Genetics, Vol. 159, 609-622, October 2001, Copyright © 2001

Ras1 Interacts With Multiple New Signaling and Cytoskeletal Loci in Drosophila Eggshell Patterning and Morphogenesis

Jon D. Schnorra,b, Robert Holdcraftb, Brett Chevalierc, and Celeste A. Bergb,c
a Department of Biology, Whitman College, Walla Walla, Washington 99362,
b Department of Genetics, University of Washington, Seattle, Washington 98195-7360
c Molecular and Cellular Biology Program, University of Washington, Seattle, Washington 98195-5330

Corresponding author: Jon D. Schnorr, Department of Biology, Pacific University, 2043 College Way, Forest Grove, OR 97116., schnorr{at}pacificu.edu (E-mail)

Communicating editor: T. SCHÜPBACH


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Little is known about the genes that interact with Ras signaling pathways to regulate morphogenesis. The synthesis of dorsal eggshell structures in Drosophila melanogaster requires multiple rounds of Ras signaling followed by dramatic epithelial sheet movements. We took advantage of this process to identify genes that link patterning and morphogenesis; we screened lethal mutations on the second chromosome for those that could enhance a weak Ras1 eggshell phenotype. Of 1618 lethal P-element mutations tested, 13 showed significant enhancement, resulting in forked and fused dorsal appendages. Our genetic and molecular analyses together with information from the Berkeley Drosophila Genome Project reveal that 11 of these lines carry mutations in previously characterized genes. Three mutations disrupt the known Ras1 cell signaling components Star, Egfr, and Blistered, while one mutation disrupts Sec61ß, implicated in ligand secretion. Seven lines represent cell signaling and cytoskeletal components that are new to the Ras1 pathway; these are Chickadee (Profilin), Tec29, Dreadlocks, POSH, Peanut, Smt3, and MESK2, a suppressor of dominant-negative Ksr. A twelfth insertion disrupts two genes, Nrk, a "neurospecific" receptor tyrosine kinase, and Tpp, which encodes a neuropeptidase. These results suggest that Ras1 signaling during oogenesis involves novel components that may be intimately associated with additional signaling processes and with the reorganization of the cytoskeleton. To determine whether these Ras1 Enhancers function upstream or downstream of the Egf receptor, four mutations were tested for their ability to suppress an activated Egfr construct ({lambda}top) expressed in oogenesis exclusively in the follicle cells. Mutations in Star and l(2)43Bb had no significant effect upon the {lambda}top eggshell defect whereas smt3 and dock alleles significantly suppressed the {lambda}top phenotype.


RECEPTOR tyrosine kinases (RTKs) function during development in a diverse array of species. In many instances, RTKs use the Ras signaling cascade to transduce extracellular signals into the cell nucleus. Although many of these disparate RTKs share similar downstream components, those components or mechanisms that provide developmental specificity are not always clear (TAN and KIM 1999 Down).

In Drosophila melanogaster, the Ras1 cascade is used to specify cell fates in different tissues and at different times. The Ras1 cascade operates downstream of the Sevenless (Sev) RTK in eye development (reviewed by WASSARMAN et al. 1995 Down) and the Torso (Tor) RTK in terminal differentiation of the embryo (reviewed by DUFFY and PERRIMON 1994 Down). Ras1 also functions downstream of the epidermal growth factor receptor (Egfr), which is used to specify cell fates in the eye, the wing, and the embryonic ventral midline and during oogenesis to pattern the primary axes of the eggshell and embryo (reviewed by SCHWEITZER and SHILO 1997 Down).

Studies of Egfr signaling during oogenesis suggest that multiple signaling events occur to correctly establish dorsoventral (D/V) and anteroposterior (A/P) polarity (reviewed by RAY and SCHUPBACH 1996 Down; NILSON and SCHUPBACH 1999 Down). Early in oogenesis, Gurken (Grk), the presumptive ligand for Egfr, signals from the germ line to the posterior follicle cells to establish posterior follicle cell fate. Later, these posterior cells signal back to the oocyte to initiate a reorganization of the cytoskeleton within the germ cells, mediating the localization of morphogens that determine the A/P and D/V axes of egg and embryo (GONZALEZ-REYES et al. 1995 Down; ROTH et al. 1995 Down). During this cytoskeletal reorganization, the oocyte nucleus and Grk protein are positioned at the dorsal anterior corner of the oocyte; further Grk-Egfr signaling specifies the identity of the dorsal follicle cells. This initial signaling event induces an amplification cascade involving the additional Egfr ligands Spitz, Vein, and Argos, leading to the continued patterning of the dorsal follicle cells (WASSERMAN and FREEMAN 1998 Down; reviewed by STEVENS 1998 Down). These cells go on to secrete the dorsal structures of the eggshell, including the dorsal respiratory filaments, or dorsal appendages. Mutations in Ras1 and Ras1 cascade components such as Raf and MEK disrupt these signaling processes and lead to dorsal appendage defects (BRAND and PERRIMON 1994 Down; HSU and PERRIMON 1994 Down; SCHNORR and BERG 1996 Down), including forked, fused, or absent dorsal appendages. Although Ras1 cascade components are required for the specification of both the embryo and eggshell axes, mutations in genes encoding these components affect the eggshell more strongly than the embryo (HSU and PERRIMON 1994 Down; SCHNORR and BERG 1996 Down).

Thus, the Ras1 cascade is used in varied processes but the mechanism for evoking developmental specificity is not clear (reviewed by SIMON 2000 Down). One possibility is that multiple signaling cascades impinge on a cell to determine its fate (reviewed by CORNELL and KIMELMAN 1994 Down). In D/V eggshell patterning, both the TGF-{alpha} Grk and the TGF-ß Dpp impinge on dorsal follicle cells to specify their identities (PERI and ROTH 2000 Down). Alternatively, the exact level of signaling could affect kinase activity and alter effector protein function (e.g., ROTH and SCHUPBACH 1994 Down; DYSON and GURDON 1998 Down). Finally, the state of a cell at the time of the signaling event could alter its response. In the Drosophila eye, for example, where downstream components of the Sevenless signaling cascade have been studied intensively, the presence and activity of such proteins as Sina, Phyllopod, TTk88, Yan, and Pointed contribute to the final outcome following Ras1 activation (reviewed by RAABE 1998 Down; DICKSON 1995 Down). Pointed also functions in D/V axis formation, but its role may differ somewhat in oogenesis compared to R7 cell determination (MORIMOTO et al. 1996 Down). These results reveal complexities that await a more thorough comparison of Ras signaling cascades throughout development.

To understand Ras signaling better, we employed a dominant modifier screen to identify components of the signaling cascade that are used during D/V patterning in oogenesis. Unlike other Egfr-dependent processes, signaling in the dorsal follicle cells leads to cell movements. We reasoned that a modifier screen would reveal novel components of the Ras1 cascade that link Egfr to morphogenesis. First we identified a weak Ras1 allele whose activity lies on the threshold of adequate signaling during D/V axis specification. We then screened lethal, second-chromosomal mutations for dominant enhancement of a weak Ras1 eggshell phenotype. Here we describe the mutations identified as Enhancers of Ras1, including 11 previously characterized genes and two novel loci. Finally, we employed a gain-of-function Egfr construct (QUEENAN et al. 1997 Down) to position a subset of these genes in the Egfr signaling pathway.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Fly stocks and culture media:
Flies were maintained on standard medium at 25°. The excision allele Ras1ix12a was generated by mobilizing the P element in the strain Ras105703 (SCHNORR and BERG 1996 Down). EgfrDf (CLIFFORD and SCHUPBACH 1989 Down), grkHK36 (SCHUPBACH 1987 Down), okraRU47, and chiffonWD18 (SCHUPBACH and WIESCHAUS 1991 Down) were provided by Trudi Schüpbach. The P-element collection was maintained during the screen as a collaborative effort of the Seattle area fly community. Most of these lines were generated by TOROK et al. 1993 Down and are part of the Berkeley Drosophila Genome Project (BDGP; SPRADLING et al. 1995 Down, SPRADLING et al. 1999 Down). Df(3R)by10 (85D8-11;85E10-13), bsba, bs3, l(2)04493 (smt3), and Df(2L)ast2 were obtained from the Bloomington Stock Center. dockP1, dockP2, and dock3 were provided by Larry Zipursky and chic07886 was provided by Lynn Cooley.

Ras1 enhancer screen:
The breeding scheme used to introduce and screen the P-element mutations in the Ras1ix12a background is depicted in Fig 1. In P0, males from the P-element strain to be tested were crossed with virgin females carrying the Ras1ix12a mutation in a w background. In G1, w/Y; P[lacW]/+; Ras1ix12a cv-c sbd/+ males were sorted by their w+ eyes and wild-type bristles. These males were backcrossed to the w; Ras1ix12a strain. In G2, females of the genotype w; P[lacW]/+; Ras1ix12a cv-c sbd were selected by their w+ eye color, stubbloid bristles, and crossveinless wing phenotypes. Five to 15 of these tester females were transferred with sibling males into fresh vials and allowed to lay eggs for 2 days. These eggs were screened under a dissecting microscope for an increase in the frequency of fused and forked dorsal appendages. Egg defects of any kind were noted, and the eggs in vials were allowed to develop to adulthood to determine the fertility of tester females. We retested 51 positive lines, repeating the crosses with more flies, examining eggs directly on agar plates, and quantifying the number of eggs that exhibited wild-type, forked, or fused dorsal appendages; 26 lines passed this secondary screen.



View larger version (12K):
In this window
In a new window
Download PPT slide
 
Figure 1. Screen for enhancers of Ras1. See MATERIALS AND METHODS for details of the crosses. G2 females were sorted into fresh vials with males and allowed to lay eggs for 2 days, and then egg morphology was screened directly in the vials under a dissecting microscope.

Genetic characterization of Ras1 Enhancer lines:
The 26 Ras1 Enhancer lines were tested by us and/or the BDGP to verify that the lethality was associated with the P-element insertion. Nine lines interacted with Ras1 but either contained multiple P-element insertions or the lethality was not uncovered by a deficiency for the region. These lines and their degree of interaction were: strong interactors: l(2)k05617, l(2)k05215; moderate interactors: l(2)k15201, l(2)k09403, l(2)k05725; and weak interactors: l(2)03832, l(2)k09610, l(2)k07312, and l(2)k14901. In all of the remaining 17 cases presented in this article, the BDGP demonstrated that the lethality is uncovered by a deficiency for the region. In some cases, the P element fails to complement mutations in a known gene that maps to the region. In addition, we generated Ras1 Enhancer excision alleles as described previously (HOROWITZ and BERG 1995 Down), with assistance from Jennifer Epler, Carrie Mitchell, and Matthew Quinn, for the following lines: Star (l(2)k09312), chic (l(2)k13321), smt3 (l(2)k01211), Tec29A (l(2)k00206), bs (l(2)k07909), Sec61ß (l(2)k03307, l(2)k07819b, l(2)k16004), and Nrk/Tpp (l(2)k014301). Females carrying viable, sterile excision alleles of Star, smt3, and chic produced eggs with a variety of ventralizing and morphogenetic eggshell defects (data not shown). Finally, we verified enhancement of the eggshell phenotype by using an independently derived allele of the following genes: smt3, chic, Egfr, and DSec61ß. In the remaining lines, a formal possibility exists, albeit an unlikely one, that the genetic enhancement observed is due to a second chromosome mutation that is not associated with the P-element insertion.

Plasmid rescue and sequence analysis of DNA neighboring integrated transposons:
To rescue DNA flanking the transposon insertion site, we followed a protocol essentially as described in ASHBURNER 1989 Down except that electrotransformation using a Bio-Rad (Hercules, CA) Gene Pulser was employed. To sequence flanking DNA, we conducted cycle sequencing reactions using ABI Big Dye terminators analyzed at the University of Washington biochemistry sequencing center on an ABI 377XL DNA sequencer. We used a primer recognizing the P-element end, 5' GCTCTAGACGGGACCACCTTATGT 3'.

Suppression of activated Egfr:
We first tested whether each Ras1 Enhancer could suppress the Egfr allele Ellipse, a gain-of-function mutation that produces rough eyes when heterozygous. All the mutations were tested in trans to Ellipse (Ellipse/Enhancer of Ras1), but no amelioration of the rough eye phenotype was apparent under the dissecting microscope.

The activated Egfr ({lambda}top) and Gal4 lines CU1 and T155 were provided by T. Schüpbach. The {lambda}top line was generated by QUEENAN et al. 1997 Down and contains a transgene on the X chromosome encoding the {lambda} Repressor dimerization domain fused to the Egfr intracellular domain and driven by the UAS yeast promoter, which requires the Gal4 protein for expression (BRAND and PERRIMON 1993 Down). The T155 and CU1 lines express Gal4 protein in all the follicle cells beginning around stage 9 of oogenesis. Females of genotype w {lambda}top/+; CU1/+ or w {lambda}top/+; T155/+ produced dorsalized eggs or eggs with excess chorion blebs. We observed increasingly severe phenotypes at higher temperatures.

To test for suppression of the {lambda}top phenotype, we crossed w {lambda}top; Pin/CyO virgins to w/Y; P[lacW]/CyO males. Male progeny of genotype w {lambda}top/Y; P[lacW]/Pin were then crossed to females carrying Gal4 enhancer lines, w; +/+; T155 or w; CU1/CyO. We then compared the phenotypes observed in females of genotype w {lambda}top/w; P[lacW]/CU1 to those of genotype w {lambda}top/w; CU1/Pin. Males from this cross did not carry the {lambda}top transgene and appeared wild type.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Ras1ix12a is an excision allele derivative of a P-element-induced mutation (Ras105703) and retains 2 kb of transposon sequence 5' of the Ras1 gene (Fig 2A). This mutation causes a weak loss-of-function phenotype, presumably by reducing the amount of wild-type protein (SCHNORR and BERG 1996 Down). Flies homozygous for the Ras1ix12a allele lay nearly wild-type eggs (Fig 2C), but when the Ras1ix12a allele is placed in trans to a deficiency for the region, females lay eggs with a single dorsal appendage (Fig 2D). Heterozygous mutations affecting other genes of the D/V pathway such as Egfr and gurken result in an increase in eggshell defects in the Ras1ix12a homozygous background (Fig 2E). These interactions appear specific for the Ras1 pathway since other oogenesis mutations such as pipsqueak2403, okraRu47, or chiffonWD18 modify the Ras1ix12a phenotype weakly or not at all (data not shown). These characteristics suggest that the Ras1ix12a allele is barely adequate for the correct patterning of the eggshell and is sensitive to perturbations in the level of Ras1 signaling.



View larger version (62K):
In this window
In a new window
Download PPT slide
 
Figure 2. Representative eggshell phenotypes observed in the Ras1 enhancer screen. (A) Genomic structure of the Ras1ix12a excision allele. Ras1ix12a was created by the incomplete excision of a PZ element leaving 2 kb of transposon sequence just 5' to the Ras1 gene. We have previously shown by transformation rescue that effects on the Rlb1 gene do not contribute to the observed phenotypes (SCHNORR and BERG 1996 Down). (B) Wild-type egg. (C) Egg from a Ras1ix12a female. Any one female lays eggs that range from wild type to those exhibiting a slight expansion of the chorion at the base of the dorsal appendages. (D) Single dorsal appendage phenotype of Ras1ix12a/Df(3R)by10, a deficiency that uncovers the Ras1 region. (E) Egg from an EgfrDf/+; Ras1ix12a/Ras1ix12a female demonstrating enhancement of the Ras1ix12a eggshell phenotype by a member of the Ras signaling pathway.

Based on these observations, we conducted a genetic screen to identify heterozygous mutations that enhance the weak Ras1ix12a eggshell phenotype. Using the scheme in Fig 1, we screened approximately 2000 existing, second chromosome, lethal, P-element-induced mutations for an enhancement of the Ras1ix12a phenotype. In the primary screen, eggs were examined through the vial and defects were identified and roughly quantified. Of 1618 successfully tested lines, 51 (3.2%) showed some level of preliminary enhancement. Strongly enhancing mutations exhibited low fecundity and severely defective eggshells, but none possessed a phenotype as severe as that observed with EgfrDf/+; Ras1 or grkHK36/+; Ras1ix12a. Weakly enhancing mutations exhibited only slightly increased eggshell defects compared to those observed in the Ras1ix12a line alone. When these lines were retested by collecting eggs on agar plates and quantifying phenotypes precisely, only 26 showed consistent enhancement of the Ras1ix12a phenotype. Of these lines, 9 were set aside (see MATERIALS AND METHODS) due to the existence of multiple P-element insertions on the chromosome or to lethality not associated with the cytological location of the P element as determined by the BDGP. The remaining 17 lines were selected for further study.

We conducted genetic and molecular tests to determine the identity of the recovered lines. These tests were guided by the cytological map position of the P element as determined by the BDGP. In addition, we generated excision alleles for most lines to verify that the lethality was due to the P element. Finally, we employed plasmid rescue to clone the genomic DNA flanking the 5' and 3' ends of the P-element transposon from most lines. We then sequenced a portion of the cloned DNA directly flanking the P element and conducted a BLAST database search to identify homologous genes. The results of the genetic and molecular characterization of the Ras1 Enhancers appear in Table 1 and Table 2.


 
View this table:
In this window
In a new window

 
Table 1. Enhancers of Ras1


 
View this table:
In this window
In a new window

 
Table 2. DSec61ß alleles exhibit dominant eggshell phenotypes

Identity of mutant lines
Cell signaling components: Seven of the Ras1 Enhancers have been implicated previously in cell signaling or are genes with significant homology to previously characterized cell signaling molecules.

Egfr and Star, known signaling molecules in oogenesis: Line l(2)k05115 strongly enhances the Ras1 eggshell phenotype and is a P-element allele of Egfr (BDGP). Likewise, line l(2)k09312 is a strong enhancer and is affecting a previously characterized gene involved in signaling, Star. Complementation tests and sequence analysis of the P-element insertion site confirmed that l(2)k09312 is affecting the Star gene. Star is required to achieve adequate levels of signaling through Egfr (HEBERLEIN et al. 1993 Down; STURTEVANT et al. 1993 Down; KOLODKIN et al. 1994 Down) and encodes a single-pass transmembrane protein thought to act in processing Egfr ligands (KOLODKIN et al. 1994 Down; PICKUP and BANERJEE 1999 Down; BANG and KINTNER 2000 Down). In addition, previous work reveals a role for Star in oogenesis (RUDEN et al. 1999 Down). We expected to recover known components of the Ras1 signaling pathway and the recovery of Egfrk05115 and Stark09312 confirms the efficacy of our approach and the suitability of the Ras1 background in conducting this screen.

Neurospecific receptor kinase/tripeptidyl-peptidase II: The l(2)k14301 mutation maps to cytological position 49F7-8. Sequence analysis of the flanking DNA demonstrated that the P element in l(2)k14301 is inserted into a complex region containing overlap between two genes. Our data reveal that l(2)k14301 is located within the 5' end of an alternative-splice form of the neurospecific receptor kinase gene (Nrk), a putative RTK related to the Trk and Ror families of RTKs. Nrk exhibits 47% identity and 64% similarity to homologs in chicken, rat, mouse, and human. Although no mutant alleles of this gene have been characterized previously, the Nrk protein does exhibit activities expected of RTKs, including the ability to autophosphorylate in vitro (OISHI et al. 1997 Down). Transcripts from this locus are expressed uniformly in follicle cells throughout oogenesis (C. J. MITCHELL and C. BERG, unpublished data). BDGP analyses of the region suggest that a second gene, tripeptidyl-peptidase II (TppII), also produces an alternatively spliced form that may be disrupted by l(2)k14301. In this case, the P element is located in the first intron. TppII is 38% identical to human and rat proteins that degrade neuropeptides by attacking their amino termini and releasing three amino acid fragments. Purified Drosophila TppII enzyme exhibits many of the same biochemical and pharmacological properties as its distant relatives (RENN et al. 1998 Down). Like Nrk, no mutant alleles specific for this locus are known.

blistered: The l(2)k07909 mutation maps to 60C7-8 and fails to complement alleles of blistered (bs), the Drosophila homolog of the Serum Response Factor (SRF). bs encodes a MADS domain containing transcription factor involved in the regulation of tracheal development and the formation of intervein tissue in the wing (GUILLEMIN et al. 1996 Down; MONTAGNE et al. 1996 Down), processes dependent on the function of the RTKs FGF-R (breathless) and Egfr. Human SRF interacts with Ets domain containing proteins that in turn are activated by the mitogen-activated protein (MAP) kinase signaling pathway (reviewed by TREISMAN 1994 Down).

Plenty of SH3s: The l(2)k11507 mutation maps to 54C7-8 and fails to complement l(2)k15815. Sequence analysis of flanking DNA reveals that l(2)k15815 is inserted in the first exon of POSH, Plenty of SH3s (BDGP), which encodes a putative scaffolding protein first identified by two-hybrid analysis with mouse RAC protein (TAPON et al. 1998 Down). POSH contains one Zinc-C3HC4 ring-finger domain and four Src-homology-3 domains, strongly suggesting a function as an adapter protein that facilitates complex formation with multiple signaling molecules. Within the ring-finger domain, Drosophila POSH exhibits 31% identity and 47% similarity to Mus POSH while the four SH3 domains exhibit ~53% identity and ~66% similarity to this vertebrate homolog.

Tec29A: The l(2)k00206 mutation maps to 29A1-2 and was identified by GUARNIERI et al. 1998 Down and ROULIER et al. 1998 Down as an allele of the Tec29A gene, which encodes a cytoplasmic tyrosine kinase of the Src family. Tec29 is also called Btk29 and was formerly called Scr29A. In Drosophila, mutations in Tec29 disrupt the regulated growth of actin bundles in the ring canals that connect germ-line cells of the 16-cell cyst (GUARNIERI et al. 1998 Down; ROULIER et al. 1998 Down).

dreadlocks: The l(2)04723 mutation maps to 21D3-4 and was identified by GARRITY et al. 1996 Down as an allele of dreadlocks (dock) in a screen for axon guidance mutants. dock encodes an SH2/SH3 adapter protein related to Grb2 and Nck (GARRITY et al. 1996 Down); its function in axon guidance may be to modulate cytoskeletal changes within the growth cone in response to tyrosine kinase signaling (RAO and ZIPURSKY 1998 Down).

Cytoskeletal components: In addition to Tec29A and dock, whose products link signaling pathways to the cytoskeleton, we identified two Ras1-interacting genes that function directly in cytoskeletal regulation.

chickadee (chic; Drosophila homolog of Profilin): Sequence analysis of flanking DNA revealed that the l(2)k13321 P element is inserted into the chickadee gene, which encodes the Drosophila Profilin homolog. The P element is located within an intron about 200 bp distal from exon 3 (Fig 3). The identity of the l(2)k13321 line was independently determined by complementation tests conducted by the BDGP.



View larger version (8K):
In this window
In a new window
Download PPT slide
 
Figure 3. Position of the l(2)k13321 P element in the chickadee gene. chickadee gene organization and position of chicfs(2)7886 as determined by COOLEY et al. 1992 Down. Sequence analysis of flanking DNA surrounding the chicl(2)13321 insertion places the P element in the intron just 3' of exon 3. Alternative 5' untranslated regions lead to the production of an ovary-specific transcript shown above and a constitutive transcript depicted below the exons. Open boxes represent untranslated exons while solid boxes represent coding exons. Note that both transcripts use exons 3, 4, and 5. The lethal phenotype and insertion site of l(2)k13321 are consistent with disruption of the constitutive transcript (see DISCUSSION).

The chic gene contains two promoters with alternative 5' untranslated regions that connect to a common coding region (Fig 3). Transcription driven from these promoters leads to either ovary-specific or constitutive mRNAs encoding exactly the same protein (COOLEY et al. 1992 Down; VERHEYEN and COOLEY 1994 Down). Loss of the ovary-specific transcript results in female sterility (e.g., allele chic07886) while reduction or disruption of the constitutive transcript is lethal. Given the position of the P element between two coding exons, we hypothesize that the lethal chick13321 allele disrupts both the constitutive and female-specific transcript.

We asked whether the loss of Profilin protein only in the germ line would result in the enhancement of the Ras1ix12a phenotype. We examined a female sterile allele of chic, chic07886, that does not disrupt chic expression in the follicle cells. chic07886 in the Ras1ix12a background produces a level of enhancement (chic07886/+; Ras1ix12a = 29% and +/+; Ras1ix12a = 1.4% single dorsal appendage eggs) comparable to that observed using the chick13321 allele (w; chick13321/+; Ras1ix12a = 18% and w; +/+; Ras1ix12a = 2.4%). This result suggests that a germ-line requirement for chic mediates D/V axis formation through the Ras1 signaling process. This result is consistent with work by MANSEAU et al. 1996 Down, who showed that female sterile alleles of chic produce weakly ventralized eggshells and interact with mutations in another germ-line cytoskeletal gene, cappuccino, to produce strongly enhanced eggshell defects.

peanut: The BDGP reported that l(2)02502 maps to 44C1-2 and fails to complement mutant alleles of the peanut (pnut) gene, which encodes a Drosophila septin (NEUFELD and RUBIN 1994 Down). Septins are involved in regulating the cytoskeleton during septum formation in various cell types (e.g., during cytokinesis; reviewed by COOPER and KIEHART 1996 Down; FIELD and KELLOGG 1999 Down). In Drosophila, mutations in the pnut gene interact with seven in absentia (sina) during induction of the R7 cell in the eye (CARTHEW et al. 1994 Down; NEUFELD and RUBIN 1994 Down).

l(2)k01211 is inserted 5' of the smt3 gene: The genomic DNA flanking the P-element insertion l(2)k01211 was rescued, sequenced, and found to be homologous to human UBL1, a ubiquitin-like protein. More thorough sequencing of the region revealed that the P element is ~10 bp upstream of the first exon of a gene called smt3 (HUANG et al. 1998 Down), originally cloned because of its homology to a family of ubiquitin-like (Ubl) proteins. The Ubl family represents a new class of ubiquitin-related proteins that share weak overall homology with ubiquitin (~20% identity) but have functional features in common such as a diglycine repeat at the carboxyl terminus. The Drosophila protein Smt3 shares 75 and 52% identity with the human Ubl proteins SMT3B and SMT3C (also known as SUMO-1), respectively, and 48% with Smt3p from the yeast Saccharomyces cerevisiae.

The BDGP reported that l(2)k01211 failed to complement the lethality associated with l(2)04493. l(2)04493 also maps to a region about 10 bp upstream of the first exon of smt3. BDGP reports the other nearest transcription unit, CG8749 (snRNP70K), is over 3 kb upstream, suggesting that l(2)04493 and l(2)k01211 affect the smt3 transcript. We tested the interaction of l(2)04493 in a Ras1ix12a background and found levels of enhancement comparable to that observed with l(2)k01211 (57% fused and forked dorsal appendages compared to 60% fused and forked dorsal appendages). Moreover, in crosses between l(2)04493 and l(2)k01211, we observed rare trans-heterozygous escapees (0.76%; n = 4445) of genotype l(2)04493/l(2)k01211. These adult females produced few late-stage egg chambers and these rare eggs exhibited poorly developed dorsal appendages (our unpublished observations). These observations are consistent with a role of l(2)k01211 in dorsal appendage formation.

Novel genes: Two Ras1 Enhancer lines, l(2)04614 and l(2)k05623, affect previously uncharacterized genes. The BDGP has verified that these lines carry only one P element and that the lethal phenotype is closely linked to the insertion. We employed plasmid rescue to obtain flanking DNA for l(2)k0562 but were unable to clone out flanking DNA from l(2)04614. Complementation analysis by BDGP, however, indicates that l(2)04614 is an allele of l(2)43Bb, an essential gene identified by saturation mutagenesis of region 43A-E (HEITZLER et al. 1993 Down). Comparison of the exquisite fine map data from these authors and the detailed molecular map from BDGP identifies four candidate genes that may define l(2)43Bb. The most likely candidate encodes a protein with homology to cell adhesion molecules of the Notch and Delta family (CG11101). Alternatively, three other putative genes flank this locus and may represent l(2)43Bb; these genes encode proteins of no known function.

Following plasmid rescue, we sequenced flanking DNA from l(2)k05623 and compared these data to BDGP genomic and expressed sequence tag databases. Alignment of the P-element insertion site, cDNA sequences, and genomic contigs revealed that l(2)k05623 is inserted into the first exon of CG15668. The protein encoded by this gene shares homology with human and rodent proteins identified through differential expression techniques. Transcripts from these genes are upregulated during normal brain development or following Nickel induction or N-myc overexpression (KOKAME et al. 1997 Down; SHIMONO et al. 1999 Down; YAMAUCHI et al. 1999 Down). The Drosophila protein exhibits ~29% identity and 45–49% similarity to these mammalian homologs, now termed NDR1, -2, or -3 (N-myc Downstream Regulated). In a complementary study that strongly supports our findings, HUANG and RUBIN 2000 Down identified this locus in a screen for misexpression suppressors of dominant negative Ksr, a kinase with unknown substrates that acts downstream of Ras in eye development. They named the gene MESK2.

Dominant eggshell defects result from mutations in DSec61ß: Not unexpectedly, we identified a number of lines that exhibit phenotypes even in the absence of the Ras1ix12a mutation (Table 2). These five lines show strong Ras1 enhancement and fail to complement one another for viability. Three of these mutant lines have been mapped by the BDGP to 51B7-8 by in situ hybridization. Although these mutations produce significant enhancement of the Ras1 phenotype, some alleles in this group produce eggshell defects as heterozygotes in a Ras1+ background. l(2)k17010/CyO and l(2)k16004/CyO females lay some eggs that have translucent eggshells with short or absent dorsal appendages; these females are weakly fertile. In contrast, l(2)k07819b fails to complement the lethality associated with these lines, interacts with Ras1 to produce strong dorsal appendage defects, but does not produce thin chorions.

Sequence analysis of flanking DNA from l(2)k16004 revealed that this P element is inserted in the 5' end of the Sec61ß gene, which encodes a subunit of a putative protein translocation channel (VALCARCEL et al. 1999 Down). The l(2)k07819b P element, however, is inserted just upstream of the gene, and this more 5' position could account for the difference in phenotype.

Suppression of an activated Egfr: Since our screen can identify mutations that affect either the germ line (e.g., chic) or the follicle cells, we sought an epistasis test that could quickly distinguish whether a new component functions upstream of Egfr in the germ line or downstream of Egfr in the follicle cells. We made use of an activated Egfr construct that could be selectively expressed in the follicle cells of the developing eggshell using the Gal4-UAS system (BRAND and PERRIMON 1993 Down; QUEENAN et al. 1997 Down). Egfr (torpedo = top) is activated by replacement of its extracellular domain with the {lambda} Repressor dimerization domain ({lambda}top) and contains a UAS regulatory region upstream. We employed two Gal4 enhancer lines, CU1 and T155, to drive expression in a majority of the follicle cells. Previous reports using this system suggested that GAL4-driven expression is highly sensitive to temperature, and we found suitable phenotypes between the temperatures of 22° and 25° to test for suppression. At 22°, {lambda}top/+; Gal4-CU1/+ females lay some eggs that appear wild type, but others have excess chorion blebs, enlarged appendages, or other features that suggest strong dorsalization (Fig 4B and Fig C). At higher temperatures, fewer wild-type eggs are laid and no eggs hatch. Since we observe a decrease in the number of completely wild-type chorions over this temperature range, we reasoned that the activity level of {lambda}top is at a threshold, and a small decrease in activity when the system is held at 25° should result in a higher frequency of wild-type eggshells.



View larger version (86K):
In this window
In a new window
Download PPT slide
 
Figure 4. Representative phenotypes observed in eggs from females carrying an activated Egfr ({lambda}top). (A) Egg from a wild-type female. (B) Egg from a female of genotype w UAS-{lambda}top/w; CU1-GAL4/Pin raised at 25°. We observed excess chorion material concentrated at the anterior end of the eggshell, similar to some dorsalized phenotypes. (C) A higher magnification view of egg from w UAS-{lambda}top/w; CU1-GAL4/Pin female showing excess blebs of chorion associated with the anterior eggshell.

Because of the large number of lines and difficult nature of the assay (see DISCUSSION), we focused the suppression analysis on a subset of Ras1 Enhancer mutations. We tested four mutations of the collection for their ability to suppress {lambda}top (see Table 3): two new genes (smt3 and l(2)43Bb) that could act in either germ cells or follicle cells and therefore lie upstream or downstream of Egfr, one moderate enhancer (dreadlocks) that we suspected acts downstream of Egfr, and one strong enhancer (Star) that we suspected acts upstream of or in parallel to Egfr. Experimental flies of the genotype {lambda}top/+; smt3l(2)k01211/CU1 showed a higher frequency of wild-type eggshells at 25° than did the control females of genotype {lambda}top/+; +/CU1. This result suggests that smt3l(2)k01211 is epistatic to Egfr and operates downstream of the receptor in the follicle cells. We found a similar but smaller effect for dock04723. Conversely, we found no difference in phenotype for tests conducted with the Stark09312 and l(2)43Bb04614 alleles, suggesting that these genes are not limiting in the pathway or are not required for the function of the activated {lambda}top protein.


 
View this table:
In this window
In a new window

 
Table 3. Suppression of activated Egfr phenotype by Enhancer of Ras1 mutations


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In this article, we present the results of a genetic screen to identify P-element mutations that enhance a weak Ras1 eggshell phenotype. Although our screen methodology limited our search to the second chromosome, we nevertheless identified 13 mutations that dominantly enhance the Ras1ix12a eggshell phenotype. Molecular and genetic analyses in combination with the BDGP resources have allowed us to identify a majority of the genes affected by these P-element insertions (Fig 5). Ras1 Enhancers such as Egfr and Star, whose functions in Ras1 signaling have been clearly demonstrated, reveal the efficacy of our approach. Our results also make a genetic connection between a number of previously identified signaling molecules, such as Dreadlocks and Tec29, and Ras1-mediated signaling during oogenesis. Finally, several Ras1 Enhancers have been implicated previously in regulating cytoskeletal structure or function. This result suggests that, in addition to D/V patterning, Ras1 may also function during egg morphogenesis to link signal transduction directly to the reorganization of the cytoskeleton.



View larger version (46K):
In this window
In a new window
Download PPT slide
 
Figure 5. Model depicting the possible site of function of proteins encoded by various Ras1 Enhancers in the egg chamber. A developing egg chamber consists of the germ-line-derived oocyte (below) surrounded by a layer of somatic follicle cells (above, gray shading). The Grk ligand is produced in the oocyte and activates the Egf receptor within the follicle cells. We have portrayed the site of protein activity as in either the oocyte or the follicle cells or in both tissues. These tentative positions are based on the following as indicated by superscript numbers: (1) mosaic analysis, (2) genetic epistasis tests or tissue-specific phenotypes, (3) mosaic analysis in germ-line only, (4) expression analysis of mRNA (data not shown), (5) work in other tissues. The proteins Pnut, Tec29A, Chic, Star, and Sec61ß have been localized to the germ line or the follicle cell layer through genetic methods or immunostaining. In some cases (Chic, Pnut) the proteins are found in both tissues but their site of interaction with the Ras pathway is not definitively established (see DISCUSSION). The functions of the proteins Nrk, Smt3, Tec29A, POSH, MESK2, and Dock (follicle cells) have not been examined directly within this tissue but genetic and molecular evidence is consistent with these assignments (see DISCUSSION). In addition, epistasis tests with the activated Egfr construct support a function for Smt3 and Dock in the follicle cells.

Recovery of previously identified Ras1 signaling components:
Ras1 signaling downstream of the Egfr, Torso, and Sev RTKs has been studied extensively in the fly (reviewed by WASSARMAN et al. 1995 Down). Consequently, we expected to recover mutations in second chromosomal genes known to function in Ras1 signal transduction, as well as genes necessary for the D/V patterning of the eggshell. Indeed, we recovered l(2)k05115, an allele of Egfr.

Another Ras1 pathway member we identified is Star, a member of the Spitz group of genes that functions during Egfr-mediated formation of the embryonic ventral midline. Star mutations appear repeatedly in screens for RTK-related eye phenotypes (HEBERLEIN and RUBIN 1991 Down; MA et al. 1996 Down) and these Star alleles suppress gain-of-function mutations affecting Egfr and sev signaling pathways (HEBERLEIN et al. 1993 Down; STURTEVANT et al. 1993 Down). In addition, a dominant female sterile allele, StarKojak, produces phenotypes that suggest a dual function for Star in A/P and D/V patterning in oogenesis (RUDEN et al. 1999 Down). Finally, Star encodes a single-pass transmembrane protein (KOLODKIN et al. 1994 Down); recent evidence supports the hypothesis that Star is involved in processing the Egfr ligands Spitz and Gurken (GOLEMBO et al. 1996 Down; RUDEN et al. 1999 Down; BANG and KINTNER 2000 Down). Our recovery of Star and epistasis tests with {lambda}top, which place Star upstream of or in parallel with Egfr (Fig 5), support these previous findings.

Another known Ras1 pathway member we identified is bs, which encodes the Drosophila homolog of the human SRF. SRF is a MADS domain-containing transcription factor that binds the serum response element, an enhancer sequence named for its presence upstream of genes that respond to growth factor stimulation (reviewed by TREISMAN 1994 Down). Although we have not directly tested the functional requirements of bs in dorsal appendage formation, it is likely that SRF acts in follicle cell nuclei (Fig 5).

Genetic observations in wing and tracheal development reveal a role for SRF in processes regulated by Egfr and FGF-R signaling pathways. In Drosophila wing imaginal discs, bs is expressed in the future intervein tissue in a pattern complementary to that of Rhomboid, an Egfr accessory protein that facilitates presentation of ligand (FRISTROM et al. 1994 Down; BANG and KINTNER 2000 Down). Loss-of-function mutations in bs interact strongly with Egfr and other Ras1 signaling components in the wing and suppress the effects of disruptions in that pathway (ROCH et al. 1998 Down). In contrast, bs mutations enhance Ras1 defects in the egg, revealing important differences in the regulation of these two processes.

In tracheal development, bs functions in the terminal branching process that results from activity of breathless (FGF-R; reviewed by METZGER and KRASNOW 1999 Down), an RTK that can employ the Ras signaling cascade (WHITMAN and MELTON 1992 Down; KOUHARA et al. 1997 Down). Lack of bs or breathless function eliminates cellular outgrowths and terminates tracheal branching prematurely. Thus, SRF and FGF-R act in concert to regulate cellular morphogenesis and in these ways resemble SRF and Ras1 function in dorsal appendage formation.

Finally, we identified five alleles of the DSec61ß gene, which encodes a subunit of the DSec61 protein translocation channel (VALCARCEL et al. 1999 Down). DSec61ß is required for embryonic development; mutants die with poorly developed, transparent cuticles due to defective cuticle secretion. DSec61ß has also been implicated in D/V patterning of the egg. Loss of DSec61ß from the germ line results in variable dorsal appendage phenotypes ranging from forked to fused single dorsal appendages (VALCARCEL et al. 1999 Down). Valcárcel et al. propose that DSec61ß is involved in Grk secretion and that the eggshell phenotypes result from secretion of lower levels of Grk ligand from the oocyte to the overlying follicle cells.

Our identification of five alleles of DSec61ß, some with distinct phenotypes, is consistent with two potential roles for this protein during oogenesis. Four of the five alleles produced some level of dominant eggshell phenotypes characterized by translucent and flaccid eggs with shortened dorsal appendages. This phenotype was observed in a Ras+ background and may be due to a defect in chorion secretion. Nevertheless, these DSec61ß alleles also enhanced the Ras1 dorsal appendage phenotype, increasing the number of fused and forked appendages observed in Ras1ix12a homozygotes. This enhancement may be an additive effect between two mutations affecting coupled biological processes, patterning and secretion. One DSec61ß allele, however, l(2)k07819b, enhanced the Ras1 eggshell phenotype but did not produce the dominant chorion defects observed with the other four alleles. This latter observation suggests that the DSec61ß enhancement is specific and supports the hypothesis that the DSec61 channel participates in the secretion of Grk ligand. For these reasons, we place DSec61ß in the germ line (Fig 5).

Signaling molecules new to the Ras pathway:
A surprising and rewarding feature of our results is the identification of signaling and cytoskeletal components that had not been linked previously to the Ras1 pathway. Molecules such as Dock, Tec29, POSH, and potentially Nrk or TppII function in signal transduction pathways or share homology with known signaling proteins but are new to Egfr-regulated D/V patterning processes. Molecules such as Profilin (chic), Peanut, and Smt3 may not be directly involved in signaling, but all are associated with cytoskeletal processes in some way. These proteins may organize the signal transduction machinery or effect the reorganization of the cytoskeleton in response to signaling.

dock is the Drosophila homolog of the mammalian oncogene Nck and belongs to the SH2/SH3 adapter protein family. dock has an essential role during axon guidance in the development of the eye, functioning in the growth cones of photoreceptor axons (GARRITY et al. 1996 Down; HING et al. 1999 Down; RUAN et al. 1999 Down). Although the mammalian Nck protein interacts with the guanine nucleotide releasing protein, Sos (HU et al. 1995 Down), no previous evidence links Drosophila dock to Sos or the Ras1 signaling cascade. Recent proposals for Dock function in the nervous system are based on its interactions with Misshapen (RUAN et al. 1999 Down) and Pak (HING et al. 1999 Down), Ste20-like kinases that may regulate growth cone changes through phosphorylation of the cytoskeleton. Our epistasis tests place dock downstream of Egfr, potentially interacting with Sos and/or the Drosophila homologs of the Ste-20-like kinases (Fig 5).

Tec29 is a non-RTK molecule that was originally identified based on its homology to Src kinases (SIMON et al. 1983 Down). Mutations in Tec29 are embryonic lethal but clonal analyses reveal a role for Tec29 in ring canal formation during oogenesis. Egg chambers lacking Tec29 protein in the germ cells contain ring canals that are reduced in size and lack phosphoproteins as well as Tec29 itself (GUARNIERI et al. 1998 Down; ROULIER et al. 1998 Down). In addition, the nurse cells fail to transfer their cytoplasmic contents into the oocyte, producing small eggs. In spite of these defects, developing embryos deficient for maternally provided Tec29 exhibit no D/V patterning defects; indeed, 60% of embryos hatch (ROULIER et al. 1998 Down). This result suggests that Tec29 interacts with Ras1 through a function in the follicle cells (Fig 5).

Drosophila POSH is homologous to a mouse protein identified in a two-hybrid screen with RAC, a Ras-like GTPase that regulates cytoskeletal function. Data from cultured cells support the hypothesis that mouse POSH mediates RAC signaling by activating the JNK cascade and inducing subsequent transcriptional changes, rather than affecting cytoskeletal structure or activity directly (TAPON et al. 1998 Down). Our study is the first to demonstrate a function for this gene in Drosophila. Although we have not tested POSH function through mosaic analysis, its homology to other known signaling components suggests that POSH acts in the follicle cells (Fig 5).

l(2)k14301 is inserted at 49F7 and potentially affects two genes, Nrk and TppII. Nrk encodes an RTK of the Ror family (OISHI et al. 1997 Down). These proteins contain a cytoplasmic tyrosine kinase domain structurally related to the Trk family of receptors but differ in that their extracellular regions contain a "kringle" domain thought to mediate protein-protein interactions (WILSON et al. 1993 Down). To date, the ligand for this family of receptors is unknown. One other Drosophila gene shows homology to the Ror family of RTKs (WILSON et al. 1993 Down); both genes were thought to be expressed exclusively in the nervous system. Our results reveal unexpected expression of Nrk in the follicle cells and suggest that additional signaling events modulate follicle cell activity during eggshell morphogenesis (Fig 5). Moreover, the existence of a second RTK in this process could explain some aspects of the differential phenotypes produced by Ras1 compared to grk and Egfr mutations (SCHNORR and BERG 1996 Down). It is possible, for example, that Nrk interacts with Ras, Tec29, POSH, and Dock to modulate cytoskeletal structure or function. Alternatively, l(2)k14301 could be affecting TppII, a serine protease with demonstrated activity in degrading neuropeptide signals (RENN et al. 1998 Down). In mammalian systems, TppII homologs can compensate for loss of ubiquitin-mediated degradation pathways (WANG et al. 2000 Down). If TppII acts in oogenesis, it may interact with Smt3 (see below) in a novel pathway to modulate signaling or cytoskeletal functions in response to Ras. Thus, the recovery of a Nrk/TppII mutation in our screen is an exciting result that will facilitate further analyses of these patterning and morphogenetic events.

Ras signaling and the cytoskeleton:
The second main class of Ras1 Enhancers consists of mutations that disrupt bona fide cytoskeletal regulatory genes. These Enhancers may interact in the pathway in a variety of ways, as discussed below.

chickadee (chic) is the Drosophila homolog of Profilin (COOLEY et al. 1992 Down), a conserved actin binding protein. The chic gene produces both constitutive and ovary-specific transcripts through alternative promoters (see RESULTS and Fig 3). Mutations that disrupt the ovary-specific transcript result in sterile females that produce dumpless eggs; at a low frequency, these eggs exhibit fused dorsal appendages (COOLEY et al. 1992 Down; VERHEYEN and COOLEY 1994 Down; MANSEAU et al. 1996 Down). In these mutants, cytoplasmic actin cables in the nurse cells are missing. As a result, the rapid transfer of cytoplasm that occurs in late-stage 10 and 11 is disrupted when the nurse cell nuclei drift into the ring canals and impede further cytoplasmic flow.

The cause of the D/V patterning defect exemplified by the fused dorsal appendages is more obscure. The female sterile alleles do not disrupt follicle cell expression of chic, suggesting the defect is linked to chic function in the germ line. In situ hybridization studies, however, do not reveal a significant change in the level or degree of localization of grk mRNA, which encodes the TGF{alpha}-like D/V morphogen (NEUMAN-SILBERBERG and SCHUPBACH 1993 Down). These results suggest that the defect is more subtle than a gross perturbation of the cytoskeleton (MANSEAU and SCHUPBACH 1989 Down; MANSEAU et al. 1996 Down). Here, we have found that mutations disrupting either the ovary transcript or both the ovary and constitutive transcript of chic enhance a weak Ras1 eggshell phenotype. One explanation may involve the interaction of Chic, the actin cytoskeleton, and the microtubule-based cytoplasmic streaming thought to facilitate the uniform distribution of molecules in the oocyte during nurse cell cytoplasmic transfer (THEURKAUF 1994 Down; MANSEAU et al. 1996 Down). Premature streaming may inhibit the localization or function of molecules involved in translation or secretion of the Grk morphogen. Alternatively, Chic might be necessary to form an actin-based anchoring network critical for tethering Grk protein.

Although the data suggest that Chic must have a germ-line function (Fig 5), these data do not rule out an additional function in the follicle cells. During egg formation, follicle cells undergo shape changes and migrations while secreting the eggshell. These functions require the reorganization and directed movement of the follicle cell cytoskeleton, possibly effected in part by the Chic protein (EDWARDS et al. 1997 Down; reviewed by CARPENTER 2000 Down).

Likewise, the current evidence concerning the function of Peanut and Smt3 links these proteins to signaling and the cytoskeleton. peanut (pnut) is one of five Drosophila septin genes (reviewed by FIELD and KELLOGG 1999 Down) and was originally identified as a genetic enhancer of a weak allele of seven in absentia (sina; CARTHEW et al. 1994 Down). pnut is required for cytokinesis and is localized to the cleavage furrow of dividing cells (NEUFELD and RUBIN 1994 Down). How does heterozygous Pnut enhance a weak Ras1 phenotype? Both Pnut and Ras1 have been implicated in cell division (NEUFELD and RUBIN 1994 Down; PROBER and EDGAR 2000 Down) and a reduction in these proteins may inhibit cell division early in oogenesis resulting in later effects on egg morphogenesis. This possibility seems remote, however, since we do not observe any obvious defects in the follicular layer.

Alternatively, septins may be critical for the organization of the cytoskeleton and/or the localization of signal transduction components in the follicle cells. Septins are found in the cytoplasmic bridges during spermatogenesis (HIME et al. 1996 Down), but their distribution in oogenesis differs. In nurse cells, septins are not part of the ring canals or intracellular bridges but are found in the cytoplasm, while in follicle cells, septins are specifically localized to baso-lateral surfaces (FARES et al. 1995 Down). Septins also localize to areas of cortical reorganization (FARES et al. 1995 Down; KINOSHITA et al. 1997 Down) and thus may be important for follicle cell shape changes and migrations. In yeast, septins function to localize signaling molecules to the future bud site (reviewed by LONGTINE et al. 1996 Down; FIELD and KELLOGG 1999 Down). Thus, peanut may be critical for the correct localization, anchoring, and stability of the Ras1 signal transduction machinery in the follicle cells (Fig 5).

Interestingly, we also identified the ubiquitin-like gene smt3 as a Ras1 Enhancer. The smt3 gene product is a member of a new family of proteins that share many functional similarities with ubiquitin. Like ubiquitin, Smt3 proteins are post-translationally conjugated to target proteins, but the functional significance of this tagging is still under investigation. In human cells, cytosolic RanGAP1 is targeted to the nuclear pore after receiving an SMT3C (SUMO-1) protein tag (MAHAJAN et al. 1997 Down). SMT3C conjugation to I{kappa}B{alpha}, on the other hand, renders the inhibitory factor resistant to ubiquitination and results in the retention of NF{kappa}B in the cytoplasm (DESTERRO et al. 1998 Down). In Drosophila, the NF{kappa}B homolog Dorsal and the transcriptional repressor Tramtrack69 (TTk69) are tagged by Smt3 (LEHEMBRE et al. 2000 Down). Although the function of the Smt3 tag on TTk69 is not clear, Dorsal/Smt3 conjugates appear to migrate preferentially from the cytoplasm into the nucleus (BHASKAR et al. 2000 Down).

These observations suggest that Ras1 signaling may be affected by Smt3 conjugation to transcription factors. The ability of the smt3 mutant to suppress the activated Egfr eggshell phenotype suggests that Smt3 functions downstream of the Egfr receptor in the follicle cells (Fig 5). Thus, Smt3 might be involved in the modulation of transcription factors in the follicle cells. One candidate molecule is CF2, a zinc finger transcription factor negatively regulated by Egfr signaling. CF2 is retained in the cytoplasm of cells experiencing high levels of Ras1 signaling activity (MANTROVA and HSU 1998 Down). Smt3 may function together with MAP kinase to alter the conformation of CF2 and prevent import into the nucleus. Alternatively, Smt3 may be conjugated to transcription factors to facilitate their nuclear import. For example, Smt3 is known to show punctate nuclear staining in some tissues of the fly and interact with TTk69 (LEHEMBRE et al. 2000 Down). Thus, Ras1 activation may lead to the conjugation of Smt3 to transcription factors, leading to nuclear importation and/or modification of their binding activities (KIM et al. 1999 Down).

Recently, JOHNSON and BLOBEL 1999 Down and TAKAHASHI et al. 1999 Down have observed the conjugation of Smt3 protein to yeast septins. Genetic studies in yeast suggest that Smt3p may be important for the disassembly of septin rings during cytokinesis (JOHNSON and BLOBEL 1999 Down). Considering these yeast interaction data, the identification of pnut and smt3 as independent modifiers of Ras1 in our screen suggest that the smt3/Ras1 interaction may be dependent on pnut. Thus, rather than modifying a transcription factor, the Smt3 protein may affect Ras1 signaling by regulating septin dynamics and the cytoskeleton.

Together, these results suggest that effective Ras1 signaling during eggshell morphogenesis depends on molecules that control the dynamic cytoskeleton. As described above, molecules such as Chic, Tec29, Pnut, Smt3, and Dock are involved in cytoskeletal reorganization. The Ras1 pathway may require a properly assembled cytoskeletal scaffold to achieve adequate signaling levels to correctly pattern the egg. Alternatively, the Ras1 signal may induce reorganization of the follicle cell cytoskeleton during the later cell migrations and subsequent secretion of the eggshell. Such large-scale reorganization may depend on a number of these Ras1 Enhancers.

Future directions:
The completion of the Drosophila genomic DNA sequence allowed us to rapidly identify the genes in our Ras1 Enhancer collection. We are still working to understand the site of function of these genes during oogenesis and their relationship to Ras1 signaling. Suppression of the {lambda}top construct (smt3 and dock mutants) strongly suggests a function for a protein in the follicle cells downstream of Egfr. Failure to suppress the {lambda}top (Star and l(2)43Bb), however, is more difficult to interpret and suggests the gene may not be required for {lambda}top signaling or is not limiting in the pathway (Fig 5). We have begun clonal analysis of a subset of these genes to clarify their site of action more fully.

In conclusion, we have identified 13 Enhancers of Ras1 that define 11 known and 2 novel genes. The vast majority of these genes encode molecules that are new to D/V patterning and also new to Ras signaling, revealing the importance of analyzing apparently similar signaling processes that occur in tissues with diverse developmental outcomes. Our study provides a wealth of new genes that link signaling and the cytoskeleton, setting the stage for analysis of the molecular mechanisms that connect patterning and morphogenesis.


*  ACKNOWLEDGMENTS

We thank the Berkeley Drosophila Genome Project, the Bloomington Stock Center, Trudi Schüpbach, Larry Zipursky, Lynn Cooley, Kathleen Fitzpatrick, Mike Simon, Mark Krasnow, Doug Ruden, Jim Fristrom, Jim Clemens, Tian Xu, and Norbert Perrimon for sending fly strains, cDNAs, antibodies, or other reagents. Special thanks to Susan Parkhurst for coordinating the screen at the Fred Hutchinson Cancer Research Center. We are grateful to Hannele Ruohola-Baker and Karen James for critical reading of the manuscript. This work was supported by National Institutes of Health grant GM-45248 to C.A.B. and a Murdock Charitable Trust Fund grant to J.D.S.

Manuscript received December 28, 2000; Accepted for publication July 9, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ASHBURNER, M., 1989 Plasmid rescue of integrated transposons, pp. 321–323 in Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BANG, A. G. and C. KINTNER, 2000  Rhomboid and Star facilitate presentation and processing of the Drosophila TGF-alpha homolog Spitz. Genes Dev. 14:177-186[Abstract/Free Full Text].

BHASKAR, V., S. A. VALENTINE, and A. J. COUREY, 2000  A functional interaction between dorsal and components of the Smt3 conjugation machinery. J. Biol. Chem. 275:4033-4040[Abstract/Free Full Text].

BRAND, A. H. and N. PERRIMON, 1993  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415[Abstract].

BRAND, A. H. and N. PERRIMON, 1994  Raf acts downstream of the EGF receptor to determine dorsoventral polarity during Drosophila oogenesis. Genes Dev. 8:629-639[Abstract/Free Full Text].

CARPENTER, C. L., 2000  Actin cytoskeleton and cell signaling. Crit. Care Med. 28:N94-N99[Medline].

CARTHEW, R. W., T. P. NEUFELD, and G. M. RUBIN, 1994  Identification of genes that interact with the sina gene in Drosophila eye development. Proc. Natl. Acad. Sci. USA 91:11689-11693[Abstract/Free Full Text].

CLIFFORD, R. J. and T. SCHÜPBACH, 1989  Coordinately and differentially mutable activities of torpedo, the Drosophila melanogaster homolog of the vertebrate EGF receptor gene. Genetics 123:771-787[Abstract/Free Full Text].

COOLEY, L., E. VERHEYEN, and K. AYERS, 1992  chickadee encodes a profilin required for intercellular cytoplasm transport during Drosophila oogenesis. Cell 69:173-184[Medline].

COOPER, J. A. and D. P. KIEHART, 1996  Septins may form a ubiquitous family of cytoskeletal filaments. J. Cell Biol. 134:1345-1348[Free Full Text].

CORNELL, R. A. and D. KIMELMAN, 1994  Combinatorial signaling in development. Bioessays 16:577-581[Medline].

DESTERRO, J. M., M. S. RODRIGUEZ, and R. T. HAY, 1998  SUMO-1 modification of I{kappa}B{alpha} inhibits NF-{kappa}B activation. Mol. Cell 2:233-239[Medline].

DICKSON, B., 1995  Nuclear factors in sevenless signalling. Trends Genet. 11:106-111[Medline].

DUFFY, J. B. and N. PERRIMON, 1994  The torso pathway in Drosophila: lessons on receptor tyrosine kinase signaling and pattern formation. Dev. Biol. 166:380-395[Medline].

DYSON, S. and J. B. GURDON, 1998  The interpretation of position in a morphogen gradient as revealed by occupancy of activin receptors. Cell 93:557-568[Medline].

EDWARDS, K. A., M. DEMSKY, R. A. MONTAGUE, N. WEYMOUTH, and D. P. KIEHART, 1997  GFP-moesin illuminates actin cytoskeleton dynamics in living tissue and demonstrates cell shape changes during morphogenesis in Drosophila. Dev. Biol. 191:103-117[Medline].

FARES, H., M. PEIFER, and J. R. PRINGLE, 1995  Localization and possible functions of Drosophila septins. Mol. Biol. Cell 6:1843-1859[Abstract].

FIELD, C. M. and D. KELLOGG, 1999  Septins: cytoskeletal polymers or signalling GTPases? Trends Cell Biol. 9:387-394[Medline].

FRISTROM, D., P. GOTWALS, S. EATON, T. B. KORNBERG, and M. STURTEVANT et al., 1994  Blistered: a gene required for vein/intervein formation in wings of Drosophila. Development 120:2661-2671[Abstract/Free Full Text].

GARRITY, P. A., Y. RAO, I. SALECKER, J. MCGLADE, and T. PAWSON et al., 1996  Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein. Cell 85:639-650[Medline].

GOLEMBO, M., E. RAZ, and B. Z. SHILO, 1996  The Drosophila embryonic midline is the site of Spitz processing, and induces activation of the EGF receptor in the ventral ectoderm. Development 122:3363-3370[Abstract].

GONZÁLEZ-REYES, A., H. ELLIOTT, and D. ST. JOHNSTON, 1995  Polarization of both major body axes in Drosophila by gurken-torpedo signalling. Nature 375:654-658[Medline].

GUARNIERI, D. J., G. S. DODSON, and M. A. SIMON, 1998  SRC64 regulates the localization of a Tec-family kinase required for Drosophila ring canal growth. Mol. Cell 1:831-840[Medline].

GUILLEMIN, K., J. GROPPE, K. DUCKER, R. TREISMAN, and E. HAFEN et al., 1996  The pruned gene encodes the Drosophila serum response factor and regulates cytoplasmic outgrowth during terminal branching of the tracheal system. Development 122:1353-1362[Abstract].

HEBERLEIN, U. and G. M. RUBIN, 1991  Star is required in a subset of photoreceptor cells in the developing Drosophila retina and displays dosage sensitive interactions with rough. Dev. Biol. 144:353-361[Medline].

HEBERLEIN, U., I. K. HARIHARAN, and G. M. RUBIN, 1993  Star is required for neuronal differentiation in the Drosophila retina and displays dosage-sensitive interactions with Ras1. Dev. Biol. 160:51-63[Medline].

HEITZLER, P., D. COULSON, M.-T. SAENZ-ROBLES, M. ASHBURNER, and J. ROOTE et al., 1993  Genetic and cytogenetic analysis of the 43A-E region containing the segment polarity gene costa and the cellular polarity genes prickle and spiny-legs in Drosophila melanogaster.. Genetics 135:105-115[Abstract].

HIME, G. R., J. A. BRILL, and M. T. FULLER, 1996  Assembly of ring canals in the male germ line from structural components of the contractile ring. J. Cell Sci. 109:2779-2788[Abstract].

HING, H., J. XIAO, N. HARDEN, L. LIM, and S. L. ZIPURSKY, 1999  Pak functions downstream of Dock to regulate photoreceptor axon guidance in Drosophila. Cell 97:853-863[Medline].

HOROWITZ, H. and C. A. BERG, 1995  Aberrant splicing and transcription termination caused by P element insertion into the intron of a Drosophila gene. Genetics 139:327-335[Abstract].

HSU, J. C. and N. PERRIMON, 1994  A temperature-sensitive MEK mutation demonstrates the conservation of the signaling pathways activated by receptor tyrosine kinases. Genes Dev. 8:2176-2187[Abstract/Free Full Text].

HU, Q., D. MILFAY, and L. T. WILLIAMS, 1995  Binding of NCK to SOS and activation of ras-dependent gene expression. Mol. Cell. Biol. 15:1169-1174[Abstract].

HUANG, A. M. and G. M. RUBIN, 2000  A misexpression screen identifies genes that can modulate RAS1 pathway signaling in Drosophila melanogaster.. Genetics 156:1219-1230[Abstract/Free Full Text].

HUANG, H. W., S. C. TSOI, Y. H. SUN, and S. S. LI, 1998  Identification and characterization of the SMT3 cDNA and gene encoding ubiquitin-like protein from Drosophila melanogaster.. Biochem. Mol. Biol. Int. 46:775-785[Medline].

JOHNSON, E. S. and G. BLOBEL, 1999  Cell cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast septins. J. Cell Biol. 147:981-994[Abstract/Free Full Text].

KIM, Y. H., C. Y. CHOI, and Y. KIM, 1999  Covalent modification of the homeodomain-interacting protein kinase 2 (HIPK2) by the ubiquitin-like protein SUMO-1. Proc. Natl. Acad. Sci. USA 96:12350-12355[Abstract/Free Full Text].

KINOSHITA, M., S. KUMAR, A. MIZOGUCHI, C. IDE, and A. KINOSHITA et al., 1997  Nedd5, a mammalian septin, is a novel cytoskeletal component interacting with actin-based structures. Genes Dev. 11:1535-1547[Abstract/Free Full Text].

KOKAME, K., H. KATO, and T. MIYATA, 1997  Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. J. Biol. Chem. 271:29659-29665[Abstract/Free Full Text].

KOLODKIN, A. L., A. T. PICKUP, D. M. LIN, C. S. GOODMAN, and U. BANERJEE, 1994  Characterization of Star and its interactions with sevenless and EGF receptor during photoreceptor cell development in Drosophila. Development 120:1731-1745[Abstract].

KOUHARA, H., Y. R. HADARI, K. T. SPIVAK, J. SCHILLING, and S. D. BAR et al., 1997  A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89:693-702[Medline].

LEHEMBRE, F., P. BADENHORST, S. MULLER, A. TRAVERS, and F. SCHWEISGUTH et al., 2000  Covalent modification of the transcriptional repressor tramtrack by the ubiquitin-related protein Smt3 in Drosophila flies. Mol. Cell. Biol. 20:1072-1082[Abstract/Free Full Text].

LONGTINE, M. S., D. J. DEMARINI, M. L. VALENCIK, A. O. AL, and H. FARES et al., 1996  The septins: roles in cytokinesis and other processes. Curr. Opin. Cell Biol. 8:106-119[Medline].

MA, C., H. LIU, Y. ZHOU, and K. MOSES, 1996  Identification and characterization of autosomal genes that interact with glass in the developing Drosophila eye. Genetics 142:1199-1213[Abstract].

MAHAJAN, R., C. DELPHIN, T. GUAN, L. GERACE, and F. MELCHIOR, 1997  A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88:97-107[Medline].

MANSEAU, L., J. CALLEY, and H. PHAN, 1996  Profilin is required for posterior patterning of the Drosophila oocyte. Development 122:2109-2116[Abstract].

MANSEAU, L. J. and T. SCHÜPBACH, 1989  cappuccino and spire: two unique maternal-effect loci required for both the anteroposterior and dorsoventral patterns of the Drosophila embryo. Genes Dev. 3:1437-1452[Abstract/Free Full Text].

MANTROVA, E. Y. and T. HSU, 1998  Down-regulation of transcription factor CF2 by Drosophila Ras/MAP kinase signaling in oogenesis: cytoplasmic retention and degradation. Genes Dev. 12:1166-1175[Abstract/Free Full Text].

METZGER, R. J. and M. A. KRASNOW, 1999  Genetic control of branching morphogenesis. Science 284:1635-1639[Abstract/Free Full Text].

MONTAGNE, J., J. GROPPE, K. GUILLEMIN, M. A. KRASNOW, and W. J. GEHRING et al., 1996  The Drosophila Serum Response Factor gene is required for the formation of intervein tissue of the wing and is allelic to blistered.. Development 122:2589-2597[Abstract].

MORIMOTO, A. M., K. C. JORDAN, K. TIETZE, J. S. BRITTON, and E. M. O'NEILL et al., 1996  Pointed, an ETS domain transcription factor, negatively regulates the EGF receptor pathway in Drosophila oogenesis. Development 122:3745-3754[Abstract].

NEUFELD, T. P. and G. M. RUBIN, 1994  The Drosophila peanut gene is required for cytokinesis and encodes a protein similar to yeast putative bud neck filament proteins. Cell 77:371-379[Medline].

NEUMAN-SILBERBERG, F. S. and T. SCHÜPBACH, 1993  The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF {alpha}-like protein. Cell 75:165-174[Medline].

NILSON, L. A. and T. SCHÜPBACH, 1999  EGF receptor signaling in Drosophila oogenesis. Curr. Top. Dev. Biol. 44:203-243[Medline].

OISHI, I., S. SUGIYAMA, Z. J. LIU, H. YAMAMURA, and Y. NISHIDA et al., 1997  A novel Drosophila receptor tyrosine kinase expressed specifically in the nervous system. Unique structural features and implication in developmental signaling. J. Biol. Chem. 272:11916-11923[Abstract/Free Full Text].

PERI, F. and S. ROTH, 2000  Combined activities of Gurken and decapentaplegic specify dorsal chorion structures of the Drosophila egg. Development 127:841-850[Abstract].

PICKUP, A. T. and U. BANERJEE, 1999  The role of Star in the production of an activated ligand for the EGF receptor signaling pathway. Dev. Biol. 205:254-259[Medline].

PROBER, D. A. and B. A. EDGAR, 2000  Ras1 promotes cellular growth in the Drosophila wing. Cell 100:435-446[Medline].

QUEENAN, A. M., A. GHABRIAL, and T. SCHÜPBACH, 1997  Ectopic activation of torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124:3871-3880[Abstract].

RAABE, T., 1998  Genetic analysis of sevenless tyrosine kinase signaling in Drosophila. Curr. Top. Microbiol. Immunol. 228:343-361[Medline].

RAO, Y. and S. L. ZIPURSKY, 1998  Domain requirements for the Dock adapter protein in growth-cone signaling. Proc. Natl. Acad. Sci. USA 95:2077-2082[Abstract/Free Full Text].

RAY, R. P. and T. SCHÜPBACH, 1996  Intercellular signaling and the polarization of body axes during Drosophila oogenesis. Genes Dev. 10:1711-1723[Free Full Text].

RENN, S. C. P., B. TOMKINSON, and P. H. TAGHERT, 1998  Characterization and cloning of tripeptidyl peptidase II from the fruit fly, Drosophila melanogaster.. J. Biol. Chem. 273:19173-19182[Abstract/Free Full Text].

ROCH, F., A. BAONZA, B. E. MARTÍN, and B. A. GARCÍA, 1998  Genetic interactions and cell behaviour in blistered mutants during proliferation and differentiation of the Drosophila wing. Development 125:1823-1832[Abstract].

ROTH, S. and T. SCHÜPBACH, 1994  The relationship between ovarian and embryonic dorsoventral patterning in Drosophila. Development 120:2245-2257[Abstract].

ROTH, S., F. S. NEUMAN-SILBERBERG, G. BARCELO, and T. SCHÜPBACH, 1995  cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell 81:967-978[Medline].

ROULIER, E. M., S. PANZER, and S. K. BECKENDORF, 1998  The Tec29 tyrosine kinase is required during Drosophila embryogenesis and interacts with Src64 in ring canal development. Mol. Cell 1:819-829[Medline].

RUAN, W., P. PANG, and Y. RAO, 1999  The SH2/SH3 adaptor protein dock interacts with the Ste20-like kinase misshapen in controlling growth cone motility. Neuron 24:595-605[Medline].

RUDEN, D. M., X. WANG, W. CUI, D. MORI, and M. ALTERMAN, 1999  A novel follicle-cell-dependent dominant female sterile allele, StarKojak, alters receptor tyrosine kinase signaling in Drosophila. Dev. Biol. 207:393-407[Medline].

SCHNORR, J. D. and C. A. BERG, 1996  Differential activity of Ras1 during patterning of the Drosophila dorsoventral axis. Genetics 144:1545-1557[Abstract].

SCHÜPBACH, T., 1987  Germ line and soma cooperate during oogenesis to establish the dorsoventral pattern of egg shell and embryo in Drosophila melanogaster.. Cell 49:699-707[Medline].

SCHÜPBACH, T. and E. WIESCHAUS, 1991  Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics 129:1119-1136[Abstract].

SCHWEITZER, R. and B. Z. SHILO, 1997  A thousand and one roles for the Drosophila EGF receptor. Trends Genet. 13:191-196[Medline].

SHIMONO, A., T. OKUDA, and H. KONDOH, 1999  N-myc-dependent repression of Ndr1, a gene identified by direct subtraction of whole mouse embryo cDNAs between wild type and N-myc mutant. Mech. Dev. 83:39-52[Medline].

SIMON, M. A., 2000  Receptor tyrosine kinases: specific outcomes from general signals. Cell 103:13-15[Medline].

SIMON, M. A., T. B. KORNBERG, and J. M. BISHOP, 1983  Three loci related to the src oncogene and tyrosine-specific protein kinase activity in Drosophila. Nature 302:837-839[Medline].

SPRADLING, A. C., D. M. STERN, I. KISS, J. ROOTE, and T. LAVERTY et al., 1995  Gene disruptions using P-transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92:10824-10830[Abstract/Free Full Text].

SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999  The Berkeley Drosophila Genome Project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177[Abstract/Free Full Text].

STEVENS, L., 1998  Twin peaks: Spitz and Argos star in patterning of the Drosophila egg. Cell 95:291-294[Medline].

STURTEVANT, M. A., M. ROARK, and E. BIER, 1993  The Drosophila rhomboid gene mediates the localized formation of wing veins and interacts genetically with components of the EGF-R signaling pathway. Genes Dev. 7:961-973[Abstract/Free Full Text].

TAKAHASHI, Y., M. IWASE, M. KONISHI, M. TANAKA, and E. A. TOH et al., 1999  Smt3, a SUMO-1 homolog, is conjugated to Cdc3, a component of septin rings at the mother-bud neck in budding yeast. Biochem. Biophys. Res. Commun. 259:582-587[Medline].

TAN, P. B. and S. K. KIM, 1999  Signaling specificity: the RTK/RAS/MAP kinase pathway in metazoans. Trends Genet. 15:145-149[Medline].

TAPON, N., K. NAGATA, N. LAMARCHE, and A. HALL, 1998  A new Rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-{kappa}B signalling pathways. EMBO J. 17:1395-1404[Medline].

THEURKAUF, W. E., 1994  Premature microtubule-dependent cytoplasmic streaming in cappuccino and spire mutant oocytes. Science 265:2093-2096[Abstract/Free Full Text].

RÖK, T., G. TICK, M. ALVARADO, and I. KISS, 1993  P-lacW insertional mutagenesis on the second chromosome of Drosophila melanogaster: isolation of lethals with different overgrowth phenotypes. Genetics 135:71-80[Abstract].

TREISMAN, R., 1994  Ternary complex factors: growth factor regulated transcriptional activators. Curr. Opin. Genet. Dev. 4:96-101[Medline].

VALCÁRCEL, R., U. WEBER, D. B. JACKSON, V. BENES, and W. ANSORGE et al., 1999  Sec61ß, a subunit of the protein translocation channel, is required during Drosophila development. J. Cell Sci. 112:4389-4396[Abstract].

VERHEYEN, E. M. and L. COOLEY, 1994  Profilin mutations disrupt multiple actin-dependent processes during Drosophila development. Development 120:717-728[Abstract].

WANG, E.W., B. M. KESSLER, A. BORODOVSKY, B. F. CRAVATT, and M. BOGYO et al., 2000  Integration of the ubiquitin-proteasome pathway with a cytosolic oligopeptidase activity. Proc. Natl. Acad. Sci. USA 97:9990-9995[Abstract/Free Full Text].

WASSARMAN, D. A., M. THERRIEN, and G. M. RUBIN, 1995  The Ras signaling pathway in Drosophila. Curr. Opin. Genet. Dev. 5:44-50[Medline].

WASSERMAN, J. D. and M. FREEMAN, 1998  An autoregulatory cascade of EGF receptor signaling patterns the Drosophila egg. Cell 95:355-364[Medline].

WHITMAN, M. and D. A. MELTON, 1992  Involvement of p21ras in Xenopus mesoderm induction. Nature 357:252-254[Medline].

WILSON, C., D. C. GOBERDHAN, and H. STELLER, 1993  Dror, a potential neurotrophic receptor gene, encodes a Drosophila homolog of the vertebrate Ror family of Trk-related receptor tyrosine kinases. Proc. Natl. Acad. Sci. USA 90:7109-7113[Abstract/Free Full Text].

YAMAUCHI, Y., S. HONGO, T. OHASHI, S. SHIODA, and C. ZHOU et al., 1999  Molecular cloning and characterization of a novel developmentally regulated gene, Bdm1, showing predominant expression in postnatal rat brain. Brain Res. 68:149-158.




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
J. Taylor, K.-H. Chung, C. Figueroa, J. Zurawski, H. M. Dickson, E. J. Brace, A. W. Avery, D. L. Turner, and A. B. Vojtek
The Scaffold Protein POSH Regulates Axon Outgrowth
Mol. Biol. Cell, December 1, 2008; 19(12): 5181 - 5192.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. Artero, E. E. Furlong, K. Beckett, M. P. Scott, and M. Baylies
Notch and Ras signaling pathway effector genes expressed in fusion competent and founder cells during Drosophila myogenesis
Development, December 22, 2003; 130(25): 6257 - 6272.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. E. James, J. B. Dorman, and C. A. Berg
Mosaic analyses reveal the function of Drosophila Ras in embryonic dorsoventral patterning and dorsal follicle cell morphogenesis
Development, January 5, 2002; 129(9): 2209 - 2222.
[Abstract] [Full Text] [PDF]