- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Shao, H.
- Articles by Tu, Z.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Shao, H.
- Articles by Tu, Z.
Expanding the Diversity of the IS630-Tc1-mariner Superfamily: Discovery of a Unique DD37E Transposon and Reclassification of the DD37D and DD39D Transposons
Hongguang Shaoa and Zhijian Tuaa Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061
Corresponding author: Zhijian Tu, Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061., jaketu{at}vt.edu (E-mail)
Communicating editor: H. OCHMAN
| ABSTRACT |
|---|
A novel transposon named ITmD37E was discovered in a wide range of mosquito species. Sequence analysis of multiple copies in three Aedes species showed similar terminal inverted repeats and common putative TA target site duplications. The ITmD37E transposases contain a conserved DD37E catalytic motif, which is unique among reported transposons of the IS630-Tc1-mariner superfamily. Sequence comparisons and phylogenetic analyses suggest that ITmD37E forms a novel family distinct from the widely distributed Tc1 (DD34E), mariner (DD34D), and pogo (DDxD) families in the IS630-Tc1-mariner superfamily. The inclusion in the phylogenetic analysis of recently reported transposons and transposons uncovered in our database survey provided revisions to previous classifications and identified two additional families, ITmD37D and ITmD39D, which contain DD37D and DD39D motifs, respectively. The above expansion and reorganization may open the doors to the discovery of related transposons in a broad range of organisms and help illustrate the evolution and structure-function relationships among these distinct transposases in the IS630-Tc1-mariner superfamily. The presence of intact open reading frames and highly similar copies in some of the newly characterized transposons suggests recent transposition. Studies of these novel families may add to the limited repertoire of transgenesis and mutagenesis tools for a wide range of organisms, including the medically important mosquitoes.
TRANSPOSABLE elements, or mobile genetic elements, are widely distributed in prokaryotic and eukaryotic genomes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Among these divergent elements, the eukaryotic DNA transposon families Tc1 and mariner and the bacterial IS630 element and its relatives in prokaryotes and ciliates comprise a superfamily, the IS630-Tc1-mariner superfamily, which is based on overall sequence similarities and a common TA dinucleotide insertion target (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
| MATERIALS AND METHODS |
|---|
Polymerase chain reaction and cloning:
Genomic DNA of adult Anopheles gambiae mosquitoes was isolated using DNAzol from Molecular Research Center (Cincinnati). An. gambiae DNA covering the entire open reading frame (ORF) of an ITmD37E transposon was obtained using polymerase chain reaction (PCR). The two primers, ATGGAAGCCGAAAGAAG GGA and GCAAATGTAGCGTTTTCTTCAT, were designed according to two short sequences (AL150661 and AL143513) in the An. gambiae sequence-tagged site (STS) database that match an ITmD37E element in the Ae. atropalpus mosquito (AY038030). PCR was performed as previously described (![]()
Screening of
ZapExpress genomic libraries:
A genomic library prepared using DNA from the Ae. atropalpus mosquito and the
ZapExpress vector (Stratagene Cloning Systems, La Jolla, CA) was provided by. J. Isoe in the laboratory of H. Hagedorn at the University of Arizona. Genomic libraries prepared using the same
ZapExpress vector and DNA from the Ae. epactius and Ae. triseriatus mosquitoes were provided by R. Nussenzveig in the laboratory of M. Wells at the University of Arizona. The above libraries were constructed as described in ![]()
5 kb. The Ae. atropalpus and Ae. epactius libraries were screened using a PCR fragment probe corresponding to the C-terminal coding region of an ITmD37E transposon in Ae. atropalpus (AY038030, primers CGACCRTCCMGTAATGYTTTSGCC and CATTAG GCGGCGCACACC). The Ae. triseriatus library was screened using a probe corresponding to the entire ORF of an ITmD37E transposon in An. Gambiae, which was obtained by PCR as described above. The choice of probes was based on a preliminary genomic DNA dot blot analysis (data not shown). Both probes were single stranded as the labeling reactions were performed using asymmetric PCR amplifications. The labeling condition was the same as that described by ![]()
![]()
In vivo excision and DNA sequencing:
Inserts in
ZapExpress clones were excised in vivo into the pBK-CMV phagemid vector, using the ExAssist helper phage from Stratagene Cloning Systems. Sequencing of the
ZapExpress clones from genomic libraries and the TA clones from PCR amplification was done either at the sequencing facility at Virginia Tech using an automated sequencer (model 377, Applied Biosystems International, Foster City, CA) or in our laboratory using a 4200S Gene ReadIR sequencing instrument from Li-Cor (Lincoln, NE).
Sequence analysis and phylogenetic inference:
Searches for matches of either nucleotide or amino acid sequences in the database (nonredundant GenBank + EMBL + DDBJ + PDB) were done using Fasta of GCG (Genetics Computer Group, Madison, WI, version 10, 1999) and BLAST (![]()
![]()
![]()
![]()
|
|
|
|
|
|
The sequence data presented in this article have been submitted to the EMBL/GenBank Data Libraries under the accession nos. AF377999-8002 and AY038026-30. The alignment presented in this article has been submitted to the EMBL/GenBank Data Libraries under the accession no. DS47334.
| RESULTS |
|---|
Discovery of ITmD37E, a novel transposon containing a unique DD37E catalytic motif, in the rockpool mosquito Ae. atropalpus:
The first ITmD37E element was discovered fortuitously in a clone isolated from an Ae. atropalpus genomic library. The sequence of the entire clone has been deposited in GenBank (AY038030). To further characterize this element, we screened the Ae. atropalpus genomic library, using a digoxigenin-labeled single-stranded DNA probe corresponding to the 3' region of the putative transposon. Approximately 270 positive clones were obtained from a total of 30,000 clones. Five of these positive clones were sequenced and deposited in GenBank (AF377999 and
AY03802629). Fig 1A shows the nucleotide and the deduced amino acid sequence of the consensus of these six ITmD37E transposons. It contains an intact ORF encoding 336-amino-acid residues flanked by 27-bp TIRs and a putative TA target site duplication. The six copies showed 97.098.6% identity at the nucleotide level (Fig 1B), indicating relatively recent transposition. The boundaries of the ITmD37E elements are confirmed on the basis of sequence comparisons between the six clones because there is no sequence similarity outside the predicted transposon (Fig 1B). All six copies are flanked by putative TA target duplications. The similarities to Tc1-like transposases (E values = 1 x 10-7 for some matches during BLAST searches) and the putative TA target duplications suggest that ITmD37E belongs to the IS630-Tc1-mariner superfamily (![]()
![]()
ITmD37E is conserved and widely distributed in mosquitoes:
The ITmD37E transposon was also discovered in other species of mosquitoes. Sequences of five and two full-length copies were obtained from clones isolated from Ae. epactius and Ae. triseriatus genomic libraries, respectively (see Table 1 for accession numbers of the copies included in the analysis). In addition, sequences of the entire ORFs of ITmD37E transposons were also obtained from a distantly related mosquito, An. gambiae, using PCR designed according to two short sequences (AL150661 and AL143513) in the An. gambiae STS database that match the known ITmD37E transposons. Eight PCR clones were sequenced, which showed 92.098.7% nucleotide identities to each other. These PCR clones are 93.797.9% and 89.495.0% identical to the two An. gambiae STS sequences, AL150661 and AL143513, respectively. The identities to AL143513 are slightly lower because only a 150-bp fragment at the end of AL143513 matches ITmD37E. The consensus for each species and a number of individual copies all contain an uninterrupted ORF encoding a 336-amino-acid transposase with the DD37E motif, although some copies contain stop codons while others contain an ORF extended by an extra 16-amino-acid residue. Therefore, the DD37E motif must have been an important functional motif in these mosquito transposons. As shown in Table 2, the full-length copies of these transposons share highly similar TIRs that are all flanked by putative TA target site duplications. Their transposase proteins are 72.894.3% identical, which was calculated using PAUP as described in MATERIALS AND METHODS. They seem to form two groups on the basis of sequence similarities: the Ae. atropalpus and Ae. epactius group and the Ae. triseriatus and An. gambiae group. There is >89% intragroup identity and 72.880.6% intergroup identity. Moreover, related transposons have been identified in nine additional species in five mosquito genera including Aedes, Armigeres, Culex, Toxorhynchites, and Anopheles, on the basis of DNA dot blot, genomic library screening, and preliminary sequence analysis (data not shown). Thus ITmD37E is widely distributed in mosquitoes.
Relative abundance of ITmD37E in different mosquito genomes:
There are
40 and
20 copies of ITmD37E in An. gambiae and Ae. triseriatus, respectively. The copy number in the An. gambiae haploid genome was extrapolated on the basis of the fact that two ITmD37E fragments were found in the An. gambiae STS database, which contains >14 Mb of genomic sequences (http://bioweb.pasteur.fr/BBMI), and that the An. gambiae genome is 270 Mb (![]()
![]()
![]()
1000 and
200 copies of ITmD37E in Ae. epactius and Ae. atropalpus, respectively. However, the frequencies of ITmD37E per 100 Mb genomic DNA are much lower in Ae. triseriatus and An. gambiae,
2 and
14 copies, respectively. Although the estimation for the three Aedes species may be influenced by the possible bias of the genomic libraries, the >100-fold differences observed here are probably large enough to override the potential bias. Thus the relative abundance of ITmD37E appears to be correlated with the groupings described above. However, it is not yet clear whether this observation can be applied to ITmD37E transposons in other mosquitoes.
Transposons containing conserved DD37D and DD39D motifs:
To understand the evolution of the unique ITmD37E transposons in the IS630-Tc1-mariner superfamily, a database survey that revealed additional diversity was conducted. First, four additional nematode transposons containing a DD37D catalytic motif, similar to a previously described insect mariner Bmmar1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
As shown in Fig 2, two of the ITmD37D elements, C.elegans.ITmD37D1 and C.briggsae.ITmD37D1, have probably been active very recently because comparisons between different copies within each of the transposons showed >99.5% nucleotide sequence identity. The boundaries of C.elegans.ITmD37D1 and C.briggsae.ITmD37D1 were confirmed by multiple sequence alignments of different copies shown in Fig 2A and Fig B. Evidence of previous mobility of C.elegans.ITmD37D1 is also presented by the identification of an insertion of C.elegans.ITmD37D1 in an unknown repetitive sequence (Fig 2C). This also confirmed that the flanking TA nucleotides are indeed the target site duplication.
Comparisons between the ITmD37E, ITmD37D, and ITmD39D transposases and the protein sequence profiles of the IS630-Tc1-mariner superfamily:
According to BLAST searches, ITmD37E and ITmD37D are most similar to a Drosophila Tc1 element Minos (Z29098; E values are 1 x 10-7 and 1 x 10-27, respectively), while ITmD39D is most similar to a medfly mariner (U40493; E value, 4 x 10-6). Systematic analyses have been performed between individual sequences of the three new groups and the profiles of the IS630-Tc1-mariner superfamily and its member families, using a Profilesearch approach described by ![]()
![]()
![]()
![]()
ITmD37E, ITmD37D, and ITmD39D transposons form three distinct families in the IS630-Tc1-mariner superfamily:
As described above, ITmD37E, ITmD37D, and ITmD39D transposons form their respective groups on the basis of similar transposases and relatively conserved TIRs. Phylogenetic analysis on the basis of the full-length alignment of representatives of all known IS630-Tc1-mariner transposons (Fig 3) strongly supports the idea that ITmD37E, ITmD37D, and ITmD39D form three clades distinct from Tc1, mariner, Ant1-Hupfer1, ciliate transposons, and the IS630-like elements (Fig 4A). The bootstrap values obtained using three different methods for the ITmD37E, ITmD37D, and ITmD39D clades are all >96%. While Tc1 (DD34E) and mariner (DD34D) also form their respective clades well supported by bootstrap analysis, Ant1-Hupfer1 (DD34E), ciliate transposons (DD34E), and the IS630-like elements (DDxE) form a less robust clade (the DDxE clade and clade VI) as indicated by low bootstrap values. All of the above clades except DDxE are also supported by bootstrap when pogo elements are included in an analysis based on the more conserved catalytic domains (Fig 4B). To study the relationship between the different clades, these two trees are rooted using the prokaryotic IS elements. In both trees, ITmD37E is a distinct clade. The status of ITmD37E is also reflected by its unique TIRs. As shown in Fig 4A, ITmD37D is grouped with Tc1 instead of mariner. This relationship is supported by bootstrap in both neighbor-joining and minimum evolution analysis. ITmD37D and Tc1 are also grouped together in the most parsimonious trees (data not shown), although the bootstrap value derived from the parsimony analysis is <50%. In addition, the ITmD37D and Tc1 grouping is supported by bootstrap analyses using all three methods in the tree, including the pogo elements (Fig 4B). The relationship between ITmD37D and Tc1 is also consistent with the similarity between their TIRs (Table 2). Thus we propose that the ITmD37D transposons, including Bmmar1, are not a basal subfamily of mariner (![]()
| DISCUSSION |
|---|
Expansion and reorganization of the IS630-Tc1-mariner superfamily on the basis of conserved catalytic motifs:
In this study we reported the discovery of ITmD37E, a novel family of transposons in the IS630-Tc1-mariner superfamily, which is characterized by its unique DD37E catalytic motif and TIRs. We also identified two additional families, ITmD37D and ITmD39D, which contain their respective conserved DD37D and DD39D catalytic motifs and TIRs (Table 2 and Fig 3 and Fig 4). The classification of ITmD37D and ITmD39D as two distinct families represents a revision of earlier studies that reported the original discoveries of the founding members of the two families Bmmar1 (DD37D; ![]()
![]()
![]()
![]()
![]()
![]()
Distribution and evolutionary implications:
ITmD37E transposons have been found in all 13 species in five genera of mosquitoes examined, including the Aedes and Anopheles genera. Although the evolutionary distance between Aedes and Anopheles is among the longest in mosquitoes (![]()
![]()
![]()
Potential applications:
The identification of a widespread DNA transposon in mosquitoes may have potentially important applications. Transformation tools are being developed for the genetic manipulation of mosquitoes. Such tools are critical components of the genetic strategy to control mosquito-transmitted diseases by creating disease-resistant mosquitoes through the introduction of refractory genes using DNA transposons (![]()
![]()
![]()
![]()
![]()
Two other transposons described in this study also showed promise as candidates for the development of transformation tools. Ten different copies of C.elegans. ITmD37D1 showed 99.3100% identity while three different copies of C.briggsae.ITmD37D1 showed 99.499.5% identity. This level of sequence identity is similar to the 99.6100% identity that we found for the 19 full-length copies of a currently active Caenorhabditis elegans transposon Tc3 (![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Pierre Capy and Hugh Robertson for insightful comments. This work was supported by a National Institutes of Health grant AI-42121 to Z. Tu and by the Agricultural Experimental Station at Virginia Tech.
Manuscript received June 25, 2001; Accepted for publication August 27, 2001.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHÄFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
ASHBURNER, M., M. A. HOY, and J. J. PELOQUIN, 1998 Prospects for the genetic transformation of arthropods. Insect Mol. Biol. 7:201-213[Medline].
ATKINSON, P. W., A. C. PINKERTON, and D. A. O'BROCHTA, 2001 Genetic transformation systems in insects. Annu. Rev. Entomol. 46:317-346[Medline].
BESANSKY, N. J. and J. R. POWELL, 1992 Reassociation kinetics of Anopheles gambiae (Diptera: Culicidae) DNA. J. Med. Entomol. 29:125-128[Medline].
CAPY, P., R. VITALIS, T. LANGIN, D. HIGUET, and C. BAZIN, 1996 Relationships between transposable elements based upon the integrase-transposase domains: Is there a common ancestor? J. Mol. Evol. 42:359-368[Medline].
CAPY, P., T. LANGIN, D. HIGUET, P. MAURER, and C. BAZIN, 1997 Do the integrases of LTR-retrotransposons and class II element transposases have a common ancestor? Genetica 100:63-72[Medline].
CLARK, J. B. and M. G. KIDWELL, 1997 A phylogenetic perspective on P transposable element evolution in Drosophila. Proc. Natl. Acad. Sci. USA 94:11428-11433
COLLINS, J., E. FORBES, and P. ANDERSON, 1989 The Tc3 family of transposable genetic elements in Caenorhabditis elegans. Genetics 121:47-55
DOAK, T. G., F. P. DOERDER, C. L. JAHN, and G. HERRICK, 1994 A proposed superfamily of transposase genes: transposon-like elements in ciliated protozoa and a common "D35E" motif. Proc. Natl. Acad. Sci. USA 91:942-946
DOOLITTLE, W. F. and C. SAPIENZA, 1980 Selfish genes, the phenotype paradigm and genome evolution. Science 284:601-603
FELSENSTEIN, J. and H. KISHINO, 1993 Is there something wrong with the bootstrap on phylogenies? A reply to Hillis and Bull. Syst. Biol. 42:193-200.
GUEIROS-FILHO, F. J. and S. M. BEVERLEY, 1997 Trans-kingdom transposition of the Drosophila element mariner within the protozoan Leishmania. Science 276:1716-1719
HENIKOFF, S., 1992 Detection of Caenorhabditis transposon homologs in diverse organisms. New Biol. 4:382-388[Medline].
ISOE, J., 2000 Comparative analysis of the vitellogenin genes of the Culicidae. Ph.D. Thesis, The University of Arizona, Tucson, AZ.
IZSVAK, Z., Z. IVICS, and R. H. PLASTERK, 2000 Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. J. Mol. Biol. 302:93-102[Medline].
JARVIK, T. and K. G. LARK, 1998 Characterization of Soymar1, a mariner element in soybean. Genetics 149:1569-1574
KIDWELL, M. G. and D. M. LISCH, 2000 Transposable elements and host genome evolution. Trends Ecol. Evol. 15:95-99[Medline].
LAMPE, D. J., B. J. AKERLEY, E. J. RUBIN, J. J. MEKALANOS, and H. M. ROBERTSON, 1999 Hyperactive transposase mutants of the Himar1 mariner transposon. Proc. Natl. Acad. Sci. USA 96:11428-11433
LAMPE, D. J., K. K. WALDEN, and H. M. ROBERTSON, 2001 Loss of transposase-DNA interaction may underlie the divergence of mariner family transposable elements and the ability of more than one mariner to occupy the same genome. Mol. Biol. Evol. 18:954-961
LOHE, A. R., D. DE AGUIAR, and D. L. HARTL, 1997 Mutations in the mariner transposase: the D,D(35)E consensus sequence is nonfunctional. Proc. Natl. Acad. Sci. USA 94:1293-1297
MAURER, P., A. REJASSE, P. CAPY, T. LANGIN, and G. RIBA, 1997 Isolation of the transposable element hupfer from the entomopathogenic fungus Beauveria bassiana by insertion mutagenesis of the nitrate reductase structural gene. Mol. Gen. Genet. 256:195-202[Medline].
MOORE, S. P., M. POWERS, and D. J. GARFINKEL, 1995 Substrate specificity of Ty1 integrase. J. Virol. 69:4683-4692[Abstract].
MYERS, E. W., G. G. SUTTON, A. L. DELCHER, I. M. DEW, and D. P. FASULO et al., 2000 A whole-genome assembly of Drosophila. Science 287:2196-2204
PLASTERK, R. H. A., Z. IZSVAK, and Z. IVICS, 1999 Resident aliens the Tc1/mariner superfamily of transposable elements. Trends Genet. 15:326-332[Medline].
RAI, K. S. and W. C. I. V. BLACK, 1999 Mosquito genomes: structure, organization, and evolution. Adv. Genet. 41:1-33[Medline].
RAZ, E., H. G. A. M. VAN LUENEN, B. SCHAERRINGER, R. H. A. PLASTERK, and W. DRIEVER, 1997 Transposition of the nematode Caenorhabditis elegans Tc3 element in the zebrafish Danio rerio. Curr. Biol. 8:82-88.
ROBERTSON, H., 1995 The Tc1-mariner superfamily of transposons in animals. J. Insect Physiol. 41:99-105.
ROBERTSON, H. M. and M. L. ASPLUND, 1996 Bmmar1: a basal lineage of the mariner family of transposable elements in the silkworm moth, Bombyx mori.. Insect Biochem. Mol. Biol. 26:945-954[Medline].
ROBERTSON, H. M. and E. G. MACLEOD, 1993 Five major subfamilies of mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol. Biol. 2:125-139[Medline].
SMIT, A. F. A. and A. D. RIGGS, 1996 Tiggers and other DNA transposon fossils in the human genome. Proc. Natl. Acad. Sci. USA 93:1443-1448
SWOFFORD, D. L., 2001 PAUP*, version 4.0 b8 (a commercial test version; completed version 4.0 to be distributed by Sinauer, Sunderland, MA).
TARCHINI, R., P. BIDDLE, R. WINELAND, S. TINGEY, and A. RAFALSKI, 2000 The complete sequence of 340 kb of DNA around the rice Adh1-adh2 region reveals interrupted colinearity with maize chromosome 4. Plant Cell 12:381-391
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994 CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680
TU, Z., 2000 Molecular and evolutionary analysis of two divergent subfamilies of a novel miniature inverted repeat transposable element in the yellow fever mosquito, Aedes aegypti. Mol. Biol. Evol. 17:1313-1325
TU, Z. and H. H. HAGEDORN, 1997 Biochemical, molecular, and phylogenetic analysis of pyruvate carboxylase in the yellow fever mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 27:133-147[Medline].
TU, Z. and J. J. HILL, 1999 MosquI, a novel family of mosquito retrotransposons distantly related to the Drosophila I factors, may consist of elements of more than one origin. Mol. Biol. Evol. 16:1675-1686[Abstract].
This article has been cited by other articles:
![]() |
W. Bao, M. G. Jurka, V. V. Kapitonov, and J. Jurka New Superfamilies of Eukaryotic DNA Transposons and Their Internal Divisions Mol. Biol. Evol., May 1, 2009; 26(5): 983 - 993. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Lorenzen, A. Gnirke, J. Margolis, J. Garnes, M. Campbell, J. J. Stuart, R. Aggarwal, S. Richards, Y. Park, and R. W. Beeman The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon PNAS, July 22, 2008; 105(29): 10085 - 10089. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Garrison, S. R. Yant, J. G. Mikkelsen, and M. A. Kay Postintegrative Gene Silencing within the Sleeping Beauty Transposition System Mol. Cell. Biol., December 15, 2007; 27(24): 8824 - 8833. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Biedler, H. Shao, and Z. Tu Evolution and Horizontal Transfer of a DD37E DNA Transposon in Mosquitoes Genetics, December 1, 2007; 177(4): 2553 - 2558. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yang, C. F. Weil, and S. R. Wessler A Rice Tc1/Mariner-Like Element Transposes in Yeast PLANT CELL, October 1, 2006; 18(10): 2469 - 2478. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. De Gregorio, G. Silvestro, M. Petrillo, M. S. Carlomagno, and P. P. Di Nocera Enterobacterial Repetitive Intergenic Consensus Sequence Repeats in Yersiniae: Genomic Organization and Functional Properties J. Bacteriol., December 1, 2005; 187(23): 7945 - 7954. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Pritham, C. Feschotte, and S. R. Wessler Unexpected Diversity and Differential Success of DNA Transposons in Four Species of Entamoeba Protozoans Mol. Biol. Evol., September 1, 2005; 22(9): 1751 - 1763. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Arkhipova and M. Meselson Diverse DNA transposons in rotifers of the class Bdelloidea PNAS, August 16, 2005; 102(33): 11781 - 11786. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Feschotte, M. T. Osterlund, R. Peeler, and S. R. Wessler DNA-binding specificity of rice mariner-like transposases and interactions with Stowaway MITEs Nucleic Acids Res., April 14, 2005; 33(7): 2153 - 2165. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tsuge, K. Ninomiya, N. Suzuki, M. Inui, and H. Yukawa A new insertion sequence, IS14999, from Corynebacterium glutamicum Microbiology, February 1, 2005; 151(2): 501 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Silva, F. Bastida, S. L. Bidwell, P. J. Johnson, and J. M. Carlton A Potentially Functional Mariner Transposable Element in the Protist Trichomonas vaginalis Mol. Biol. Evol., January 1, 2005; 22(1): 126 - 134. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Feschotte Merlin, a New Superfamily of DNA Transposons Identified in Diverse Animal Genomes and Related to Bacterial IS1016 Insertion Sequences Mol. Biol. Evol., September 1, 2004; 21(9): 1769 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Feschotte, L. Swamy, and S. R. Wessler Genome-Wide Analysis of mariner-Like Transposable Elements in Rice Reveals Complex Relationships With Stowaway Miniature Inverted Repeat Transposable Elements (MITEs) Genetics, February 1, 2003; 163(2): 747 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Claudianos, J. Brownlie, R. Russell, J. Oakeshott, and S. Whyard maT--A Clade of Transposons Intermediate Between mariner and Tc1 Mol. Biol. Evol., December 1, 2002; 19(12): 2101 - 2109. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Shao, H.
- Articles by Tu, Z.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Shao, H.
- Articles by Tu, Z.











