Expanding the Diversity of the IS630-Tc1-mariner Superfamily: Discovery of a Unique DD37E Transposon and Reclassification of the DD37D and DD39D Transposons

Corresponding author: Zhijian Tu, Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061., jaketu{at}vt.edu (E-mail)

Communicating editor: H. OCHMAN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

A novel transposon named ITmD37E was discovered in a wide range of mosquito species. Sequence analysis of multiple copies in three Aedes species showed similar terminal inverted repeats and common putative TA target site duplications. The ITmD37E transposases contain a conserved DD37E catalytic motif, which is unique among reported transposons of the IS630-Tc1-mariner superfamily. Sequence comparisons and phylogenetic analyses suggest that ITmD37E forms a novel family distinct from the widely distributed Tc1 (DD34E), mariner (DD34D), and pogo (DDxD) families in the IS630-Tc1-mariner superfamily. The inclusion in the phylogenetic analysis of recently reported transposons and transposons uncovered in our database survey provided revisions to previous classifications and identified two additional families, ITmD37D and ITmD39D, which contain DD37D and DD39D motifs, respectively. The above expansion and reorganization may open the doors to the discovery of related transposons in a broad range of organisms and help illustrate the evolution and structure-function relationships among these distinct transposases in the IS630-Tc1-mariner superfamily. The presence of intact open reading frames and highly similar copies in some of the newly characterized transposons suggests recent transposition. Studies of these novel families may add to the limited repertoire of transgenesis and mutagenesis tools for a wide range of organisms, including the medically important mosquitoes.

TRANSPOSABLE elements, or mobile genetic elements, are widely distributed in prokaryotic and eukaryotic genomes (KIDWELL and LISCH 2000 ). They have the ability to replicate and spread in the genomes as primarily "selfish" genetic units (DOOLITTLE and SAPIENZA 1980 ). On the other hand, recent evidence suggests that the self-replicating property may have enabled transposable elements to provide the genomes with potent agents to generate tremendous genetic plasticity (KIDWELL and LISCH 2000 ). Transposable elements can be classified by the mechanisms of their transposition as DNA-mediated or RNA-mediated elements. The transposition of RNA elements such as retrotransposons involves a reverse transcription step that generates cDNA from RNA transcripts of the RNA elements. The cDNA molecules are integrated in the genome with the help of the integrase, which is encoded by retrotransposons and retroviruses (e.g., MOORE et al. 1995 ). DNA-mediated elements such as P, hobo, Tc1, and mariner usually transpose through a cut-and-paste mechanism (e.g., PLASTERK et al. 1999 ). They are characterized by terminal inverted repeats (TIRs) flanking a gene encoding a transposase that catalyzes the transposition reaction. Despite the differences in the transposition mechanisms, the integrase of some RNA elements and the transposases of some DNA elements are thought to have evolved from a common origin (CAPY et al. 1997 ). Thus prokaryotic IS elements, eukaryotic Tc1 and mariner transposons, and eukaryotic retrotransposons and retroviruses form a megafamily that shares similar signature sequences or motifs in the catalytic domain of its respective transposase and integrase (CAPY et al. 1996 , CAPY et al. 1997 ). The common motif for this transposase-integrase megafamily is a conserved D(Asp)DE(Glu) or DDD catalytic triad. The DDE(D) triad is an essential part of the catalytic site and mutations in the triad abolish the transposase activity in in vivo excision assays (LOHE et al. 1997 ). The distances between the first two D's are variable while the distances between the last two residues in the catalytic triad are mostly invariable for a given transposon family in eukaryotes, indicating functional importance.

Among these divergent elements, the eukaryotic DNA transposon families Tc1 and mariner and the bacterial IS630 element and its relatives in prokaryotes and ciliates comprise a superfamily, the IS630-Tc1-mariner superfamily, which is based on overall sequence similarities and a common TA dinucleotide insertion target (HENIKOFF 1992 ; DOAK et al. 1994 ; ROBERTSON 1995 ; CAPY et al. 1996 ). On the basis of the analysis of the more conserved catalytic domain, a group of DNA transposons named pogo may also belong to the IS630-Tc1-mariner superfamily (SMIT and RIGGS 1996 ; CAPY et al. 1997 ). Within the IS630-Tc1-mariner superfamily, the IS630-like elements contain a DDxE motif where x indicates variable distance. However, excluding mutations in apparently defective copies, Tc1-like elements identified in fungi, invertebrates, and vertebrates all contain a DD34E motif while most mariner elements identified in flatworm, insects, and vertebrates contain a DD34D motif (Table 1). There are two reported exceptions to the DD34D motif in mariners: the DD37D motif in an insect mariner Bmmar1 and the DD39D motif in a soy bean mariner Soymar1 (ROBERTSON and ASPLUND 1996 ; JARVIK and LARK 1998 ). Transposons related to Bmmar1 and Soymar1 have also been found in rice and nematodes through database analysis (TARCHINI et al. 2000 ; LAMPE et al. 2001 ). Here we report the discovery of a novel family of transposons widely distributed in mosquitoes, which contain a unique DD37E motif. We provide a detailed analysis of the characteristics shared by the DD37D and DD39D transposons and suggest that some of the newly discovered DD37D transposons may have been transposing very recently. We present evidence suggesting that the DD37E, DD37D, and DD39D transposons make up three new families in the IS630-Tc1-mariner superfamily, defined by their respective catalytic motifs. We therefore name them I(S630)T(c1)m(ariner)D37E, ITmD37D, and ITmD39D. The above classification represents an expansion and reorganization of the IS630-Tc1-mariner superfamily. The significance of the discovery of the ITmD37E transposons in mosquitoes and the significance of the above classification have been discussed in light of the importance of the Tc1 and mariner families in current genetic and evolutionary studies.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Polymerase chain reaction and cloning:
Genomic DNA of adult Anopheles gambiae mosquitoes was isolated using DNAzol from Molecular Research Center (Cincinnati). An. gambiae DNA covering the entire open reading frame (ORF) of an ITmD37E transposon was obtained using polymerase chain reaction (PCR). The two primers, ATGGAAGCCGAAAGAAG GGA and GCAAATGTAGCGTTTTCTTCAT, were designed according to two short sequences (AL150661 and AL143513) in the An. gambiae sequence-tagged site (STS) database that match an ITmD37E element in the Ae. atropalpus mosquito (AY038030). PCR was performed as previously described (TU and HAGEDORN 1997 ). The PCR product was separated and cut from an agarose gel and purified using the Sephaglas Bandprep Kit from Amersham Pharmacia Biotech (Arlington Heights, IL). Purified PCR products were cloned in a pCR 2.1 vector using a TA cloning kit from Invitrogen (Carlsbad, CA). Multiple clones were sequenced as described below.

Screening of ZapExpress genomic libraries:
A genomic library prepared using DNA from the Ae. atropalpus mosquito and the ZapExpress vector (Stratagene Cloning Systems, La Jolla, CA) was provided by. J. Isoe in the laboratory of H. Hagedorn at the University of Arizona. Genomic libraries prepared using the same ZapExpress vector and DNA from the Ae. epactius and Ae. triseriatus mosquitoes were provided by R. Nussenzveig in the laboratory of M. Wells at the University of Arizona. The above libraries were constructed as described in TU 2000 . The average insert size of these libraries is 5 kb. The Ae. atropalpus and Ae. epactius libraries were screened using a PCR fragment probe corresponding to the C-terminal coding region of an ITmD37E transposon in Ae. atropalpus (AY038030, primers CGACCRTCCMGTAATGYTTTSGCC and CATTAG GCGGCGCACACC). The Ae. triseriatus library was screened using a probe corresponding to the entire ORF of an ITmD37E transposon in An. Gambiae, which was obtained by PCR as described above. The choice of probes was based on a preliminary genomic DNA dot blot analysis (data not shown). Both probes were single stranded as the labeling reactions were performed using asymmetric PCR amplifications. The labeling condition was the same as that described by TU and HAGEDORN 1997 , who used a digoxigenin-dUTP labeling mixture. MagnaGraph nylon membranes (Micron Separation, Westborough, MA) were used to lift the plaques. Hybridization was carried out at 55° as described in TU 2000 . The first set of washes was at 55° with 2x SSC and 0.1% SDS. The second set of washes was at 55° with 0.5x SSC and 0.1% SDS. The label was detected using an alkaline phosphatase-linked antidigoxigenin antibody and two phosphatase substrates, X-phosphate and nitroblue tetrazolium salt, following the protocol of Boehringer Mannheim Biochemicals (Indianapolis).

In vivo excision and DNA sequencing:
Inserts in ZapExpress clones were excised in vivo into the pBK-CMV phagemid vector, using the ExAssist helper phage from Stratagene Cloning Systems. Sequencing of the ZapExpress clones from genomic libraries and the TA clones from PCR amplification was done either at the sequencing facility at Virginia Tech using an automated sequencer (model 377, Applied Biosystems International, Foster City, CA) or in our laboratory using a 4200S Gene ReadIR sequencing instrument from Li-Cor (Lincoln, NE).

Sequence analysis and phylogenetic inference:
Searches for matches of either nucleotide or amino acid sequences in the database (nonredundant GenBank + EMBL + DDBJ + PDB) were done using Fasta of GCG (Genetics Computer Group, Madison, WI, version 10, 1999) and BLAST (ALTSCHUL et al. 1997 ). Pairwise comparisons were done using Gap or Bestfit of GCG. Multiple sequences were aligned using either ClustalW (THOMPSON et al. 1994 ) or Pileup of GCG. The parameters such as gap weight and gap length weight are described in the legend of the alignment figures. Profiles of aligned sequences were generated using Profilemake of GCG. Z scores of the comparisons between a sequence and a profile were obtained using Profilesearch of GCG with the SWISS-PROT database plus sequences of interest. Specific parameters are described in the footnote of Table 3. Phylogenetic trees were constructed using minimum evolution, neighbor-joining, and maximum-parsimony methods of PAUP* 4.0 b8 (SWOFFORD 2001 ). Specific parameters are described in the legend to Fig 4. Five hundred bootstrap replicates were used to assess the confidence in the grouping (FELSENSTEIN and KISHINO 1993 ). Pairwise identities of aligned sequences were converted from pairwise differences calculated using PAUP* 4.0 b8.

View larger version (56K): In this window In a new window Download PPT slide   Figure 1. (A) Nucleotide and deduced amino acid sequence of the consensus of six ITmD37E transposons in the rockpool mosquito Ae. atropalpus (AF377999 and AY038026–30). The boundaries between the putative TA target site duplication and the transposon are marked by arrows. The TIRs are underlined. The deduced amino acid sequence is shown under the nucleotide sequence. The amino acid residues of the DD37E triad are circled. (B) Multiple sequence alignment of the six ITmD37E elements of Ae. atropalpus and their flanking sequences. All sequences are identified by their accession numbers shown at the left. The sequences were aligned using ClustalW (THOMPSON et al. 1994 ; gap weight = 10; gap extension weight = 0.05). The majority of the internal sequences of ITmD37E, indicated by dots, are not shown. The two-sided arrow indicates the boundaries of ITmD37E. Putative TA target duplications are underlined. Nucleotide sequence identities obtained by pairwise comparisons between the six ITmD37E transposons are indicated. The identities were calculated using PAUP* 4.0 b8 (SWOFFORD 2001 ).

View larger version (45K): In this window In a new window Download PPT slide   Figure 2. (A) Multiple sequence alignment of the full-length C.elegans.ITmD37D1 transposons and their flanking sequences. The sequence alignment method and symbols are as described in Fig 1B. (B) Multiple sequence alignment of the full-length C.briggsae.ITmD37D1 transposons and their flanking sequences. The sequence alignment method and symbols are as described in Fig 1B. (C) Evidence of past mobility of C.elegans.ITmD37D1. Shown at the bottom is a repetitive sequence that contains an insertion of a C.elegans.ITmD37D1. The top sequences correspond to an unknown repetitive element. These repeats were found in the same cosmid sequence. The numbers in parentheses indicate the positions of the starting nucleotide. Dashed lines indicate gaps. Dots represent nucleotides that are not shown. C.elegansITmD37D1 is shown in the open box. The TA target duplication flanking the C.elegansITmD37D1 is underlined. The consensus of the nematode transposons has been used in a recent phylogenetic analysis (LAMPE et al. 2001 ). A–C establish the common characteristics of these transposons (e.g., TIRs and TA target duplications), the high sequence identities between different copies, and the evidence of past mobility.

View larger version (75K): In this window In a new window Download PPT slide   Figure 3. Multiple sequence alignment of ITmD37E, ITmD37D, and ITmD39D transposons and representatives of other families of the IS630-Tc1-mariner transposons (DOAK et al. 1994 ; CAPY et al. 1996 , CAPY et al. 1997 ; ROBERTSON and ASPLUND 1996 ). The accession numbers of all sequences are listed in Table 1. All transposase sequences were aligned using ClustalW (THOMPSON et al. 1994 ; gap weight = 5; gap extension weight = 0.05). The full alignment has been deposited in an EMBL alignment database (DS47334). Only regions surrounding the DDE(D) catalytic triad are shown here. The DDE(D) triad and other invariable residues are in boldface type while the triad is also marked by arrows. Note the change from D to A in G.palpalis.mar1, which is a defective element (ROBERTSON and ASPLUND 1996 ). pogo transposons were not included in this alignment because they cannot be reliably aligned with the IS630-Tc1-mariner elements when the entire transposase sequences are included. However, the more conserved catalytic domains of pogo have been successfully aligned to the catalytic domains of IS630-Tc1-mariner elements, which are described in the legend of Fig 4B. A highly defective Tc1-like transposon in the Pacific hagfish Eptatretus stouti named Tes1 was not included in the alignment because the N terminus cannot be reliably aligned and there is no alignable stop codon at the C terminus as indicated by ROBERTSON 1995 . Instead of having a DD34E motif as do the rest of Tc1 transposons, the defective Tes1 element contains a DD38E catalytic triad, which may be due to neutral mutations after the inactivation of this transposon.

View larger version (40K): In this window In a new window Download PPT slide   Figure 4. (A) Phylogenetic relationship between ITmD37E, ITmD37D, and ITmD39D transposons and representatives of other families of the IS630-Tc1-mariner transposons. The tree shown here is an unrooted phylogram constructed using a minimum evolution algorithm based on the full alignment described in Fig 3. Two additional methods, neighbor-joining and maximum parsimony, were also used. Confidence of the groupings was estimated using 500 bootstrap replications. The bootstrap values represent the percentage of times out of 500 bootstrap resamplings that branches were grouped together at a particular node. The first, second, and third numbers represent the bootstrap values derived from minimum evolution, neighbor-joining, and maximum-parsimony analyses, respectively. Only the values for major groupings are shown. Various colors indicate different clades. All phylogenetic analyses were conducted using PAUP 4.0 b8 (SWOFFORD 2001 ). Detailed methods are described in TU and HILL 1999 . (B) Phylogenetic relationship between different families of the IS630-Tc1-mariner transposons, including pogo, on the basis of the catalytic domains. The alignment used here was obtained using the catalytic domains of pogo and transposons shown in Fig 3 and Fig 4A. Although the precise boundaries of the catalytic domains have not been clearly defined, we used the C-terminal half of most of the transposases starting 20–30 amino acid residues upstream of the first D of the DDE(D) triad. The alignment method was the same as that described in Fig 3. All symbols and phylogenetic analysis methods are the same as those described in A.

The sequence data presented in this article have been submitted to the EMBL/GenBank Data Libraries under the accession nos. AF377999-8002 and AY038026-30. The alignment presented in this article has been submitted to the EMBL/GenBank Data Libraries under the accession no. DS47334.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Discovery of ITmD37E, a novel transposon containing a unique DD37E catalytic motif, in the rockpool mosquito Ae. atropalpus:
The first ITmD37E element was discovered fortuitously in a clone isolated from an Ae. atropalpus genomic library. The sequence of the entire clone has been deposited in GenBank (AY038030). To further characterize this element, we screened the Ae. atropalpus genomic library, using a digoxigenin-labeled single-stranded DNA probe corresponding to the 3' region of the putative transposon. Approximately 270 positive clones were obtained from a total of 30,000 clones. Five of these positive clones were sequenced and deposited in GenBank (AF377999 and AY038026–29). Fig 1A shows the nucleotide and the deduced amino acid sequence of the consensus of these six ITmD37E transposons. It contains an intact ORF encoding 336-amino-acid residues flanked by 27-bp TIRs and a putative TA target site duplication. The six copies showed 97.0–98.6% identity at the nucleotide level (Fig 1B), indicating relatively recent transposition. The boundaries of the ITmD37E elements are confirmed on the basis of sequence comparisons between the six clones because there is no sequence similarity outside the predicted transposon (Fig 1B). All six copies are flanked by putative TA target duplications. The similarities to Tc1-like transposases (E values = 1 x 10^-7 for some matches during BLAST searches) and the putative TA target duplications suggest that ITmD37E belongs to the IS630-Tc1-mariner superfamily (DOAK et al. 1994 ). As shown in Table 1, the IS630-Tc1-mariner superfamily of transposons contains either a DDE or a DDD catalytic triad. Excluding the apparently defective copies that accumulated many mutations, most, if not all, eukaryotic DDE transposons in the superfamily contain a DD34E motif (Table 1). However, as shown in Fig 1A, the ITmD37E transposon contains a unique DD37E catalytic motif. As shown by further analysis described below, these elements represent a novel family within the IS630-Tc1-mariner superfamily. The family is named ITmD37E to reflect its unique catalytic motif. The transposons found in Ae. atropalpus are named Ae.atropalpus.ITmD37E1, following a naming convention proposed for mariner (ROBERTSON and ASPLUND 1996 ) as described in Table 1. Instead of referring to an individual copy, the Arabic numeral refers to a distinct type of ITmD37E transposon in a species.

ITmD37E is conserved and widely distributed in mosquitoes:
The ITmD37E transposon was also discovered in other species of mosquitoes. Sequences of five and two full-length copies were obtained from clones isolated from Ae. epactius and Ae. triseriatus genomic libraries, respectively (see Table 1 for accession numbers of the copies included in the analysis). In addition, sequences of the entire ORFs of ITmD37E transposons were also obtained from a distantly related mosquito, An. gambiae, using PCR designed according to two short sequences (AL150661 and AL143513) in the An. gambiae STS database that match the known ITmD37E transposons. Eight PCR clones were sequenced, which showed 92.0–98.7% nucleotide identities to each other. These PCR clones are 93.7–97.9% and 89.4–95.0% identical to the two An. gambiae STS sequences, AL150661 and AL143513, respectively. The identities to AL143513 are slightly lower because only a 150-bp fragment at the end of AL143513 matches ITmD37E. The consensus for each species and a number of individual copies all contain an uninterrupted ORF encoding a 336-amino-acid transposase with the DD37E motif, although some copies contain stop codons while others contain an ORF extended by an extra 16-amino-acid residue. Therefore, the DD37E motif must have been an important functional motif in these mosquito transposons. As shown in Table 2, the full-length copies of these transposons share highly similar TIRs that are all flanked by putative TA target site duplications. Their transposase proteins are 72.8–94.3% identical, which was calculated using PAUP as described in MATERIALS AND METHODS. They seem to form two groups on the basis of sequence similarities: the Ae. atropalpus and Ae. epactius group and the Ae. triseriatus and An. gambiae group. There is >89% intragroup identity and 72.8–80.6% intergroup identity. Moreover, related transposons have been identified in nine additional species in five mosquito genera including Aedes, Armigeres, Culex, Toxorhynchites, and Anopheles, on the basis of DNA dot blot, genomic library screening, and preliminary sequence analysis (data not shown). Thus ITmD37E is widely distributed in mosquitoes.

Relative abundance of ITmD37E in different mosquito genomes:
There are 40 and 20 copies of ITmD37E in An. gambiae and Ae. triseriatus, respectively. The copy number in the An. gambiae haploid genome was extrapolated on the basis of the fact that two ITmD37E fragments were found in the An. gambiae STS database, which contains >14 Mb of genomic sequences (http://bioweb.pasteur.fr/BBMI), and that the An. gambiae genome is 270 Mb (BESANSKY and POWELL 1992 ). The copy number in Ae. triseriatus was estimated on the basis of the average insert size of the genomic library, the number of positive plaques, the total plaques screened, and the known genome size of Ae. triseriatus (RAI and BLACK 1999 ). The detailed calculation method is described in TU 2000 . Although the copy number of ITmD37E in Ae. atropalpus and Ae. epactius cannot be estimated because of unknown genome sizes, it is possible to assess the average frequency of ITmD37E in these genomes on the basis of the ratio of positive plaques over total plaques screened. In every 100 Mb of the genomic DNA, there are 1000 and 200 copies of ITmD37E in Ae. epactius and Ae. atropalpus, respectively. However, the frequencies of ITmD37E per 100 Mb genomic DNA are much lower in Ae. triseriatus and An. gambiae, 2 and 14 copies, respectively. Although the estimation for the three Aedes species may be influenced by the possible bias of the genomic libraries, the >100-fold differences observed here are probably large enough to override the potential bias. Thus the relative abundance of ITmD37E appears to be correlated with the groupings described above. However, it is not yet clear whether this observation can be applied to ITmD37E transposons in other mosquitoes.

Transposons containing conserved DD37D and DD39D motifs:
To understand the evolution of the unique ITmD37E transposons in the IS630-Tc1-mariner superfamily, a database survey that revealed additional diversity was conducted. First, four additional nematode transposons containing a DD37D catalytic motif, similar to a previously described insect mariner Bmmar1 (ROBERTSON and ASPLUND 1996 ), were identified and included in our analyses described below (Table 1 and Table 2). Some of these nematode transposons have been noted as members of the mori (Bmmar1) subfamily of the mariner family in a very recent analysis including Tc1 and different subfamilies of the mariner elements (LAMPE et al. 2001 ). Similar TIRs (Table 2) and transposases (30.0–47.1% amino acid identities) confirm that these nematode DD37D transposons and Bmmar1 constitute a distinct group. In addition, a transposon containing a DD39D motif similar to Soymar1, a previously described soy bean mariner (JARVIK and LARK 1998 ), was identified in Arabidopsis thaliana (Table 1). These transposons and their relatives in rice (Table 1; TARCHINI et al. 2000 ) also form a distinct group on the basis of similar TIRs (Table 2) and transposases (42.5–52.7% identities). However, further analyses described below indicate that instead of being divergent subfamilies of the mariner family (ROBERTSON and ASPLUND 1996 ; JARVIK and LARK 1998 ; LAMPE et al. 2001 ), the DD37D and DD39D transposons are likely two new families distinct from mariner. These elements are thus named ITmD37D and ITmD39D, respectively, using the same naming convention described for ITmD37E (Table 1). Like the ITmD37E elements, all full-length ITmD37D and ITmD39D transposons are flanked by putative TA target duplications.

As shown in Fig 2, two of the ITmD37D elements, C.elegans.ITmD37D1 and C.briggsae.ITmD37D1, have probably been active very recently because comparisons between different copies within each of the transposons showed >99.5% nucleotide sequence identity. The boundaries of C.elegans.ITmD37D1 and C.briggsae.ITmD37D1 were confirmed by multiple sequence alignments of different copies shown in Fig 2A and Fig B. Evidence of previous mobility of C.elegans.ITmD37D1 is also presented by the identification of an insertion of C.elegans.ITmD37D1 in an unknown repetitive sequence (Fig 2C). This also confirmed that the flanking TA nucleotides are indeed the target site duplication.

Comparisons between the ITmD37E, ITmD37D, and ITmD39D transposases and the protein sequence profiles of the IS630-Tc1-mariner superfamily:
According to BLAST searches, ITmD37E and ITmD37D are most similar to a Drosophila Tc1 element Minos (Z29098; E values are 1 x 10^-7 and 1 x 10^-27, respectively), while ITmD39D is most similar to a medfly mariner (U40493; E value, 4 x 10^-6). Systematic analyses have been performed between individual sequences of the three new groups and the profiles of the IS630-Tc1-mariner superfamily and its member families, using a Profilesearch approach described by DOAK et al. 1994 . Comparisons between the profile of the IS630-Tc1-mariner superfamily and the ITmD37E, ITmD37D, and ITmD39D elements gave Z scores from 6.8 to 17.5, which are within the range of scores of comparisons between the superfamily profile and known IS630-Tc1-mariner elements (Table 3). These scores are all higher than the scores of the comparisons between different profiles and pogo transposons (Table 3), which are possibly divergent members of the IS630-Tc1-mariner superfamily (CAPY et al. 1996 , CAPY et al. 1997 ; SMIT and RIGGS 1996 ). The profile analysis also indicated that both ITmD37E and ITmD37D are probably more similar to Tc1 than to mariner or IS630 (Table 3). It is clear that all of the three new groups are members of the IS630-Tc1-mariner superfamily.

ITmD37E, ITmD37D, and ITmD39D transposons form three distinct families in the IS630-Tc1-mariner superfamily:
As described above, ITmD37E, ITmD37D, and ITmD39D transposons form their respective groups on the basis of similar transposases and relatively conserved TIRs. Phylogenetic analysis on the basis of the full-length alignment of representatives of all known IS630-Tc1-mariner transposons (Fig 3) strongly supports the idea that ITmD37E, ITmD37D, and ITmD39D form three clades distinct from Tc1, mariner, Ant1-Hupfer1, ciliate transposons, and the IS630-like elements (Fig 4A). The bootstrap values obtained using three different methods for the ITmD37E, ITmD37D, and ITmD39D clades are all >96%. While Tc1 (DD34E) and mariner (DD34D) also form their respective clades well supported by bootstrap analysis, Ant1-Hupfer1 (DD34E), ciliate transposons (DD34E), and the IS630-like elements (DDxE) form a less robust clade (the DDxE clade and clade VI) as indicated by low bootstrap values. All of the above clades except DDxE are also supported by bootstrap when pogo elements are included in an analysis based on the more conserved catalytic domains (Fig 4B). To study the relationship between the different clades, these two trees are rooted using the prokaryotic IS elements. In both trees, ITmD37E is a distinct clade. The status of ITmD37E is also reflected by its unique TIRs. As shown in Fig 4A, ITmD37D is grouped with Tc1 instead of mariner. This relationship is supported by bootstrap in both neighbor-joining and minimum evolution analysis. ITmD37D and Tc1 are also grouped together in the most parsimonious trees (data not shown), although the bootstrap value derived from the parsimony analysis is <50%. In addition, the ITmD37D and Tc1 grouping is supported by bootstrap analyses using all three methods in the tree, including the pogo elements (Fig 4B). The relationship between ITmD37D and Tc1 is also consistent with the similarity between their TIRs (Table 2). Thus we propose that the ITmD37D transposons, including Bmmar1, are not a basal subfamily of mariner (ROBERTSON and ASPLUND 1996 ). Instead, they are a distinct family related to the Tc1 transposons. The relationship between ITmD39D and other transposons is less certain. Although ITmD39D is closer to mariner as shown in Fig 4A, the relationship was not supported by parsimony analysis. Moreover, as shown in the tree including the pogo elements (Fig 4B), the grouping between ITmD39D and mariner collapsed and ITmD39D is related to pogo instead. Moreover, the TIRs of ITmD39D are completely different from the TIRs of mariner. In light of the uncertainty of the phylogenetic relationship between ITmD39D and mariner transposases and their different catalytic motifs and TIRs, we propose that ITmD39D may also be considered as a distinct family.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Expansion and reorganization of the IS630-Tc1-mariner superfamily on the basis of conserved catalytic motifs:
In this study we reported the discovery of ITmD37E, a novel family of transposons in the IS630-Tc1-mariner superfamily, which is characterized by its unique DD37E catalytic motif and TIRs. We also identified two additional families, ITmD37D and ITmD39D, which contain their respective conserved DD37D and DD39D catalytic motifs and TIRs (Table 2 and Fig 3 and Fig 4). The classification of ITmD37D and ITmD39D as two distinct families represents a revision of earlier studies that reported the original discoveries of the founding members of the two families Bmmar1 (DD37D; ROBERTSON and ASPLUND 1996 ) and Soymar1 (DD39D; JARVIK and LARK 1998 ). It was suggested that Bmmar1 and Soymar1 may be subfamilies of mariner, although the distinction between these elements and the rest of the mariner elements was clearly noted (ROBERTSON and ASPLUND 1996 ; JARVIK and LARK 1998 ). According to the analysis presented here, the IS630-Tc1-mariner superfamily can be organized in six families that include ITmD37E, ITmD37D, ITmD39D, Tc1, mariner, and pogo and an unresolved clade VI that includes bacterial IS630-like elements and some fungal and ciliate transposons (Fig 4). Further determination of the status and relationship of the transposons in clade VI may require accumulation of more related transposon sequences in a diverse range of organisms. The above classification is supported by bootstrap analysis with or without pogo elements (Fig 4). pogo is an interesting case as it has a unique N-terminal DNA-binding domain and a long C-terminal domain rich in acidic residues, although its catalytic domain is related to IS630-Tc1-mariner transposons (SMIT and RIGGS 1996 ). In addition, the distance between the last two D's of the catalytic triad of the pogo family is variable. The classification of Tc1, mariner, and the three new families based on phylogenetic analysis is consistent with the grouping by their respective catalytic triad. It should be noted, however, not all DD34E transposons belong to the Tc1 family and phylogenetic evidence always needs to be included in the classification of a new transposon. The close relationship between ITmD37D and Tc1 suggests a more complex evolutionary process from their common ancestor to these two current motifs, which may require more than a simple change from a D to an E in the catalytic triad or vice versa. This is consistent with the result that a point mutation from DD34D to DD34E abolished the transposase activity of a mariner in in vivo excision assays (LOHE et al. 1997 ). Although a few other interfamily relationships were indicated, none was supported in both phylogenetic trees (Fig 4). Finally, the diversity of the catalytic motifs and their conservation within each family raised an interesting question about the structure-function relationship of these distinct, yet related, transposases. Answers to such a biophysical question may help illustrate the evolutionary process that leads to the expansion of such a diverse group of transposons in the IS630-Tc1-mariner superfamily.

Distribution and evolutionary implications:
ITmD37E transposons have been found in all 13 species in five genera of mosquitoes examined, including the Aedes and Anopheles genera. Although the evolutionary distance between Aedes and Anopheles is among the longest in mosquitoes (ISOE 2000 ), Ae.triseriatus.ITmD37E1 is more closely related to An.gambiae.ITmD37E1 than the ITmD37E transposons in two other Aedes species, Ae.atropalpus.ITmD37E1 and Ae.epactius.ITmD37E1 (Fig 4). We suggest that this may reflect the existence of two subfamilies because our preliminary data suggest the existence of a second ITmD37E transposon more closely related to Ae.triseriatus.ITmD37E1 in both Ae. atropalpus and Ae. epactius (data not shown). It remains to be determined whether the relatively high sequence similarity between Ae.triseriatus.ITmD37E1 and An.gambiae.ITmD37E1 reflects high selection pressure on the transposase proteins or possible horizontal transfer events. Such questions may be addressed by a systematic survey of the ITmD37E transposons in a wide range of mosquitoes, which may shed light on the evolutionary dynamics of these transposons in this medically important insect family. The independent family status of ITmD37E in a superfamily that has a broad host range suggests that ITmD37E is likely a family of ancient origin. It may be reasonable to expect a broad distribution of ITmD37E in other insects and perhaps other invertebrates. Although no similar transposons have been found in the Drosophila melanogaster genome database, we cannot exclude their existence in D. melanogaster because a large fraction of the repeat-rich regions has not been sequenced (MYERS et al. 2000 ). In addition, given the nature of transposon-host interaction, we do not expect ubiquitous distribution of transposons in a particular taxonomic group. According to the current compilation, the ITmD39D family is limited to the flowering plants while the ITmD37D family is found in both nematodes and insects, two highly divergent invertebrate groups. As data from genomic analysis accumulate, this distribution could be expanded. Nonetheless, the identification of related transposons in ITmD37D and ITmD39D families in diverse organisms is opening the door for a broad survey based on the identification of conserved amino acid residues that can be used to design primers for PCR (ROBERTSON and MACLEOD 1993 ). In fact, stretches of conserved amino acid residues do exist in both families (Fig 3). Evolution of Tc1 and mariner has been a topic of extensive studies including their regulation, horizontal transmission, and interactions with the host genomes. It is foreseeable that the rapid accumulation of genomic sequence data from a wide range of organisms in combination with the deliberate PCR and genomic survey will greatly facilitate the discovery of many more transposons in the three distinct families described here. Such expansion will provide wonderful opportunities in a wide range of organisms to study the evolutionary dynamics of these individual families as well as the IS630-Tc1-mariner superfamily in general.

Potential applications:
The identification of a widespread DNA transposon in mosquitoes may have potentially important applications. Transformation tools are being developed for the genetic manipulation of mosquitoes. Such tools are critical components of the genetic strategy to control mosquito-transmitted diseases by creating disease-resistant mosquitoes through the introduction of refractory genes using DNA transposons (ASHBURNER et al. 1998 ). A few mosquito species have been successfully transformed using exogenous DNA transposons including mariner and Tc1-like transposons (ATKINSON et al. 2001 ). Although no evidence of active transposition has been obtained for ITmD37E, the relatively high sequence similarity within some of the species and the identification of intact ORFs suggest that it may be a worthy effort to identify or to screen for active ITmD37E transposons, using methods described by LAMPE et al. 1999 . The seemingly ubiquitous distribution of ITmD37E in mosquitoes indicates its potentially broad utility as a transformation tool once active elements are obtained. Although interaction between endogenous elements and the ITmD37E vector may be a potential problem, a recent study on the lack of interaction between relatively closely related mariner elements (LAMPE et al. 2001 ), and the fact that different types of ITmD37E can coexist in the same mosquito species, indicate that the problem can be mitigated. Multiple subfamilies of relatively closely related P elements have also been found to coexist in a few Drosophila species (CLARK and KIDWELL 1997 ). In addition to the potential for the direct application described above, studies of these mosquito transposons may help understand their regulation, long-term activity, and spread in mosquito populations, which will be important for the long-term success of the genetic strategy to control mosquito-transmitted diseases.

Two other transposons described in this study also showed promise as candidates for the development of transformation tools. Ten different copies of C.elegans. ITmD37D1 showed 99.3–100% identity while three different copies of C.briggsae.ITmD37D1 showed 99.4–99.5% identity. This level of sequence identity is similar to the 99.6–100% identity that we found for the 19 full-length copies of a currently active Caenorhabditis elegans transposon Tc3 (COLLINS et al. 1989 ). Thus it is possible that these two ITmD37D transposons are either still active or at least recently active. Given the possible broad distribution of ITmD37D transposons in nematodes and insects, transformation tools developed on the basis of the above two transposons have the potential to be widely applicable. Continued discovery and analysis of transposons in the three distinct families described here may provide additional transformation systems to the current repertoire of transposon-based broad-range transgenesis and mutagenesis tools, a large fraction of which has been derived from Tc1 and mariner transposons (e.g., GUEIROS-FILHO and BEVERLEY 1997 ; RAZ et al. 1997 ; IZSVAK et al. 2000 ).

	ACKNOWLEDGMENTS

We thank Pierre Capy and Hugh Robertson for insightful comments. This work was supported by a National Institutes of Health grant AI-42121 to Z. Tu and by the Agricultural Experimental Station at Virginia Tech.

Manuscript received June 25, 2001; Accepted for publication August 27, 2001.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHÄFFER, J. ZHANG, and Z. ZHANG et al., 1997  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].

ASHBURNER, M., M. A. HOY, and J. J. PELOQUIN, 1998  Prospects for the genetic transformation of arthropods. Insect Mol. Biol. 7:201-213[Medline].

ATKINSON, P. W., A. C. PINKERTON, and D. A. O'BROCHTA, 2001  Genetic transformation systems in insects. Annu. Rev. Entomol. 46:317-346[Medline].

BESANSKY, N. J. and J. R. POWELL, 1992  Reassociation kinetics of Anopheles gambiae (Diptera: Culicidae) DNA. J. Med. Entomol. 29:125-128[Medline].

CAPY, P., R. VITALIS, T. LANGIN, D. HIGUET, and C. BAZIN, 1996  Relationships between transposable elements based upon the integrase-transposase domains: Is there a common ancestor? J. Mol. Evol. 42:359-368[Medline].

CAPY, P., T. LANGIN, D. HIGUET, P. MAURER, and C. BAZIN, 1997  Do the integrases of LTR-retrotransposons and class II element transposases have a common ancestor? Genetica 100:63-72[Medline].

CLARK, J. B. and M. G. KIDWELL, 1997  A phylogenetic perspective on P transposable element evolution in Drosophila. Proc. Natl. Acad. Sci. USA 94:11428-11433[Abstract/Free Full Text].

COLLINS, J., E. FORBES, and P. ANDERSON, 1989  The Tc3 family of transposable genetic elements in Caenorhabditis elegans. Genetics 121:47-55[Abstract/Free Full Text].

DOAK, T. G., F. P. DOERDER, C. L. JAHN, and G. HERRICK, 1994  A proposed superfamily of transposase genes: transposon-like elements in ciliated protozoa and a common "D35E" motif. Proc. Natl. Acad. Sci. USA 91:942-946[Abstract/Free Full Text].

DOOLITTLE, W. F. and C. SAPIENZA, 1980  Selfish genes, the phenotype paradigm and genome evolution. Science 284:601-603[Free Full Text].

FELSENSTEIN, J. and H. KISHINO, 1993  Is there something wrong with the bootstrap on phylogenies? A reply to Hillis and Bull. Syst. Biol. 42:193-200.

GUEIROS-FILHO, F. J. and S. M. BEVERLEY, 1997  Trans-kingdom transposition of the Drosophila element mariner within the protozoan Leishmania. Science 276:1716-1719[Abstract/Free Full Text].

HENIKOFF, S., 1992  Detection of Caenorhabditis transposon homologs in diverse organisms. New Biol. 4:382-388[Medline].

ISOE, J., 2000 Comparative analysis of the vitellogenin genes of the Culicidae. Ph.D. Thesis, The University of Arizona, Tucson, AZ.

IZSVAK, Z., Z. IVICS, and R. H. PLASTERK, 2000  Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. J. Mol. Biol. 302:93-102[Medline].

JARVIK, T. and K. G. LARK, 1998  Characterization of Soymar1, a mariner element in soybean. Genetics 149:1569-1574[Abstract/Free Full Text].

KIDWELL, M. G. and D. M. LISCH, 2000  Transposable elements and host genome evolution. Trends Ecol. Evol. 15:95-99[Medline].

LAMPE, D. J., B. J. AKERLEY, E. J. RUBIN, J. J. MEKALANOS, and H. M. ROBERTSON, 1999  Hyperactive transposase mutants of the Himar1 mariner transposon. Proc. Natl. Acad. Sci. USA 96:11428-11433[Abstract/Free Full Text].

LAMPE, D. J., K. K. WALDEN, and H. M. ROBERTSON, 2001  Loss of transposase-DNA interaction may underlie the divergence of mariner family transposable elements and the ability of more than one mariner to occupy the same genome. Mol. Biol. Evol. 18:954-961[Abstract/Free Full Text].

LOHE, A. R., D. DE AGUIAR, and D. L. HARTL, 1997  Mutations in the mariner transposase: the D,D(35)E consensus sequence is nonfunctional. Proc. Natl. Acad. Sci. USA 94:1293-1297[Abstract/Free Full Text].

MAURER, P., A. REJASSE, P. CAPY, T. LANGIN, and G. RIBA, 1997  Isolation of the transposable element hupfer from the entomopathogenic fungus Beauveria bassiana by insertion mutagenesis of the nitrate reductase structural gene. Mol. Gen. Genet. 256:195-202[Medline].

MOORE, S. P., M. POWERS, and D. J. GARFINKEL, 1995  Substrate specificity of Ty1 integrase. J. Virol. 69:4683-4692[Abstract].

MYERS, E. W., G. G. SUTTON, A. L. DELCHER, I. M. DEW, and D. P. FASULO et al., 2000  A whole-genome assembly of Drosophila. Science 287:2196-2204[Abstract/Free Full Text].

PLASTERK, R. H. A., Z. IZSVAK, and Z. IVICS, 1999  Resident aliens the Tc1/mariner superfamily of transposable elements. Trends Genet. 15:326-332[Medline].

RAI, K. S. and W. C. I. V. BLACK, 1999  Mosquito genomes: structure, organization, and evolution. Adv. Genet. 41:1-33[Medline].

RAZ, E., H. G. A. M. VAN LUENEN, B. SCHAERRINGER, R. H. A. PLASTERK, and W. DRIEVER, 1997  Transposition of the nematode Caenorhabditis elegans Tc3 element in the zebrafish Danio rerio. Curr. Biol. 8:82-88.

ROBERTSON, H., 1995  The Tc1-mariner superfamily of transposons in animals. J. Insect Physiol. 41:99-105.

ROBERTSON, H. M. and M. L. ASPLUND, 1996  Bmmar1: a basal lineage of the mariner family of transposable elements in the silkworm moth, Bombyx mori.. Insect Biochem. Mol. Biol. 26:945-954[Medline].

ROBERTSON, H. M. and E. G. MACLEOD, 1993  Five major subfamilies of mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol. Biol. 2:125-139[Medline].

SMIT, A. F. A. and A. D. RIGGS, 1996  Tiggers and other DNA transposon fossils in the human genome. Proc. Natl. Acad. Sci. USA 93:1443-1448[Abstract/Free Full Text].

SWOFFORD, D. L., 2001 PAUP*, version 4.0 b8 (a commercial test version; completed version 4.0 to be distributed by Sinauer, Sunderland, MA).

TARCHINI, R., P. BIDDLE, R. WINELAND, S. TINGEY, and A. RAFALSKI, 2000  The complete sequence of 340 kb of DNA around the rice Adh1-adh2 region reveals interrupted colinearity with maize chromosome 4. Plant Cell 12:381-391[Abstract/Free Full Text].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

TU, Z., 2000  Molecular and evolutionary analysis of two divergent subfamilies of a novel miniature inverted repeat transposable element in the yellow fever mosquito, Aedes aegypti. Mol. Biol. Evol. 17:1313-1325[Abstract/Free Full Text].

TU, Z. and H. H. HAGEDORN, 1997  Biochemical, molecular, and phylogenetic analysis of pyruvate carboxylase in the yellow fever mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 27:133-147[Medline].

TU, Z. and J. J. HILL, 1999  MosquI, a novel family of mosquito retrotransposons distantly related to the Drosophila I factors, may consist of elements of more than one origin. Mol. Biol. Evol. 16:1675-1686[Abstract].

This article has been cited by other articles:

				W. Bao, M. G. Jurka, V. V. Kapitonov, and J. Jurka New Superfamilies of Eukaryotic DNA Transposons and Their Internal Divisions Mol. Biol. Evol., May 1, 2009; 26(5): 983 - 993. [Abstract] [Full Text] [PDF]

				M. D. Lorenzen, A. Gnirke, J. Margolis, J. Garnes, M. Campbell, J. J. Stuart, R. Aggarwal, S. Richards, Y. Park, and R. W. Beeman The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon PNAS, July 22, 2008; 105(29): 10085 - 10089. [Abstract] [Full Text] [PDF]

				B. S. Garrison, S. R. Yant, J. G. Mikkelsen, and M. A. Kay Postintegrative Gene Silencing within the Sleeping Beauty Transposition System Mol. Cell. Biol., December 15, 2007; 27(24): 8824 - 8833. [Abstract] [Full Text] [PDF]

				J. K. Biedler, H. Shao, and Z. Tu Evolution and Horizontal Transfer of a DD37E DNA Transposon in Mosquitoes Genetics, December 1, 2007; 177(4): 2553 - 2558. [Abstract] [Full Text] [PDF]

				G. Yang, C. F. Weil, and S. R. Wessler A Rice Tc1/Mariner-Like Element Transposes in Yeast PLANT CELL, October 1, 2006; 18(10): 2469 - 2478. [Abstract] [Full Text] [PDF]

				E. De Gregorio, G. Silvestro, M. Petrillo, M. S. Carlomagno, and P. P. Di Nocera Enterobacterial Repetitive Intergenic Consensus Sequence Repeats in Yersiniae: Genomic Organization and Functional Properties J. Bacteriol., December 1, 2005; 187(23): 7945 - 7954. [Abstract] [Full Text] [PDF]

				E. J. Pritham, C. Feschotte, and S. R. Wessler Unexpected Diversity and Differential Success of DNA Transposons in Four Species of Entamoeba Protozoans Mol. Biol. Evol., September 1, 2005; 22(9): 1751 - 1763. [Abstract] [Full Text] [PDF]

				I. R. Arkhipova and M. Meselson Diverse DNA transposons in rotifers of the class Bdelloidea PNAS, August 16, 2005; 102(33): 11781 - 11786. [Abstract] [Full Text] [PDF]

				C. Feschotte, M. T. Osterlund, R. Peeler, and S. R. Wessler DNA-binding specificity of rice mariner-like transposases and interactions with Stowaway MITEs Nucleic Acids Res., April 14, 2005; 33(7): 2153 - 2165. [Abstract] [Full Text] [PDF]

				Y. Tsuge, K. Ninomiya, N. Suzuki, M. Inui, and H. Yukawa A new insertion sequence, IS14999, from Corynebacterium glutamicum Microbiology, February 1, 2005; 151(2): 501 - 508. [Abstract] [Full Text] [PDF]

				J. C. Silva, F. Bastida, S. L. Bidwell, P. J. Johnson, and J. M. Carlton A Potentially Functional Mariner Transposable Element in the Protist Trichomonas vaginalis Mol. Biol. Evol., January 1, 2005; 22(1): 126 - 134. [Abstract] [Full Text] [PDF]

				C. Feschotte Merlin, a New Superfamily of DNA Transposons Identified in Diverse Animal Genomes and Related to Bacterial IS1016 Insertion Sequences Mol. Biol. Evol., September 1, 2004; 21(9): 1769 - 1780. [Abstract] [Full Text] [PDF]

				C. Feschotte, L. Swamy, and S. R. Wessler Genome-Wide Analysis of mariner-Like Transposable Elements in Rice Reveals Complex Relationships With Stowaway Miniature Inverted Repeat Transposable Elements (MITEs) Genetics, February 1, 2003; 163(2): 747 - 758. [Abstract] [Full Text] [PDF]

				C. Claudianos, J. Brownlie, R. Russell, J. Oakeshott, and S. Whyard maT--A Clade of Transposons Intermediate Between mariner and Tc1 Mol. Biol. Evol., December 1, 2002; 19(12): 2101 - 2109. [Abstract] [Full Text] [PDF]