- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Toivonen, J. M.
- Articles by Jacobs, H. T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Toivonen, J. M.
- Articles by Jacobs, H. T.
technical knockout, a Drosophila Model of Mitochondrial Deafness
Janne M. Toivonen1,a, Kevin M. C. O'Dell1,b, Nathalie Petitc, Sharon C. Irvineb, Gillian K. Knightb, Marjo Lehtonena, Mark Longmuira, Kaisa Luotoa, Sylvie Touraillec, Zongsheng Wangb, Serge Alziaric, Zahid H. Shaha, and Howard T. Jacobsa,ba Institute of Medical Technology & Tampere University Hospital, FIN-33014 University of Tampere, Finland,
b IBLS Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, Scotland
c UMR CNRS 6547, Equipe Génome Mitochondrial, Université Blaise Pascal, 63177 Aubière Cedex, France
Corresponding author: Howard T. Jacobs, Institute of Medical Technology, FIN-33014 University of Tampere, Finland., howy.jacobs{at}uta.fi (E-mail)
Communicating editor: K. J. NEWTON
| ABSTRACT |
|---|
Mutations in mtDNA-encoded components of the mitochondrial translational apparatus are associated with diverse pathological states in humans, notably sensorineural deafness. To develop animal models of such disorders, we have manipulated the nuclear gene for mitochondrial ribosomal protein S12 in Drosophila (technical knockout, tko). The prototypic mutant tko25t exhibits developmental delay, bang sensitivity, impaired male courtship, and defective response to sound. On the basis of a transgenic reversion test, these phenotypes are attributable to a single substitution (L85H) at a conserved residue of the tko protein. The mutant is hypersensitive to doxycyclin, an antibiotic that selectively inhibits mitochondrial protein synthesis, and mutant larvae have greatly diminished activities of mitochondrial redox enzymes and decreased levels of mitochondrial small-subunit rRNA. A second mutation in the tko gene, Q116K, which is predicted to impair the accuracy of mitochondrial translation, results in the completely different phenotype of recessive female sterility, based on three independent transgenic insertions. We infer that the tko25t mutant provides a model of mitochondrial hearing impairment resulting from a quantitative deficiency of mitochondrial translational capacity.
MITOCHONDRIAL DNA (mtDNA) in metazoans encodes a small subset of the polypeptide subunits of the mitochondrial redox complexes, plus the RNA components of the mitochondrial translational apparatus (![]()
![]()
![]()
![]()
Although some progress has been made in understanding how mtDNA mutations lead to impaired bioenergetic function at the cellular level, many issues remain unresolved. For example, it is unclear whether mtDNA mutations in components of the translational apparatus produce disease by quantitative or qualitative interference with mitochondrial translation. The tissue specificity of mitochondrial disease remains largely unexplained, and the pathological process in the whole organism is little understood. Moreover, research in this area is hampered by the lack of animal models resulting from the intractability of manipulating mtDNA in vitro.
To circumvent these difficulties, we are exploiting a previously isolated mutant in the fruit fly Drosophila that has phenotypic features strongly reminiscent of mitochondrial disease. This mutant (technical knockout, tko, mutant allele tko25t) has a phenotype of bang sensitivity (![]()
![]()
![]()
![]()
The tko mutant phenotype can be fully complemented transgenically by a 3.2-kb fragment of genomic DNA containing a single transcription unit that encodes a homologue of bacterial ribosomal protein S12 (![]()
![]()
![]()
![]()
Thus far, tko25t is the only viable mutant allele of the gene that has been isolated, all others being recessive larval lethals. tko25t is itself recessive, and is also female hemizygous lethal, presumably because it is a hypomorph for which half the normal gene dosage is insufficient to complete development. Sequence analysis of the coding region of the mitochondrial ribosomal protein S12 encoded at this locus in wild-type (Canton-S) and tko25t flies revealed a single amino-acid difference (L85H) affecting a phylogenetically conserved leucine residue (![]()
![]()
![]()
In this article we report the results of genetic, biochemical, and behavioral experiments that indicate that the tko25t mutant represents a valid model for mitochondrial hearing impairment in humans and contribute important information regarding the molecular mechanism of this disorder. First, we reveal novel details of the tko25t mutant phenotype involving defects in developmental timing, courtship, and hearing. Second, we show by various approaches that the mutant phenotype is associated with a quantitative deficiency of mitochondrial translation. Third, we demonstrate, by a transgenic reversion test, that the L85H substitution is indeed the cause of the main features of the tko25t mutant phenotype.
| MATERIALS AND METHODS |
|---|
Flies and fly culture:
tko25t mutant flies were kindly supplied by Dr. C.-F. Wu. The tko3 line tko3/FM7a/Dp(1;2;Y)w+ was obtained from the Drosophila Stock Center (Bloomington, IN) and outcrossed to an existing FM7 balancer strain. Other strains used were Canton-S (wild type), 0713 (inbred wild type), and w1118 (for micro-injection). Flies were cultured on a standard oatmeal and molasses medium seeded with live yeast, to which was added various antibiotics (doxycyclin or streptomycin) as indicated in the text or figure legends. For behavioral and developmental analyses flies were maintained at 25° on a 12 hr:12 hr light:dark cycle, unless otherwise stated. To assess developmental timing neutral red (an inert dye) was added to the media of both wild-type and tko25t mutant flies.
Behavioral assays:
Bang sensitivity was measured, essentially as in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
Oligonucleotides:
All oligonucleotides were purchased from DNA Technology (Aarhus, Denmark). Oligonucleotides used for PCR and PCR in vitro mutagenesis (see Fig 5 for their approximate locations) were as follows, with all sequences given in the 5' to 3' direction. For the tko coding strand
- tko-53: CGGGATCCAGATAATCGTAGGACAGGTCGGCAGA,

View larger version (17K):
In this window
In a new window
Download PPT slide
Figure 1. Bang-sensitive phenotype of tko25t mutant flies. (a) Recovery times from paralysis after 10 sec of vortexing (mean ± SE of measurements on 10 individual flies of each sex and genotype) of wild-type and tko25t mutant flies, tested between 24 hr after eclosion, both with and without outbreeding. Note large standard errors for mutant flies due to "outliers" with very long recovery times. (b) Reactivity measurements on wild-type and tko25t adults (3 days old), plotted as mean distance traveled (centimeters traveled per minute) in the open-field chamber over the 10-min period after the initial mechanical disturbance. Means are from 10 flies of each sex and genotype. For clarity, standard errors are not shown on the figure, but were generally in the range of 14 cm for each data point plotted; hence, the differences between mutant and wild-type flies are highly significant. 
View larger version (17K):
In this window
In a new window
Download PPT slide
Figure 2. Impaired sound responsiveness of tko25t mutant flies. Hearing was measured by the male courtship song response assay as described in the text. The mean number of flies (±SD), in batches of six, responding to courtship song played for 1 min and 10 min is plotted against sound intensity. Filled circles and solid lines, wild-type males; open circles and dotted lines, tko25t mutant males. Faint horizontal lines indicate the zero response level. Wild-type (hearing) flies show pronounced response at 7090 dB even after 1 min, whereas mutant flies show only a minimal response at abnormally high volume (100 dB) over 10 min. 
View larger version (22K):
In this window
In a new window
Download PPT slide
Figure 3. Developmental delay and doxycyclin hypersensitivity of tko25t mutant flies. (a) Total numbers of flies eclosing after growth at 25° on medium containing increasing concentrations of doxycyclin, each data point representing the offspring from 30 females, set up in 5 replicate vials (6 females plus 3 males each). Filled circles, wild-type Canton-S; open circles, tko25t. (b) Mean eclosion day of the same flies, plotted similarly, males and females pooled. The ratio of males and females eclosing was unaffected by the drug. SEs are omitted for clarity, but were all <0.1 days. 
View larger version (23K):
In this window
In a new window
Download PPT slide
Figure 4. Metabolic and rRNA analysis of tko25t mutant third instar larvae. (a) Enzymatic activities of mitochondria isolated from Canton-S, inbred wild-type (0713), and tko25t mutant larvae. cI, complex 1 (NADH:ubiquinone oxidoreductase); cIII, complex III (ubiquinol:cytochrome c oxidoreductase); cIV, complex IV (cytochrome c oxidase). Citrate synthase activities showed no significant differences between the strains. (b) ATP synthesis capacities of mitochondria isolated from the three strains, using the following different substrates: Pyr-Mal, pyruvate plus malate; GP,
-glycerophosphate; and Asc-TMPD, ascorbate plus TMPD. (c) Northern hybridization of RNA from third instar larvae of tko25t and Canton-S strains, probed simultaneously for mitochondrial 12S and 16S rRNA. Autoradiographic exposure time was 25 min.
View larger version (17K):
In this window
In a new window
Download PPT slide
Figure 5. Cloning/mutagenesis scheme for creation of transgenic flies. For full details refer to MATERIALS AND METHODS. (a) Schematic map of the 3.2-kb BamHI fragment of genomic DNA from the mutant strain tko25t. The two exons of the gene are shown as shaded boxes, and the single intron is shown as an open box, with the positions and orientations of primers tko-52 and tko-32 indicated. The mutant carries a C
A point mutation at codon 85 of the coding sequence, replacing a conserved leucine with histidine (see also Fig 6E). (b) Genomic DNA from the mutant strain was digested with BamHI, circularized by ligation (dotted line), and amplified using primers tko-52 and tko-32 to generate the 1.7-kb "flanking" fragment cloned as gtkoII. (c) The entire 3.2-kb BamHI fragment was cloned from tko25t genomic DNA using primers tko-53 and tko-33. The fragment was cloned directly into the P-element vector pP{CaSpeR-4} to generate the "mutant" construct pP{CaSpeR-4}/tko(25t)-BamHI for micro-injection, from which transgenic lines A1A3 were obtained. (d) A two-stage PCR in vitro mutagenesis strategy was used to create the replacement mutation at residue 85, restoring the wild-type decoding specificity for leucine. The products of the first step were mixed and reamplified using the terminal primers, then recloned into the vector to create e, the reverted construct pP{CaSpeR-4}/tko(25t)-BamHI-H85L, from which transgenic lines B1B8 were obtained. To introduce the Q116K substitution, an equivalent procedure was employed, starting from the in vitro-reverted construct (e). From the eventual construct pP{CaSpeR-4}/tko-BamHI/EcoRI-Q116K transgenic lines Q116K(1), Q116K(3), and Q116K(6) were obtained. - H85L-1: GTGCTGGTGCGCCTCTCCACCGGCAAG,
- Q116K-1: GTGGGGCGTCTGAAGGACGTGCCCGG,
- tko-32: ACCACTTCCTAATCACGTTGTTCAAATG,
- tko-54: CGGGATCCAGATAATCGTAGGACAGGT, and
- tko-56: CGGGATCCGAATATTAGCTTTAAGGCACCCG.
- For the noncoding strand
- tko-52: CGGAGTTTTGTTCAGTAGTTTTCTGTTC,
- H85L-2: TTGCCGGTGGAGAGGCGCACCAGCAC,
- Q116K-2: CCGGGCACGTCCTTCAGACGCCCCAC,
- tko-33: CGGGATCCTGATATTATATAGCTTGCAATCAG
- AGATA, tko-34: CGGGATCCTGATATTATATAGCTTGCAAT, and
- tko-36: CGGAATTCTGATATTATATAGCTTGCAAT.
For the mutagenic primers H85L-1, H85L-2, Q116K-1, and Q116K-2 the nucleotides that introduce the mutation are underlined. Restriction sites used for cloning (in every case BamHI, except EcoRI for tko-36) are double underlined. Note that primers tko-54 and tko-34 overlap, respectively, tko-53 and tko-33, but are slightly shorter, giving better compatibility with the mutagenic primers. For DNA sequencing of the cloned 3.2-kb BamHI fragment containing the tko gene, standard vector primers plus the following were used, in addition to some of those listed above: P-in, GATGAAATAACATAAGGTGGTCCCGTCG (P-element-specific); tko-55, CTAAATAGCTTCCGAGCAAG [coding strand, 5' untranslated region (UTR)]; tko-51, GAACAGAAAACTACTGAACAAAACTCCG (coding strand, 5' UTR just upstream of the translation start); tko-35, GCAGCTAATGGCCACCAAATC (noncoding strand, near start of intron); tko-I2, GGTCGCAGTTTAGGAGACAATAGGTG (coding strand, near middle of intron); and tko-31, CATTTGAACAACGTGATTAGGAAGTGGT (noncoding strand, end of coding sequence). For PCR amplification of fragments of Drosophila mtDNA to create probes for Northern hybridization, the following primers (supplied by Genset, Paris), were used. For 16S rRNA,
- D16S-1: AGAAACCAACCTGGCTTACACCGG
- D16S-2: AAGACATGTTTTTGTTAAACAGGCGAATA.
For 12S rRNA,
- D12S-1: TCATTCTAGATACACTTTCCAGTACATC
- D12S-2: ACCGCGACTGCTGGCACCAATTTAGT.
PCR cloning and in vitro mutagenesis:
Except where stated, all steps were carried out using standard procedures (![]()
![]()
DNA sequencing and informatics:
Plasmid DNAs and PCR products were sequenced using dye-terminator chemistry on the ABI 310 Genetic Analyzer (Perkin-Elmer, Foster City, CA), with kit reagents supplied by the manufacturer, plus standard (M13R, T7) and customized primer oligonucleotides as listed above. DNA sequences were analyzed using the GCG package (Program Manual for the Wisconsin Package, 1994).
Mitochondrial preparation:
Mitochondria were isolated by differential centrifugation of third instar larvae ground in buffer containing 0.22 M sucrose, 0.12 M mannitol, 10 mM Tricine, pH 7.6, and 1 mM EDTA, as described previously (![]()
![]()
1 mg ml-1) were sonicated for 6 sec at 4°, frozen, and thawed, except when used for ATP synthesis determination.
Assays of mitochondrial redox activities:
All activities except ATP synthesis were measured at 28° and expressed in nanomoles per minute per milligram. Complex I (NADH:ubiquinone oxidoreductase) activity was monitored by NADH oxidation at 340 nm (
= 6220 M-1 cm-1) in pH 7.2 buffer containing 35 mM NaH2PO4, 5 mM MgCl2, and 2.5 mg/ml bovine serum albumin (BSA), in the presence of 2 µg/ml antimycin, 2 mM potassium cyanide, 97.5 µM ubiquinone, 0.13 mM NADH, and 40 µg mitochondrial protein (![]()
= 18,500 M-1 cm-1) in pH 7.2 buffer containing 35 mM NaH2PO4, 5 mM MgCl2, and 2.5 mg/ml BSA in the presence of 2 mM KCN, 2 µg/ml rotenone, 15 µM ubiquinol, 15 µM cytochrome c, and 5 µg mitochondrial protein (![]()
0.75), monitored at 550 nm (
= 18,500 M-1 cm-1) in pH 7.4 buffer containing 30 mM KH2PO4, 1 mM EDTA, 56 µM cytochrome c, and 5 µg mitochondrial protein (![]()
= 13,600 M-1 cm-1) in 100 mM Tris-HCl, pH 8 buffer, 2.5 mM EDTA, 37 µM acetyl-CoA, 75 µM DTNB, 300 µM oxaloacetate, and 5 µg mitochondrial protein (![]()
![]()
![]()
-glycerophosphate, or 3.3 mM ascorbate + 80 µM TMPD. Calibration was performed at the end of each measurement by the addition of 200 pmol of ATP.
P-element transgenesis:
DNA from pP{CaSpeR-4} constructs was micro-injected into recipient w1118 embryos together with DNA from P-element transposase-encoding plasmid pUChs
2-3 (![]()
![]()
DNA extraction and Southern hybridization:
Aliquots of 20 flies were ground in 500 µl lysis buffer [100 mM Tris-HCl, pH 8.5, 80 mM NaCl, 5% (w/v) sucrose, 0.5% (w/v) SDS, 50 mM EDTA, pH 8.0], frozen at -20°, and then incubated at 70° for 30 min. KCl was added to 400 mM and samples were placed on ice for 30 min. The precipitates were removed by centrifugation and the supernatants were extracted twice with phenol/chloroform (1:1) and precipitated with 0.75 volume isopropanol. DNA precipitates were washed with 70% ethanol, dried, and dissolved in 45 µl TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing 20 µg/ml boiled RNase A. One-third of each DNA aliquot was digested overnight with EcoRV (manufacturer's buffer and recommended conditions; New England Biolabs), and fractionated on a 1% agarose gel. Depurination, capillary blotting to MagnaCharge nylon membrane (Osmonics, Inc., Westborough, MA), and UV cross-linking used standard methods (![]()
-32P]dCTP (3000 Ci/mmol; Amersham, Pharmacia UK, Buckinghamshire). The blot was washed at 65° for 20 min with 3x SSC, 0.1% SDS, twice for 20 min with 0.3x SSC, 0.1% SDS, and finally for 10 min in the same buffer before autoradiography.
RNA extraction and Northern hybridization:
Third instar larvae (
100 mg) were homogenized in Trizol reagent (GIBCO-BRL, Gaithersburg, MD) and total RNA was extracted according to the manufacturer's instructions. Between 5 and 30 µg of RNA from larvae of each strain were ethanol precipitated, air dried, and resuspended in 4.5 µl pyrocarbonic acid diethyl ester-treated water, to which was added 2 µl 5x MOPS buffer (![]()
![]()
| RESULTS |
|---|
The tko25t mutant phenotype:
Previous studies of tko25t mutant flies demonstrated bang sensitivity associated with mechanoreceptor failure and a possible structural abnormality of mechanosensory organs, as well as female hemizygous lethality. To document the phenotype more precisely in a developmental context, we studied inbred tko25t flies, as well as some that had been partially outbred for several generations by being maintained as heterozygotes with the FM7 balancer chromosome (![]()
The adult fly, even when inbred, still suffers a clear sensory and/or behavioral defect, as demonstrated by the results of activity measurements (Fig 1B). The mean reactivity (measured as the distance traveled in the first minute in response to a mechanical disturbance) of the mutant flies was less than half that of the wild-type flies. However, mutant males and females showed normal activity in a circadian rhythm machine (data not shown) and were rhythmic, indicating that their activity defect is specifically in reactivity. Courtship analysis, in which wild-type and tko25t flies were mated in all combinations of gender and genotype (Table 1), also revealed evidence for sensory/behavioral abnormalities. The tko25t males were rejected by wild-type females, but wild-type males were equally successful at courting either tko25t or wild-type females. tko25t males were moderately successful in courting tko25t females, but also showed a substantially prolonged courtship and reduced mating time compared with wild type.
|
Flies were tested for a hearing deficit by exposure to experimentally generated courtship song batches of males whose wings had been surgically removed (![]()
![]()
Mutant flies showed several other developmental abnormalities that are not obviously attributable to a sensorineural deficit. At 25° they took
23 days longer to develop than their wild-type counterparts, eclosing on days 1213 instead of on days 1011 (Fig 3). The effect was more marked in males than in females. In three independent experiments, each involving the offspring from 30 females, mutant males showed a mean developmental delay to eclosion of 2.40 ± 0.10 days, whereas the delay in females was 2.17 ± 0.06 days. Daily observations of the developing flies indicated that the delay occurred almost exclusively during the larval stages, mainly the second and third larval instars. No delay was evident during embryogenesis; i.e., mutant larvae hatched at the same time as wild type, whereas pupariation was at least 2 days late in the mutants. The mutant allele had no maternal effect on developmental timing. Heterozygous offspring of tko25t or wild-type mothers eclosed at the same time as each other and as wild-type flies, whereas mutant flies were delayed regardless of whether their mothers were heterozygous or homozygous for the mutation. The mutant flies were also markedly temperature sensitive, showing relatively good survival to eclosion at 21° (total number of offspring from 90 females, 86% of that from wild type), but slightly less at 25° (74% of the wild type), and a low rate of successful completion of development at 16° (19% of the number of wild-type flies eclosing).
As expected for a mutant postulated to have a quantitative defect in the availability or function of mitochondrial ribosomes, the flies were hypersensitive to doxycyclin, an antibiotic that specifically inhibits mitochondrial as opposed to cytosolic translation (![]()
In contrast, streptomycin, an antibiotic that acts by impairing translational accuracy in eubacterial ribosomes, had no significant effects on the development of wild-type or tko25t mutant flies at concentrations
1 mg/ml (data not shown). Wild-type mitochondrial ribosomes, like those of the cytosol, are resistant to this drug. The absence of any effect in the mutant indicates that the mutation is unlikely to affect the fidelity of mitochondrial translation. The result is also consistent with modeling of the tko25t mutation in E. coli (![]()
To confirm quantitative effects on mitochondrial function we analyzed mitochondrial redox activities in third instar larvae of wild-type and tko25t mutant flies (Fig 4). To control for any effect of inbreeding per se, we used, in addition to Canton-S, an inbred reference strain (0713) as a wild-type control. Large and significant decreases in complexes I, II, and IV were evident in tko25t larvae, compared with either reference strain (Fig 4A). Citrate synthase activities measured in the same extracts showed no significant differences between the strains. ATP synthesis capacity was less affected (Fig 4B), although the effects were still significant, at least for two of the substrate mixes tested. A clear effect on the level of small subunit (12S) compared with large subunit (16S) mitoribosomal RNA was also seen in third instar larvae (Fig 4C), indicating a relative deficiency of small subunits. Densitometry on replicate blots using different amounts of RNA indicated that the amount of 12S relative to 16S rRNA in the mutant was only 30% of that in wild-type flies. Use of a cDNA probe for a cytosolic ribosomal protein, rp49, as loading control showed that this was due to a deficiency of 12S rather than an excess of 16S rRNA (data not shown).
Construction of tko25t H85L revertants by P-element transgenesis:
To test whether the complex phenotype exhibited by tko25t mutant flies is wholly attributable to the L85H substitution in the coding sequence of mitoribosomal protein S12 (mt-rps12), we constructed strains of transgenic flies carrying additional autosomal copies of the gene, which were derived originally from genomic DNA of the mutant strain, and which either had or had not been reverted to leucine at residue 85. The strategy by which this was accomplished is summarized in Fig 5 and detailed in MATERIALS AND METHODS. Briefly, the 3.2-kb BamHI fragment containing the mt-rps12 coding sequence was cloned from genomic DNA of tko25t mutant flies via a high-fidelity PCR strategy and then subjected to PCR in vitro mutagenesis to correct the leucine-to-histidine substitution at residue 85. The structure of all constructs was verified by DNA sequencing (see EMBL data library accession no. AJ250320). Both versions of the 3.2-kb fragment were cloned into the P-element vector pP{CaSpeR-4} and then independently micro-injected, together with a P-element transposase-encoding plasmid, into the germline of recipient white mutant embryos. Injected embryos that survived to adulthood were mated to white mutants, and putative transgene-containing, red-eyed progeny from the next generation were retained. Three transgenic lines (A1A3) carrying different insertions of the unmanipulated tko25t mutant allele and eight transgenic lines (B1B8) carrying different insertions of the reverted (H85L) allele were obtained and each was tested for homozygous viability, for the chromosomal location of the insertion, and for the presence of an intact tko transgene at an ectopic site by PCR and Southern blotting.
All insertion(s) were autosomal, and all except line B8 (reverted allele) were homozygous viable. An intact transgene was found in every case by PCR (data not shown), and Southern analysis showed that most of the transgenic lines contained just one or two ectopic copies of the tko gene, although 1 line (A3) carried a number of additional ectopic copies of the unreverted allele (data not shown). All 11 transgenic lines, i.e., the 8 transgenic lines carrying different autosomal insertions of the reverted (H85L) allele plus 3 carrying different autosomal insertions of the unmanipulated tko25t mutant allele, were initially characterized in a tko wild-type genetic background. None was bang sensitive, nor did any of them exhibit developmental delay or other features of the tko25t mutant phenotype, as expected, given the recessive nature of the mutation. No other phenotypic abnormalities were observed in the transgenic lines bred to homozygosity, except the lethality in line B8 already mentioned and a variegated eye-color phenotype in line B1.
Phenotypic analysis of tko25t H85L revertants:
Males from the transgenic lines were mated to tko25t homozygous females (see scheme illustrated in Fig 6, a and b), and the progeny were scored initially for the developmental delay characteristic of the tko25t mutant. As expected, all female progeny were phenotypically wild type, since they each carried a wild-type copy of the tko gene on the X chromosome inherited from their transgenic fathers. The male progeny, which all carried the tko25t mutant allele on their X chromosome, showed a clear-cut restoration of wild-type developmental timing for all lines carrying an autosomal copy of the reverted allele (mean eclosion at 25° between 10.1 and 10.7 ± 0.1 days for all eight lines), whereas all three lines with one or more additional copies of the mutant allele showed the same 2- to 3-day developmental delay as the tko25t mutant itself, with eclosion at 25° at days 13.4 ± 0.1 for line A1 and 12.7 ± 0.1 for lines A2 and A3. Two simple conclusions emerge. First, the presence of an extra hemizygous dose (or several) of the tko25t mutant allele does not significantly complement the developmental timing defect. Second, the L85H substitution in the tko25t mutant allele can alone account for the developmental delay of the mutant.
|
Hemizygous lethality was tested by crossing males of each transgenic line with females heterozygous for a lethal allele of tko (tko3) over the FM7 balancer (![]()
![]()
One unreverted transgenic line (A1) and three H85L-reverted transgenic lines (B1, B2, and B5) were studied in further detail. First, crosses were set up to reevaluate developmental timing in flies both hemizygous and homozygous for each transgene, in both sexes, in the tko25t mutant background. All tko25t flies carrying also the (unreverted) transgene from line A1 had a mean eclosion day of
12.5, like the tko25t mutant itself. All tko25t flies carrying the reverted transgene from lines B1, B2, or B5 had a mean eclosion day of
10, like wild-type flies. In the tko25t mutant background the reverted lines were no longer bang sensitive (Fig 7), and males carrying the reverted transgene from line B5 were able to mate with wild-type females at the same frequency and with similar timing as did wild-type males (Table 2). Flies carrying the unreverted A1 transgene in the same background were still bang sensitive (Fig 7) and also defective in male courtship (Table 2, refer also to Table 1), exhibiting prolonged courtship time, reduced copulation time, and a low frequency of successful mating, although the latter effect was somewhat less marked than for the original mutant line. Enzymatic analyses of larval mitochondria (data not shown) also indicated that the wild-type but not the mutant transgene restored mitochondrial redox enzymes to the levels of the wild-type strain. The L85H substitution therefore appears sufficient to account for all the main features of the mutant phenotype, whether metabolic, developmental, or behavioral.
|
|
Phenotypic analysis of the Q116K substitution in tko:
Extensive previous analysis of the tko gene homologue in bacteria (rpsL) has given clear functional insight into different regions of the protein. In E. coli, the rpsL mutation L56H, equivalent to L85H in tko, gives a phenotype of impaired ribosome assembly, but without detectable effects on translational accuracy (![]()
![]()
Three independent lines, Q116K(1), Q116K(3), and Q116K(6), each carrying apparently single insertions of the Q116K transgene on the third, second, and third chromosomes, respectively, were bred to homozygosity for further analysis. All were initially viable and showed no developmental delay nor any other obvious phenotype. One additional transgenic line had an eye phenotype that is almost certainly attributable to an insertional effect and was not investigated further in this study. One line, Q116K(1), progressively lost viability as a homozygote, and in crosses to wild-type flies this was found to be a maternal effect. All three were crossed into the tko-null (tko3) background and bred to homozygosity. Lines Q116K(3) and Q116K(6) remained viable in this state, although line Q116K(1) again lost viability after three to five generations. In crosses to wild-type males, all three lines were female sterile, although courtship appeared normal. The female sterility was marked by a failure to lay eggs. No other developmental abnormalities were observed. The flies showed no sensitivity to streptomycin (data not shown).
| DISCUSSION |
|---|
This is the first demonstration that a mutation in an essential component of the mitochondrial translational apparatus gives rise to a whole-organism phenotype in a model metazoan. The phenotype has both developmental and behavioral aspects that reflect features of mitochondrial disease in humans, for which it represents a useful model.
Developmental consequences of a mitochondrial translational defect in Drosophila:
The developmental delay associated with the tko25t mutation is zygotically determined and entirely postembryonic, occurring mainly in the larval stages. This accords with the fact that mtDNA (![]()
![]()
![]()
![]()
![]()
In contrast, the increased time taken by the tko25t mutant to complete the larval stages fits with the idea that zygotic expression of components of the mitochondrial translational apparatus is required during this phase of net growth. Mitochondrial energy limitations, as implied by the decreased level of mitochondrial redox enzymes containing mitochondrial translation products in mutant larvae, may constrain the rate of cell division in one or more cell types. The larval stages are dedicated to the increase of biomass based on the metabolization of food sources; hence, it is not surprising that a defect in the system that produces the bioenergy-generating complexes would limit the overall rate at which new biomass is accumulated.
Flies heterozygous for null alleles of cytosolic ribosomal protein genes (e.g., RpL19, RpS3) generally show the characteristic minute (MIN) phenotype, also involving delayed eclosion and short, slender bristles (![]()
![]()
![]()
![]()
Behavioral consequences of a mitochondrial translational defect in Drosophila:
The tko25t mutant exhibits bang sensitivity, hyporeactivity, a defect in neuronal transmission from mechanoreceptor cells, and impaired response to sound. This raises a number of questions regarding the relationship of these phenotypes to each other and to the inferred deficit in mitochondrial translation.
Like deafness in vertebrates (![]()
![]()
, encoding the
-subunit of a plasma membrane Na+,K+-ATPase (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Why does a failure in mechanoreceptor transmission result in bang sensitivity? The major bang-sensitive mutants, including tko, show a failure in the giant fiber pathway (![]()
![]()
Why does a mitochondrial translational defect cause mechanosensory failure and impaired response to sound? Previous electrophysiological measurements of tko25t flies indicated that the frequency of action potentials in response to a bristle displacement was reduced (![]()
![]()
![]()
![]()
![]()
![]()
The behavioral phenotype of tko25t flies extends beyond bang sensitivity and impaired response to sound to include decreased reactivity and defective courtship. The courtship defect fits with a primary physiological impairment in sound perception, although other sensory systems may also be affected. Courtship involves recognition of sensory cues by both sexes, including visual and olfactory stimuli as well as sound (see ![]()
![]()
![]()
The male courtship defect of the tko25t mutant may have more than one component and is perhaps partly attributable to the reactivity deficit. However, the mutant male's courtship behavior is apparently not perceived as inadequate by mutant females, although this could be influenced by selection during inbreeding, as observed for the raised (rsd) mutant (![]()
![]()
Quantitative effects of the tko25t mutation:
As in E. coli, where the equivalent mutation (L56H) in rpsL caused a severe defect in ribosome assembly (![]()
![]()
However, the presence of an additional copy of the mutant allele on an autosome did not detectably improve the mutant phenotype. This strongly implies that the mutant phenotype is not simply related to gene dosage, although female hemizygous lethality implies that, if the expression of the mutant allele falls below a critical threshold, normal development cannot be completed. Male flies hemizygous for an autosomally located transgenic copy of the mutant allele also did not eclose. In fact even line A3, which carries at least three autosomal copies of the unreverted transgene, did not rescue the null mutant. Therefore, the information for full expression and/or dosage compensation of the gene cannot be carried on the 3.2-kb fragment used for transgenesis. Expression analysis by cDNA minisequencing (S. MANJIRY and J. M. TOIVONEN, unpublished data) confirmed that transgene expression was typically
30% that of the endogenous gene. In contrast, flies hemizygous for a single autosomal copy of the reverted tko25t allele were phenotypically wild type even in the tko3 background, regardless of sex. Therefore, even suboptimal expression of the wild-type allele is sufficient to restore wild-type phenotype, which is fully consistent with the recessive nature of the tko25t mutation.
The tko fly as a model for human mitochondrial disease:
We set out initially to test whether a point mutation engendering a nonconservative amino acid substitution in the coding region of mitoribosomal protein S12 could account for the bang sensitivity of the tko25t mutant, which was postulated as a model for mitochondrial deafness. Our findings strongly support this conclusion: reversion of the mutation abolishes the behavioral as well as the developmental phenotype of the mutant. Moreover, the mutation increases the sensitivity of the flies to the effects of a mitochondrial translational inhibitor. In that sense it resembles at least one mitochondrial mutation in humans, at nucleotide pair 1555, which sensitizes carriers to aminoglycoside ototoxicity (![]()
Most of the gene products involved in mechanoreceptor function are not highly conserved at the sequence level, although it has recently been argued that, because insect mechanoreceptors and vertebrate inner-ear hair cells are developmentally related, they are likely to have a common evolutionary origin (![]()
![]()
![]()
The developmental effects of the tko25t mutation may be relevant to other aspects of mitochondrial disease. The most common inherited pathological point mutation in mtDNA in humans, A3243G, has a complex and variable phenotype (![]()
![]()
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Michael Ashburner, Les Grivell, Jaanus Remme, and Jouni Aspi for useful discussions; Anja Rovio for technical and many other kinds of assistance; Helen Lindsay for help in measuring developmental timing; Martin Kerr and Laura Kean for advice and help with micro-injection; and Philippe Rosay for assistance in carrying out circadian rhythm measurements. We are also indebted to Mike Ritchie for help with generating the courtship song and for other advice with the hearing tests. This work was supported by grants from the Academy of Finland, Tampere University Hospital Medical Research Fund, and the European Union.
Manuscript received February 6, 2001; Accepted for publication July 2, 2001.
| LITERATURE CITED |
|---|
ALZIARI, S., G. STEPIEN, and R. DURAND, 1981 In vitro incorporation of [35S]methionine in mitochondrial proteins of Drosophila melanogaster.. Biochem. Biophys. Res. Commun. 99:1-8[Medline].
BRADFORD, M., 1976 Protein essay reagent. Anal. Biochem. 72:248-251[Medline].
DELUCA, M., 1969 Firefly luciferase. Adv. Enzymol. 44:37-68.
DENK, W., J. R. HOLT, G. M. G. SHEPHERD, and D. P. COREY, 1995 Calcium imaging of single stereocilia in hair cells: localization of transduction channels at both ends of tip links. Neuron 15:1311-1321[Medline].
DENNIS, P. P. and R. F. YOUNG, 1975 Regulation of ribosomal protein synthesis in Escherichia coli B/r. J. Bacteriol. 121:994-999
EBERL, D. F., 1999 Feeling the vibes: chordotonal mechanisms in insect hearing. Curr. Opin. Neurobiol. 9:389-393[Medline].
EBERL, D. F., G. M. DUYK, and N. PERRIMON, 1997 A genetic screen for mutations that disrupt an auditory response in Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 94:14837-14842
ENGEL, J. E. and C. F. WU, 1994 Altered mechanoreceptor response in Drosophila bang-sensitive mutants. J. Comp. Physiol. 175:267-278[Medline].
ERREDE, B., M. D. KAMEN, and Y. HATEFI, 1978 Preparation and properties of complex IV (ferrocytochrome c: oxygen oxidoreductase EC 1.9.3.1). Methods Enzymol. 53:40-47[Medline].
FADIC, R. and D. R. JOHNS, 1996 Clinical spectrum of mitochondrial diseases. Semin. Neurol. 16:11-20[Medline].
FISCHEL-GHODSIAN, N., 1999 Mitochondrial deafness mutations reviewed. Hum. Mutat. 13:261-270[Medline].
GANETZKY, B. and C. F. WU, 1982 Indirect suppression involving behavioral mutants with altered nerve excitability in Drosophila melanogaster. Genetics 100:597-614
HATEFI, Y., 1978a Preparation and properties of NADH:ubiquinone oxidoreductase (complex I) EC 1.6.5.3. Methods Enzymol. 53:11-14[Medline].
HATEFI, Y., 1978b Preparation and properties of dihydro-ubiquinone:cytochrome c oxidoreductase (complex III). Methods Enzymol. 53:35-40[Medline].
HALL, J. C., 1994 The mating of a fly. Science 264:1702-1714
HARDISTY, R. E., J. FLEMING, and K. P. STEEL, 1998 The molecular genetics of inherited deafnesscurrent knowledge and recent advances. J. Laryngol. Otol. 112:432-437[Medline].
ICHAS, F., L. S. JOUAVILLE, and J. P. MAZAT, 1997 Mitochondria are excitable organelles capable of generating and conveying electrical and calcium signals. Cell 89:1145-1153[Medline].
JACOBS, H. T., 1997 Mitochondrial deafness. Ann. Med. 29:488-491.
JOUAVILLE, L. S., F. ICHAS, and J. P. MAZAT, 1998 Modulation of cell calcium signals by mitochondria. Mol. Cell. Biochem. 184:371-376[Medline].
JUDD, B. H., M. W. SHEN, and T. C. KAUFMAN, 1972 The anatomy and function of a segment of the X chromosome of Drosophila melanogaster. Genetics 71:139-156
KAY, M. A. and M. JACOBS-LORENA, 1987 Developmental genetics of ribosome synthesis in Drosophila.. Trends Genet. 3:347-351.
KELLEY, M. R. and W. R. LEE, 1983 Mutagenesis in oocytes of Drosophila melanogaster. 1. Scheduled synthesis of nuclear and mitochondrial DNA and unscheduled DNA synthesis. Genetics 104:279-299
KIROV, N. C., P. M. LIEBERMAN, and C. RUSHLOW, 1996 The transcriptional corepressor DSP1 inhibits activated transcription by disrupting TFIIA-TBP complex formation. EMBO J. 15:7079-7087[Medline].
KONGSUWAN, K., Q. YU, A. VINCENT, M. C. FRISARDI, and M. ROSBASH et al., 1985 A Drosophila Minute gene encodes a ribosomal protein. Nature 317:555-558[Medline].
KONOPKA, R. J., M. J. HAMBLEN-COYLE, C. F. JAMIESON, and J. C. HALL, 1994 An ultrashort clock mutation at the period locus of Drosophila melanogaster that reveals some new features of the fly's circadian system. J. Neurogenet. 9:189-216[Medline].
LAWRENCE, P. A., P. JOHNSTON and G. MORATA, 1986 Methods of marking cells, pp. 229242 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Oxford.
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.
MAJAMAA, K., J. S. MOILANEN, S. UIMONEN, A. M. REMES, and P. I. SALMELA et al., 1998 Epidemiology of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes: prevalence of the mutation in an adult population. Am. J. Hum. Genet. 63:447-454[Medline].
MARIOTTINI, P., Z. H. SHAH, J. M. TOIVONEN, C. BAGNI, and J. N. SPELBRINK et al., 1999 Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing and translation. J. Biol. Chem. 274:31853-31862
MCROBERT, S. P., F. B. SCHNEE, and L. TOMPKINS, 1995 Selection for increased female sexual receptivity in raised stocks of Drosophila melanogaster.. Behav. Genet. 25:303-309[Medline].
MERRIAM, J. R., 1969 FM7: a new first chromosome balancer. Dros. Inf. Serv. 44:101.
O'DELL, K. and B. BURNET, 1988 The effects on locomotor activity and reactivity of the hypoactive and inactive mutations of Drosophila melanogaster.. Heredity 61:199-207.
O'DELL, K., B. BURNET, and J. M. JALLON, 1989 Effects of the hypoactive and inactive mutations on mating success in Drosophila melanogaster.. Heredity 62:373-381.
PAVLIDIS, P. and M. A. TANOUYE, 1995 Seizures and failures in the giant fiber pathway of Drosophila bang-sensitive paralytic mutants. J. Neurosci. 15:5810-5819[Abstract].
PAVLIDIS, P., M. RAMASWAMI, and M. A. TANOUYE, 1994 The Drosophila easily shocked gene: a mutation in a phospholipid synthetic pathway causes seizure, neuronal failure, and paralysis. Cell 79:23-33[Medline].
PREZANT, T. R., J. V. AGAPIAN, M. C. BOHLMAN, X. D. BU, and S. ÖTZAS et al., 1993 Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat. Genet. 4:289-294[Medline].
RITCHIE, M. G., R. M. TOWNHILL, and A. HOIKKALA, 1998 Female preference for fly song: playback experiments confirm the targets of sexual selection. Ann. Behav. 56:713-717.
RITCHIE, M. G., E. J. HALSEY, and J. M. GLEASON, 1999 Drosophila song as a species-specific mating signal and the behavioural importance of Kyriacou and Hall cycles in D. melanogaster song. Anim. Behav. 58:649-657[Medline].
RIO, D. C., 1996 10.24, personal communication to FlyBase (available from http://fly.ebi.ac.uk:7081/.bin/fbidq.html?FBrf0090026).
ROYDEN, C. S., V. PIRROTTA, and L. Y. JAN, 1987 The tko locus, site of a behavioral mutation in Drosophila melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell 51:165-173[Medline].
RUBENSTEIN, J. L., D. L. BRUTLAG, and D. A. CLAYTON, 1977 The mitochondrial DNA of Drosophila melanogaster exists in two distinct and stable superhelical forms. Cell 12:471-482[Medline].
SAEBOE-LARSSEN, S., M. LYAMOURI, J. MERRIAM, M. P. OKSVOLD, and A. LAMBERTSSON, 1998 Ribosomal protein insufficiency and the minute syndrome in Drosophila: a dose-response relationship. Genetics 148:1215-1224
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCHUBIGER, M., Y. FENG, D. M. FAMBROUGH, and J. PALKA, 1994 A mutation of the Drosophila sodium pump
subunit gene results in bang-sensitive paralysis. Neuron 12:373-381[Medline].
SHAH, Z. H., K. M. C. O'DELL, S. C. M. MILLER, X. AN, and H. T. JACOBS, 1997 Metazoan nuclear genes for mitoribosmal protein S12. Gene 204:55-62[Medline].
SHANNON, M. P., T. C. KAUFMAN, M. W. SHEN, and B. H. JUDD, 1972 Lethality patterns and morphology of selected lethal and semi-lethal mutations in the zeste-white region of Drosophila melanogaster.. Genetics 72:615-638
SHEPHERD, D. and P. B. GARLAND, 1969 Citrate synthase from rat liver. Methods Enzymol. 13:11-16.
SONDERGAARD, L., 1980 Dominant cold paralytic mutations on the autosomes of Drosophila melanogaster.. Hereditas 92:335-340.
SONDERGAARD, L., 1986 The nuclear mutation Ocdts-1 changes the 2-dimensional electrophoretic pattern of Drosophila mitochondria. Hereditas 104:313-315.
SONDERGAARD, L., N. C. NIELSEN, and R. M. SMILLIE, 1975 The effect of the Out coldts mutation on temperature induced changes in the Arrhenius activation energy of succinate-cytochrome c reductase activity in Drosophila. FEBS Lett. 51:126-129[Medline].
SPRADLING, A. C., 1986 P element mediated transformation, pp. 175197 in Drosophila: A Practical Approach, Chap. 8, edited by D. B. ROBERTS. IRL Press, Oxford.
TALAMILLO, A., A. A. K. CHISHOLM, R. GARESSE, and H. T. JACOBS, 1998 Expression of the nuclear gene encoding mitochondrial ATP synthase subunit alpha in early development of Drosophila and sea urchin. Mol. Biol. Rep. 25:87-94[Medline].
TAVERNARAKIS, N. and M. DRISCOLL, 1997 Molecular modeling of mechanotransduction in the nematode Caenorhabditis elegans.. Annu. Rev. Physiol. 59:659-689[Medline].
THUMMEL, C. S. and V. PIRROTTA, 1992 Technical notes: new pCasper P-element vectors. Dros. Inf. Serv. 70:150.
TOIVONEN, J. M., M. R. BOOCOCK, and H. T. JACOBS, 1999 Modelling in Escherichia coli of mutations in mitoribosomal protein S12: novel mutant phenotypes of rpsL.. Mol. Microbiol. 31:1735-1746[Medline].
TOMARU, M., H. MATSUBAYASHI, and Y. OGUMA, 1995 Heterospecific inter-pulse intervals of courtship song elicit female rejection in Drosophila biauraria.. Anim. Behav. 50:905-914.
TOURMENTE, S., I. SAVRE-TRAIN, F. BERTHIER, and M. RENAUD, 1990 Expression of six mitochondrial genes during Drosophila oogenesis: analysis by in situ hybridization. Cell Differ. Dev. 31:137-149[Medline].
VAN DEN BOGERT, C., P. MUUS, C. HAANEN, A. PENNINGS, and T. E. MELIS et al., 1988 Mitochondrial biogenesis and mitochondrial activity during the progression of the cell-cycle of human leukemic cells. Exp. Cell Res. 178:143-153[Medline].
VON SCHILCHER, F., 1976 The role of auditory stimuli in the courtship of Drosophila melanogaster.. Anim. Behav. 24:18-26.
WALKER, R. G., A. T. WILLINGHAM, and C. S. ZUKER, 2000 A Drosophila mechanosensory transduction channel. Science 287:2229-2234
WIBOM, R., K. SÖDERLUND, A. LUNDIN, and E. HULTMAN, 1991 A luminometric method for the determination of ATP and phosphocreatine in single human skeletal muscle fibres. J. Biolumin. Chemilumin. 6:123-129[Medline].
WOLSTENHOLME, D. R., 1992 Animal mitochondrial DNAstructure and evolution. Int. Rev. Cytol. 141:173-216[Medline].
ZHANG, Y., A. DAVIS, J. ROOTE, and M. ASHBURNER, 1997 sesB encodes an ADP/ATP translocase. A. Conf. Dros. Res. 38:205A.
This article has been cited by other articles:
![]() |
C. Adan, Y. Matsushima, R. Hernandez-Sierra, R. Marco-Ferreres, M. A. Fernandez-Moreno, E. Gonzalez-Vioque, M. Calleja, J. J. Aragon, L. S. Kaguni, and R. Garesse Mitochondrial Transcription Factor B2 Is Essential for Metabolic Function in Drosophila melanogaster Development J. Biol. Chem., May 2, 2008; 283(18): 12333 - 12342. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, X. Shi, R. Padmanabhan, Q. Wang, Z. Wu, S. C. Stevenson, M. Hild, D. Garza, and H. Li Identification of novel modulators of mitochondrial function by a genome-wide RNAi screen in Drosophila melanogaster Genome Res., January 1, 2008; 18(1): 123 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zanotto, Z. H. Shah, and H. T. Jacobs The bidirectional promoter of two genes for the mitochondrial translational apparatus in mouse is regulated by an array of CCAAT boxes interacting with the transcription factor NF-Y Nucleic Acids Res., January 28, 2007; 35(2): 664 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. T. Jacobs Disorders of mitochondrial protein synthesis Hum. Mol. Genet., October 15, 2003; 12(90002): R293 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. T. DOW and S. A. DAVIES Integrative Physiology and Functional Genomics of Epithelial Function in a Genetic Model Organism Physiol Rev, July 1, 2003; 83(3): 687 - 729. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Toivonen, J. M.
- Articles by Jacobs, H. T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Toivonen, J. M.
- Articles by Jacobs, H. T.






