTEN, and H. HANSMA, 1975 Genetic dissection of behavior in Paramecium. Science 188:898-904
LEFORT-TRAN, M., K. AUFDERHEIDE, M. POUPHILE, M. ROSSIGNOL, and J. BEISSON, 1981 Control of exocytotic processes: cytological and physiological studies of trichocyst mutants in Paramecium tetraurelia. J. Cell Biol. 88:301-311
LING, K.-Y., B. VAILLANT, W. J. HAYNES, Y. SAIMI, and C. KUNG, 1998 A comparison of internal eliminated sequences in the genes that encode two K+-channel isoforms in Paramecium tetraurelia. J. Eukaryot. Microbiol. 45:459-465[Medline].
MCCORMICK-GRAHAM, M., W. J. HAYNES, and D. P. ROMERO, 1997 Variable telomeric repeat synthesis in Paramecium tetraurelia is consistent with misincorporation by telomerase. EMBO J. 16:3233-3242[Medline].
MCCUE, L. A., K. A. MCDONOUGH, and C. E. LAWRENCE, 2000 Functional classification of cNMP-binding proteins and nucleotide cyclases with implications for novel regulatory pathways in Mycobacterium tuberculosis. Genome Res. 10:204-219
PREER, J. R., JR., L. B. PREER, B. M. RUDMAN, and A. J. BARNETT, 1985 Deviation from the universal code shown by the gene for surface protein 51A in Paramecium. Nature 314:188-190[Medline].
PRESTON, R. R., Y. SAIMI, and C. KUNG, 1990a Evidence for two K+ currents activated upon hyperpolarization of Paramecium tetraurelia. J. Membr. Biol. 115:41-50[Medline].
PRESTON, R. R., M. A. WALLEN-FRIEDMAN, Y. SAIMI, and C. KUNG, 1990b Calmodulin defects cause the loss of Ca2+ -dependent K+ currents in two pantophobiac mutants of Paramecium tetraurelia. J. Membr. Biol. 115:51-60[Medline].
PRESTON, R. R., Y. SAIMI, and C. KUNG, 1992 Calcium-dependent inactivation of the calcium current activated upon hyperpolarization of Paramecium tetraurelia. J. Gen. Physiol. 100:233-251
ROBERTSON, G. A., J. W. WARMKE, and B. GANETZKY, 1996 Potassium currents expressed from Drosophila and mouse eag cDNAs in Xenopus oocytes. Neuropharmacology 35:841-850[Medline].
RUIZ, F., L. VAYSSIE, C. KLOTZ, L. SPERLING, and L. MADEDDU, 1998 Homology-dependent gene silencing in Paramecium. Mol. Biol. Cell 9:931-943
SAIMI, Y. and C. KUNG, 1987 Behavioral genetics of Paramecium. Annu. Rev. Genet. 21:47-65[Medline].
SAIMI, Y. and C. KUNG, 1994 Ion channel regulation by calmodulin binding. FEBS Lett. 350:155-158[Medline].
SAIMI, Y., R. D. HINRICHSEN, M. FORTE, and C. KUNG, 1983 Mutant analysis shows that the Ca2+-induced K+ current shuts off one type of excitation in Paramecium. Proc. Natl. Acad. Sci. USA 80:5112-5116
SAMBROOK, J., E. F. FRITSCH and T. MANATIS, 1989 Molecular Cloning: A Laboratory Manuel. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHARP, P. A., 2001 RNA interference: 2001. Gene Dev. 15:485-490
SONNEBORN, T. M., 1970 Methods in Paramecium research, pp. 241339 in Methods in Cell Physiology, edited by D. M. PRESCOTT. Academic Press, New York.
WU, C. F., B. GANETZKY, F. N. HAUGLAND, and A. X. LIU, 1983 Potassium currents in Drosophila: different components affected by mutations of two genes. Science 220:1076-1078
ZHONG, Y. and C. F. WU, 1991 Alteration of four identified K+ currents in Drosophila muscle by mutations in eag. Science 252:1562-1564
This article has been cited by other articles:
![]() |
A. Schwab, P. Hanley, A. Fabian, and C. Stock Potassium Channels Keep Mobile Cells on the Go Physiology, August 1, 2008; 23(4): 212 - 220. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Loukin, M. M.-C. Kuo, X.-L. Zhou, W. J. Haynes, C. Kung, and Y. Saimi Microbial K+ Channels J. Gen. Physiol., May 31, 2005; 125(6): 521 - 527. [Full Text] [PDF] |
||||
![]() |
H. Lalucque and P. Silar Incomplete Penetrance and Variable Expressivity of a Growth Defect as a Consequence of Knocking Out Two K+ Transporters in the Euascomycete Fungus Podospora anserina Genetics, January 1, 2004; 166(1): 125 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Haynes, K.-Y. Ling, Y. Saimi, and C. Kung PAK Paradox: Paramecium Appears To Have More K+-Channel Genes than Humans Eukaryot. Cell, August 1, 2003; 2(4): 737 - 745. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Ling, K.-Y.
- Articles by Saimi, Y.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Ling, K.-Y.
- Articles by Saimi, Y.








