Genetics, Vol. 159, 17-33, September 2001, Copyright © 2001

Mutations in SID2, a Novel Gene in Saccharomyces cerevisiae, Cause Synthetic Lethality With sic1 Deletion and May Cause a Defect During S Phase

Matthew D. Jacobsona,b, Claudia X. Muñozb, Kirstin S. Knoxb, Beth E. Williamsb, Lenette L. Lub, Frederick R. Crossa, and Elizabeth A. Vallenb
a The Rockefeller University, New York, New York 10021
b Department of Biology, Swarthmore College, Swarthmore, Pennsylvania 19081

Corresponding author: Elizabeth A. Vallen, Department of Biology, Swarthmore College, Swarthmore, PA 19081., evallen1{at}swarthmore.edu (E-mail)

Communicating editor: M. D. ROSE


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

SIC1 encodes a nonessential B-type cyclin/CDK inhibitor that functions at the G1/S transition and the exit from mitosis. To understand more completely the regulation of these transitions, mutations causing synthetic lethality with sic1{Delta} were isolated. In this screen, we identified a novel gene, SID2, which encodes an essential protein that appears to be required for DNA replication or repair. sid2-1 sic1{Delta} strains and sid2-21 temperature-sensitive strains arrest preanaphase as large-budded cells with a single nucleus, a short spindle, and an ~2C DNA content. RAD9, which is necessary for the DNA damage checkpoint, is required for the preanaphase arrest of sid2-1 sic1{Delta} cells. Analysis of chromosomes in mutant sid2-21 cells by field inversion gel electrophoresis suggests the presence of replication forks and bubbles at the arrest. Deleting the two S phase cyclins, CLB5 and CLB6, substantially suppresses the sid2-1 sic1{Delta} inviability, while stabilizing Clb5 protein exacerbates the defects of sid2-1 sic1{Delta} cells. In synchronized sid2-1 mutant strains, the onset of replication appears normal, but completion of DNA synthesis is delayed. sid2-1 mutants are sensitive to hydroxyurea indicating that sid2-1 cells may suffer DNA damage that, when combined with additional insult, leads to a decrease in viability. Consistent with this hypothesis, sid2-1 rad9 cells are dead or very slow growing even when SIC1 is expressed.


PASSAGE through the eukaryotic cell cycle is regulated by cyclin-dependent kinases (CDKs). CDKs are active when bound to cyclins and it appears that cyclins are responsible for much of the functional specificity of the cyclin-CDK complex. The activity of CDK complexes is regulated at the level of expression of CDKs and cyclins, as well as post-translationally by phosphorylation, regulated degradation, and CDK inhibitors. In the budding yeast Saccharomyces cerevisiae, Cdc28p is the main CDK involved in cell cycle control, forming a complex with both the G1 cyclins (Cln1-3) and the B-type cyclins (Clb1-6). The G1 cyclins act upstream of the events controlling the G1/S phase transition, including bud formation, microtubule organizing center duplication, and DNA replication (reviewed by LEW et al. 1997 Down). One essential function of the G1 cyclins is the inactivation of the B-type cyclin-Cdc28 inhibitor, Sic1p, as sic1 deletion rescues strains containing a cln1{Delta} cln2{Delta} cln3{Delta} triple deletion that are otherwise inviable (SCHNEIDER et al. 1996 Down).

As an inhibitor of Clb-Cdc28 kinase activity, Sic1p appears to function to allow cells to exit mitosis as well as to prevent premature DNA replication (SCHWOB et al. 1994 Down; TOYN et al. 1997 Down). SIC1 transcripts are cell cycle regulated, accumulating late in M phase dependent upon the transcription factor Swi5p, and disappearing at the G1/S transition (KNAPP et al. 1996 Down). A decrease in Clb2p-Cdc28p activity is needed for passage into G1 and it appears that Sic1p assists in this process by inhibiting the CDK complex (TOYN et al. 1997 Down). While cells can enter G1 with elevated levels of Clb2p, overexpressed Clb2{Delta}DBp (destruction box deleted) is lethal, causing cell cycle arrest in telophase (SURANA et al. 1993 Down). Clb2-Cdc28 kinase activity is also decreased by proteosome degradation of Clb2p after its ubiquitination by the anaphase-promoting complex (APC; SURANA et al. 1993 Down; IRNIGER et al. 1995 Down).

At the G1/S transition, degradation of Sic1p releases inhibition of Clb5/6p-Cdc28p, which then induce DNA replication (SCHWOB et al. 1994 Down; SCHNEIDER et al. 1996 Down). Sic1p proteolysis is dependent on its Cln-dependent phosphorylation (SCHNEIDER et al. 1996 Down; VERMA et al. 1997 Down) and upon Cdc34p, an E2 ubiquitin-conjugating enzyme (SCHWOB et al. 1994 Down). Inducing GAL-CLB5{Delta}DB expression advances DNA replication in sic1{Delta}, but not SIC1 cells, indicating that Sic1p has a function in regulating S phase entry (SCHWOB et al. 1994 Down). Clb5p and Clb6p seem to have related, but not identical, roles in initiating DNA replication. clb5{Delta} cells initiate DNA replication normally, but take twice as long to complete DNA synthesis (EPSTEIN and CROSS 1992 Down; KUHNE and LINDER 1993 Down). Cells deleted for clb6 display a normal onset and duration of replication. However, when clb5 and clb6 are both deleted, DNA synthesis is delayed, but the duration of replication, once begun, is unaffected (SCHWOB and NASMYTH 1993 Down). Recent evidence suggests that Clb5p can activate early and late origins of replication while Clb6p can activate only the early origins (DONALDSON et al. 1998 Down). This result agrees with the phenotypes of clb5 and clb6 single mutants. The phenotype of the double deletion can then be explained if the remaining Clbs (Clb1-4) can trigger both early and late origins to fire (DONALDSON et al. 1998 Down).

In addition to timing DNA replication, inhibition of Clb5/6p-Cdc28p activity by Sic1p may function to regulate origin loading and the DNA replication machinery. Binding of the six-subunit origin recognition complex (ORC), the Mcm family (Mcm2-7), and Cdc6p is thought to make the origins competent for firing by Clb5/6p-Cdc28p kinase activity (reviewed in DIFFLEY 1996 Down; STILLMAN 1996 Down). Origin loading is inhibited by CDK activity and this is thought to be the basis for a mechanism that allows replication to occur once per cell cycle (DAHMANN et al. 1995 Down). Cdc6p appears to recruit Mcm binding to the origins. In the presence, but not in the absence of SIC1, late G1 expression of Cdc6p (under the control of the HO promoter) can promote Mcm binding (TANAKA et al. 1997 Down). This suggests that Sic1-induced delay of Clb-Cdc28 activity allows proper origin binding of competence factors in preparation for DNA replication. Clb-Cdc28 kinase activity and Sic1p also affect DNA replication in a Cdc6- and ORC-independent fashion, suggesting that the kinase may also have direct effects on enzymes required for DNA synthesis (DUNCKER et al. 1999 Down). One possibility is that the Clb-Cdc28 kinase regulates the association of DNA polymerase-primase (pol{alpha}) to chromatin (DESDOUETS et al. 1998 Down).

SIC1 is not an essential gene, but sic1 cells show a high frequency of chromosome loss and breakage (NUGROHO and MENDENHALL 1994 Down). Several genetic backgrounds make SIC1 essential, including dbf2{Delta}, GAL-CLB2, cdh1{Delta}/hct1{Delta}, cdc23-1, and rsi1-1 (apc2; SCHWAB et al. 1997 Down; TOYN et al. 1997 Down; KRAMER et al. 1998 Down). Overexpression of Sic1p is able to rescue cdc5, cdc14-1, cdc15, and cdc20-1 strains (SCHWAB et al. 1997 Down; TOYN et al. 1997 Down; JASPERSON et al. 1998). All of these genetic interactions appear to be related to Sic1's function at the exit from mitosis. Cdc23p and Apc2p are members of the APC (ZACHARIAE et al. 1998B Down) while Cdc20p and Cdh1p/Hct1p seem to function as APC activators (SCHWAB et al. 1997 Down; VISINTIN et al. 1997 Down). dbf2, cdc5, cdc14, and cdc15 all have terminal arrest phenotypes late in mitosis (BYERS and GOETSCH 1973 Down; PRINGLE and HARTWELL 1981 Down; JOHNSTON et al. 1990 Down; KITADA et al. 1993 Down) and may activate the APC or dephosphorylate Cdc28 substrates or regulators (JASPERSEN et al. 1998 Down; VISINTIN et al. 1998 Down). Taken together, these data indicate that SIC1 plays an important role in late mitosis. If SIC1 also has a significant role in regulating DNA replication, it is possible that genes exist which, when mutated in combination with sic1{Delta}, disrupt the normal regulated process of DNA replication sufficiently to render the cells inviable. To identify such genes, as well as other genes playing roles in the exit from mitosis, we screened for mutations causing synthetic lethality with sic1{Delta}. Here we report on the discovery of a novel gene, SID2, which appears to play a role in DNA replication.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and media:
YP-dextrose (YPD), YP-galactose (YPGal), and synthetic complete (SC) minimal media were made by standard techniques (AUSUBEL et al. 1987 Down). Hydroxyurea and {alpha}-factor (both from Sigma Chemical, St. Louis) were used at 0.2 M and 0.1 µM, respectively. The strains and plasmids used in this study are listed in Table 1 and Table 2, respectively. All yeast strains are isogenic with BF264-15D (trp1-1a leu2-3,112 ura3 ade1 his2) and are bar1- unless otherwise noted. Standard methods were used for all strain constructions, crosses, and transformations (AUSUBEL et al. 1987 Down; ROSE et al. 1990 Down; GUTHRIE and FINK 1991 Down). A disruption of sic1 marked with TRP1, SIC1 under the control of the inducible GAL1 promoter (NUGROHO and MENDENHALL 1994 Down; the gifts of M. Mendenhall) and a disruption of rad9 marked with LEU2 (WEINERT and HARTWELL 1990 Down) were integrated into the BF264-15D background. The clb5::ARG4 and clb6::ADE1 disruptions were made in the BF264-15D background and have been previously described (EPSTEIN and CROSS 1992 Down; SCHWOB and NASMYTH 1993 Down). The CLB2HA construct (SCHWAB et al. 1997 Down), CLB5HA, and CLB5{Delta}DBHA constructs have also been described (CROSS et al. 1999 Down). Yeast strain L40 and plasmids pNIA, pNIAE2, and pNEAE2 have been previously described (RHEE et al. 2000 Down).


 
View this table:
In this window
In a new window

 
Table 1. Strains used in this study


 
View this table:
In this window
In a new window

 
Table 2. Plasmids used in this study

Plating efficiency assays:
Tenfold serial dilutions in water were made from fresh stationary-phase cultures and 5 µl from each dilution was plated. Plates were incubated for 2–4 days at 30°.

Mutagenesis and sic1{Delta} lethality screen:
LY623 and MJ65 yeast cells were mutagenized using standard procedures (ROSE et al. 1990 Down) to ~30% viability. Mutagenized cells were plated on YPGal (~200 colonies per plate). The colonies were then screened by replica plating for mutants that were alive on YPGal and dead on YPD.

Library screening:
LEU2 CEN4 plasmids, which complemented sid2-1, were isolated by transforming a sid2-1 strain (MJ163) with American Type Culture Collection library 77162 (constructed by P. Hieter in pBS32). Transformants were selected on SCGal-Leu minimal media plates and replica plated to YPD and YPGal in order to isolate colonies that could grow on YPD. The plasmids were recovered from Dex+ strains (HOFFMAN and WINSTON 1987 Down) and plasmid linkage was tested after retransformation. Partial sequence was obtained by The Rockefeller University Protein/DNA Technology Center using primer pBRSB (ACCGCACCTGTGGCGCCG), which hybridizes to pBR322 sequences 31 base pairs upstream of the BamHI site.

Cloning and disrupting SID2:
All restriction enzymes and DNA modifying enzymes were used according to the manufacturer's instructions. A 3.4-kb fragment (PstI to SpeI) containing the entire YJR046w open reading frame (ORF) was isolated from a LEU2 CEN4 library plasmid that rescued sid2-1. This fragment was cloned into pRS405 to form pMJ01 and into pRS415 to form pMJ02 (Fig 1). pMJ01 was digested with NcoI (which cuts uniquely in YJR046w) and integrated by homologous recombination into the sid2-1 haploid MJ193 to form MJ257. The integration was confirmed by Southern blot analysis. MJ257 was crossed to a SID2 strain (MJ58). The diploid was sporulated and the tetrads were dissected for analysis. If the sid2-1 mutation was not linked to YJR046w, approximately half of the Leu- spores should have had the Sid- phenotype because the mutation would have been segregating independently of the LEU2 integration. None of the spores (54 spores analyzed) were Sid-, indicating that the sid2-1 mutation was linked to YJR046w. In addition, when MJ257 was crossed to sid2-1 strains, all Leu+ spores were Sid+ and all Leu- spores were Sid- (47 spores analyzed), indicating tight linkage between the integrated DNA and the SID2 locus.



View larger version (43K):
In this window
In a new window
Download PPT slide
 
Figure 1. (A) A CEN-based plasmid carrying YJR046w (pMJ02) rescues sid2-1 sic1 lethality. Strain MJ193 (sid2-1 sic1{Delta} GAL1-SIC1) was transformed with the YJR046w-containing plasmid pMJ02, the RS415 vector, and a RS415 CEN-based plasmid containing SIC1 under the control of its own promoter. MJ58 (sic1{Delta} GAL1-SIC1) was transformed with RS415. The strains were grown overnight to stationary phase in SCGal-Leu and 5 µl of 10-fold serial dilutions were plated on YPGal and YPD and incubated for 3–4 days at 30°. The SIC1 plasmid-containing sid2-1 sic1{Delta} strain shows a slight rescue compared to vector but did not grow nearly as well as the YJR046w-containing sid2-1 sic1{Delta} strain on YPD. All transformants grew equally well on YPGal where GAL1-SIC1 was expressed. (B) sid2-1 SIC1 and SID2 SIC1 strains have similar plating efficiencies. Strains 914 (SID2 SIC1) and LY1118 (sid2-1 SIC1) were grown overnight to stationary phase in YPD and plated as described above. (C) The cloned region contained in pMJ01 (RS405) and pMJ02 (RS415) that rescues sid2-1 and the SID2 disruption construct (pMJ07) where a Kanr/LEU2 fragment replaced ~1 kb of YJR046w coding sequence.

SID2 was deleted in a diploid heterozygous for sic1{Delta} and GAL1-SIC1 using pMJ07, which was derived from pMJ01 in the following way. The XbaI polylinker site in pMJ01 was removed with a SpeI/NotI digest. The 5' overhanging ends of the digested plasmid were blunted using Klenow enzyme and then ligated, to form pMJ03. pMJ03 was then digested with XbaI, liberating a 970-bp fragment internal to SID2, and the ends were blunted with Klenow enzyme. A 3.5-kb fragment containing the LEU2 and Kanr genes from pJA51-{Delta}P digested with SmaI (CROSS 1997 Down) was ligated to the digested MJ03 to form MJ07. pMJ07 was digested with HindIII and the resulting 5-kb fragment was gel purified and used to disrupt SID2 in a diploid by homologous recombination. A diploid containing the deletion (confirmed by Southern blot) was sporulated and tetrads were dissected.

Construction of the temperature-sensitive SID2 allele, sid2-21:
SID2-HIS3 (pSH6) and SID2-URA3 (pSU3) plasmids were made by gap repair by first isolating a 5.6-kb fragment (ScaI to DraIII) containing all of SID2 and flanking vector sequences from pMJ02 and 3-kb PvuI vector fragments from both pRS413 and pRS416. The pMJ02 SID2 fragment and either the pRS413 or pRS416 fragment were cotransformed into LY914 and the resultant plasmids were isolated. pSH6 was then mutagenized with hydroxylamine according to standard procedures (ROSE et al. 1990 Down).

Haploid strains containing pSU3 (SID2-URA3) were deleted for SID2 using pMJ07 as described above. The sid2::LEU2 deletion was confirmed in the resulting Leu+ FOAS strains by Southern blot analysis. One such strain, LY1023, was transformed with pSH6 (SID2-HIS3) and became FOAR as expected. LY1023 was then transformed with hydroxylamine-mutagenized pSH6 and plated on SCDex-His at room temperature (~200 colonies per plate). The colonies were replica plated to SCDex-His and SCDex + FOA at both room temperature and 37° and then screened for mutants that were dead only on SCDex + FOA at 37°. The plasmids were recovered from these strains and transformed back into LY1023 to verify the phenotype. Five sid2-ts plasmids were isolated from ~7700 colonies screened with a 1% frequency of sid2 null mutations (FOAS at room temperature and 37°).

The 3.5-kb SpeI to SalI fragments containing the sid2-ts alleles were isolated from the five plasmids and cloned into pRS406 digested with XhoI and SpeI. These new sid2-ts integrating plasmids were digested with XhoI (which cuts uniquely in SID2) and integrated by homologous recombination into LY914. Purified Ura+ transformants were patched onto YPD at room temperature and then streaked on SCDex + FOA at room temperature. The resulting FOAR colonies were screened for temperature-sensitive growth. Temperature-sensitive strains were recovered from only one of the original five alleles (sid2-21) although at least 48 FOAR colonies from 12 independent transformants were screened for each allele. Integration after digestion of the remaining four plasmids with BstEII, which cuts upstream of SID2, was also tried, but again, no temperature-sensitive recombinants were recovered after passage on FOA. One of the resulting sid2-21 temperature-sensitive strains, LY1037, was transformed with SU3 and found to become temperature resistant, confirming that the temperature-sensitive growth of LY1037 was due to sid2-21. Furthermore, when LY1037 was crossed to MJ257 (SID2::LEU2), temperature sensitivity and Leu+ segregated in repulsion in all 12 tetrads analyzed.

Tagging Sid2 with protein A:
A Sid2-protein A fusion protein was constructed by PCR amplification of the protein A gene and an adjacent his5+ marker (the Schizosaccharomyces pombe homolog of the S. cerevisiae HIS3 gene) from pBXAHis5 (M. Rout, The Rockefeller University) using primers with homology to SID2 at their 5' ends and to protein A or his5+ at their 3' ends. The pBXAHis5 plasmid was derived from pFA6a-HIS3MX6 (WACH et al. 1997). The following oligonucleotides were used to amplify the protein A-his5+ fragment for C-terminal addition of protein A to Sid2: 046-PROTA 5', GGATAAAAACAGATTTTCTAAGCTGTTGCAAATCCACAAATCAAAACAACAAGATGGTGAAGCTCAAAAACTTAAT; 046-HIS3', CGTACATACACAATGCACAGTCTTCAAAGTAAAATACCAACGTATGTATCAAGATCGTCGACGGTATCGATAAGCTTwhere the underlined sequences correspond to those from SID2. Twenty-five cycles of PCR consisting of 1 min at 95°, 1 min at 55°, and 4 min (+5-sec increase/cycle) at 72° were performed. The PCR products were transformed into his3/his3 diploid cells (LY915) and His+ transformants were selected. Homologous recombination resulted in SID2-ProA fusions linked to his5+. Putative protein A-tagged strains were analyzed by Western and Southern blotting to verify tagging of the Sid2 protein.

Construction of lexA-GAL4-SID2 fusions and "one-hybrid" assay:
The SID2 gene was amplified with forward primer 5'-AAAGAGATCGAATACCCGGGGATCCTTATGAGTGGCACAGCCTAAT-3' and reverse primer 5'-TCGCCCGGAATTAGCTTGGCTGCAGTTCAATCTTGTTGTTTTGAT-3' using the Expand High Fidelity PCR system (Roche, Indianapolis). The underlined sequences correspond to those from SID2 and the italicized sequences correspond to sequences in the pNIA plasmid. Thirty-three cycles of PCR each consisting of of 1 min at 94°, 1 min at 50°, and 2 min at 68° were performed. The PCR fragment was recombined into plasmid pNIA (RHEE et al. 2000 Down) by cotransformation into yeast. Plasmids were recovered from yeast (HOFFMAN and WINSTON 1987 Down), electroporated into Escherichia coli, and analyzed by restriction analysis. Six independently derived NIASID2 plasmids were transformed into strain L40 (RHEE et al. 2000 Down) and liquid ß-galactosidase assays were performed on log phase cultures grown under selective conditions as described (AUSUBEL et al. 1987 Down).

Yeast fractionation:
Fractionation was performed (ROUT and KILMARTIN 1998 Down) using the modifications for S. cerevisiae described with a 1-liter culture of Wickerham's media grown overnight to an optical density (660 nm) of 0.8. The volumes loaded for Western blot analysis were adjusted to compensate for varying total volumes of each collected fraction.

Phenotypic analysis of sid2-1 sic1{Delta} and sid2-21 strains:
SID2 and sid2-1 strains (both sic1{Delta} GAL1-SIC1) were grown overnight to early log phase in liquid YPGal media. The cultures were then split and dextrose was added to one-half of each to a final concentration of 2%. YPD cultures of sid2-21 and SID2 strains were grown overnight at 25° to early log phase and then shifted to 37°. For both experiments, samples were removed at 2-hr intervals and processed for FACS analysis, cell counting, or immunofluorescence staining as described below. For the synchronization experiments, early log phase cultures of SID2, sid2-1, SID2 sic1{Delta} GAL1-SIC1, and sid2-1 sic1{Delta} GAL1-SIC1 were grown in YPGal at 30°. {alpha}-factor was added and incubation continued for 3 hr. Cells were centrifuged, washed in YP lacking sugar, and resuspended in fresh 30° YPD. Samples were removed at 12-min intervals.

FACS analysis and cell counting:
Flow cytometric DNA quantitation was performed as described elsewhere (EPSTEIN and CROSS 1992 Down). Growth curve samples were fixed with 3 ml of 0.74% formaldehyde in 1x PBS. The samples were sonicated for 12 sec and cell number was analyzed using a Coulter counter. Microscopic analysis was used to determine the percentage of cells that were unbudded, small budded, or large budded. At each time point, at least 200 cells were counted. Small-budded cells were those where the daughter bud was less than two-thirds the size of the mother bud. Large-budded cells had a daughter bud greater than two-thirds the size of the mother bud.

Field inversion gel electrophoresis assay:
Yeast strains 1036 (SID2) and 1037 (sid2-21) were grown to early log phase in YPD at 23°. Samples of the wild type and mutant were removed for processing, the cultures were shifted to 37°, and samples were then removed at 2-hr intervals. For the hydroxyurea-treated control sample, hydroxyurea was added directly to an aliquot of the log phase culture of wild-type cells (final concentration, 0.2 M) and incubation continued for 3 hr at 30°. Chromosomal DNA samples were prepared in agarose plugs as described (SCHWARTZ and CANTOR 1984 Down; ROSE et al. 1990 Down). Samples containing equivalent OD600 units of cells were applied to a 1% agarose gel, electrophoresed in 0.5x Tris-borate-EDTA buffer at 4–8° at 8.3 V/cm, stained with ethidium bromide overnight, and then destained for 1 hr. Field inversion was controlled by a PC500 SwitchBack pulse controller (Hoefer, Amersham Pharmacia Biotech, Piscataway, NJ) with a run time of 32 hr, a pulse time of 1–50 sec and an F/R ratio of 3.0:1.

Immunofluorescence staining:
Immunofluorescence microscopy was done essentially as described previously (WENTE et al. 1992 Down). Tubulin was visualized using anti-tubulin antibody (WENTE et al. 1992 Down; 1:200 dilution) followed by Cy-3 donkey conjugated anti-rat IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). The fluorescent DNA-specific dye 4',6-diamidino-2-phenylindole (DAPI) was used to visualize yeast nuclei.

Immunoprecipitation and detection of HA-tagged proteins:
The immunoprecipitation protocol is based on methods described previously (LEVINE et al. 1996 Down). Yeast cultures (100 ml) were grown overnight to an optical density (600 nm) of 1.0. Cells were collected and washed in TNN buffer (50 mM Tris pH 7.5, 250 mM NaCl, 5 mM EDTA, 10% glycerol, 0.1% Nonidet P-40). TNN extraction buffer [TNN + 5% aprotinin (Sigma), 0.1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 10 µg/ml pepstatin, 10 mM NaPPi (pH 7.4), 10 mM NaF] was used for cell breaking, antibody incubation, and immunoprecipitation with the protein A-agarose slurry. The extract was incubated for 1 hr on ice with 1 µl of the monoclonal HA11 antibody (ascitis; Babco). Following incubation with the antibody, the extract was added to 30 µl of a protein A-agarose slurry (Sigma) prewashed with TNN and rotated at 4° for 1 hr.

SDS-polyacrylamide gel electrophoresis (10%) and transfer to Immobilon were done as previously described (CROSS and BLAKE 1993 Down). Following the transfer, the immunoblots were blocked overnight [PBS with 0.5% Nonidet P-40, 0.1% Tween 20, 0.5% BSA, and 15% milk (Carnation)]. The blot was incubated with antibodies (1.5 hr for the primary, 1 hr for the secondary) in PBS-Tween 20 (0.2%) with 1% milk at room temperature. The primary antibody, polyclonal rabbit anti-HA (Covance Research Products, Richmond, CA), was diluted 1:7500. The secondary antibody was a 1:1500 dilution of polyclonal donkey anti-rabbit conjugated to horseradish peroxidase (Amersham). The samples were washed three times for 10 min each with PBS-Tween 20 following each antibody incubation. The proteins were then detected using an enhanced chemiluminescence kit (Amersham).

Other Western blots were processed as described above except for the following modifications. The blots were blocked for 1 hr at room temperature in PBS-Tween 20 with 2.5% milk and incubated with the antibodies in PBS-Tween 20 containing 5% milk. A 1:1000 dilution of rabbit anti-mouse IgG (Organon Teknika, Durham, NC) was used to detect protein A tags. Mouse monoclonal anti-Nop1 (ARIS and BLOBEL 1988 Down) was diluted 1:2000 and mouse monoclonal anti-PGK (Molecular Probes, Eugene, OR) was diluted 1:10,000. The secondary antibody was a 1:1000 dilution of polyclonal donkey anti-rabbit (sheep anti-mouse for Nop1 and PGK) conjugated to horseradish peroxidase (Amersham).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Isolation of mutants synthetically lethal with sic1 deletion:
To identify factors that assist SIC1 at the G1/S transition or at the exit from mitosis, we isolated mutations that caused synthetic lethality with sic1{Delta}. sic1{Delta} GAL1-SIC1 strains (LY623 and MJ65) were mutagenized and screened for mutants alive on YPGal (SIC1 expressed) and dead on YPD (SIC1 repressed). Approximately 28,000 colonies were screened by replica plating and 21 recessive mutants were isolated. The mutants were named SID for SIC1 Indispensable.

By complementation testing, the following groups were established: sid1 (seven alleles), sid2 (one allele), sid3/dbf2 (six alleles), and sid4/cdc15 (one allele). The remaining six mutants do not fall into the four complementation groups described above and define at least two more complementation groups. They remain unsorted because of difficulties with backcrossing. There appears to have been spontaneous diploidization of many of the mutants, resulting in minimal spore viability following tetrad dissection after crosses to wild-type haploid strains. Attempts to sporulate the diploidized strains after transformation with MAT-containing plasmids were unsuccessful. sid1 has yet to be cloned, though two LEU2 CEN libraries have been thoroughly screened for rescue plasmids (39,000 transformants). Preliminary analysis suggests that sid1 sic1{Delta} strains arrest as large-budded cells with segregated nuclei (data not shown). sid3 sic1{Delta} mutants failed to complement a dbf2{Delta} sic1{Delta} GAL1-SIC1 strain (LY699) on YPD and sid3 was meiotically linked to dbf2{Delta} (MJX21-4D) in tetrad analysis. The sid4 sic1{Delta} mutant failed to complement a cdc15-2 sic1{Delta} strain (LY677). Linkage could not be established, however, as the sid4 mutant had spontaneously diploidized. Although cdh1{Delta} sic1{Delta} spores are inviable (SCHWAB et al. 1997 Down), no cdh1 mutants resulted from this screen as determined by complementation testing to MJ249 and MJ242. cdh1{Delta} sic1{Delta} spores were isolated in our strain background using GAL1-SIC1 to suppress the lethality. cdh1{Delta} sic1{Delta} spores that did not contain GAL1-SIC1 were inviable as previously reported. cdh1{Delta} sic1{Delta} GAL-SIC1 strains were able to grow when replica plated to YP-dextrose, though they clearly grew more slowly than sic1{Delta} GAL1-SIC1 strains (data not shown). Thus the very low level of expression from GAL1-SIC1 on glucose is probably sufficient to partially rescue cdh1{Delta} sic1{Delta} GAL-SIC1 strains on glucose medium, which may account for our failure to isolate cdh1 mutations in our screen. The isolated sid mutants were all found to complement cdc5 and cdc14 strains.

SID2 is YJR046w, a novel gene:
To clone SID2, a LEU2 CEN4 library was screened for plasmids that could rescue the lethality of sid2-1 sic1{Delta} GAL1-SIC1 cells on YPD. Four plasmids containing the yeast ORF YJR046w/TAH11 and flanking regions were isolated after screening 8000 transformants. An insert containing only YJR046w intact was subcloned into RS415 and the resulting plasmid (pMJ02) was able to rescue the lethality of sid2-1 sic1{Delta} GAL1-SIC1 cells on YPD (Fig 1A). LEU2 was integrated adjacent to YJR046w in a sid2-1 strain and was found to be meiotically linked to SID2 (MATERIALS AND METHODS). SID2 encodes a 604-amino-acid protein lacking significant homology to any known genes. Since SID2 was known to be essential in wild-type cells (HUANG et al. 1997 Down), a sid2{Delta} GAL1-SIC1 strain was constructed to determine if the sid2 null mutation could be rescued by elevated Sic1 levels. SID2 was deleted in a diploid heterozygous for GAL1-SIC1 and sic1{Delta} using a construct that removed 1 kb internal to SID2 and inserted a 3.5-kb fragment containing LEU2-Kanr (Fig 1C). The diploid was sporulated and the tetrads were dissected on galactose-containing media. All viable spores were Leu-; the spores predicted to contain sid2::LEU2 were inviable even when they were predicted to contain GAL1-SIC1. Therefore, overexpression of SIC1 does not suppress the lethality caused by deletion of SID2. Most of the further analysis of SID2 was performed using sid2-1 strains. The sid2-1 mutation was backcrossed from the original mutagenized strain into the sic1{Delta} GAL1-SIC1 background at least four times before further analysis.

SID2 on a centromere-based plasmid completely rescued the lack of growth of the sid2-1 sic1{Delta} cells (Fig 1A). Similarly, GAL1-SIC1 overexpression permitted growth of sid2-1 sic1{Delta} strains on YPGal that was comparable to wild type (Fig 1A). To demonstrate that growth of sid2-1 sic1{Delta} strains on YPGal was dependent on the presence of GAL-SIC1, we dissected diploids heterozygous for sid2-1, sic1{Delta}, and GAL-SIC1 on YPGal. SID2::LEU2 was also segregating in the cross, allowing unambiguous determination of sid2-1 spores. Dissection of 65 tetrads on YPGal gave 23 spores that could unequivocally be predicted to be sid2-1 sic1{Delta} and lacking GAL-SIC1; all were dead. In contrast, the viability of SID2 sic1{Delta} cells lacking GAL-SIC1 was 86% (n = 29).

The screen that isolated sid2-1 identified mutants that were viable in the presence of high levels of SIC1 and inviable in the absence of SIC1. To determine whether sid2-1 mutant cells required the high levels of SIC1 expressed from the GAL1 promoter throughout the cell cycle, we assayed the growth of sid2-1 cells in the presence of lower levels of SIC1. In contrast to the complete suppression by GAL-SIC1, sid2-1 sic1{Delta} strains were only partially rescued by SIC1 on a centromere-based plasmid when SIC1 was expressed under the control of its own promoter (Fig 1A). However, a more complete rescue of sid2-1 strains by endogenous SIC1 was observed in backcrosses where the wild-type SIC1 gene was segregating against sic1{Delta}. When diploids heterozygous for sid2-1 and sic1{Delta} were sporulated and tetrads were dissected, colonies that were sid2-1 SIC1 were similar in size to those that were SID2 SIC1 (data not shown). When sid2-1 SIC1 spores were analyzed, they gave plating efficiencies more similar to wild-type SID2 SIC1 strains (Fig 1B), although a slight decrease in both the number of colony forming units and colony size could still be observed in the sid2-1 SIC1 strain. The observed difference between the ability of plasmid and chromosomal SIC1 to rescue may be due to a lack of regulatory regions in the SIC1-containing plasmid. The suppression of sid2-1 by wild-type levels of SIC1 demonstrates that overexpression of SIC1 is not absolutely required for the viability of sid2-1 mutant cells. Although the sid2-1 SIC1 mutant cells appear to grow fairly similarly to wild type, they do have an increase in the number of cells with a 2C DNA content and large buds compared to SID2 SIC1 cells (Fig 7E and Fig F). Based on the other phenotypes of sid2 mutants, it is likely that this phenotype is due to a defect in DNA replication or induction of a DNA damage checkpoint. It is less likely that the sid2 mutant cells replicate their DNA prematurely compared to wild type because sid2 mutant cells are actually delayed in DNA replication compared to wild-type cells (see below).



View larger version (43K):
In this window
In a new window
Download PPT slide
 
Figure 2. Sid2p is predominantly cytoplasmic, but has a functional nuclear localization signal. (A) Strain LY925, in which SID2 was genomically tagged at its carboxyl terminus with protein A, was fractionated using a sucrose gradient. Cytosolic, surface, surface to 2.01 M sucrose, 2.01–2.10 M sucrose, 2.10–2.30 M sucrose, and pellet fractions were collected and appropriate amounts were loaded to adjust for varying collection volumes. The fractions were examined by Western blot probing for Sid2-PrA, Nop1 (a nuclear control), and PGK (3-phosphoglycerate kinase, a cytoplasmic control). (B) ß-Galactosidase assays were performed on strain L40, which contains lacZ under the control of the lexA operator, after transformation with plasmids encoding fusion proteins. All the plasmids contain a modified lexA DNA-binding domain and the GAL4 transcriptional activation domain. Control plasmid NIA contains the lexA-GAL4 fusion, while the remaining plasmids contain fusions between that sequence and other coding regions. Plasmid NIAE2 carries the sequence encoding the cytoplasmic VirE2 protein from Agrobacterium tumefaciens, plasmid NEAE2 carries the sequence encoding the SV40 large T Ag NLS and VirE2, and NIASID2 carries the entire SID2 coding sequence. Error bars represent the standard error of two experiments; the data for NIASID2 is the average of the results of two experiments performed with six independently isolated NIASID2 plasmids. Activity levels and standard error for the NIA and NIAE2 transformants were 0.43 ± 0.04 units and 0.31 ± 0.03 units, respectively.




View larger version (93K):
In this window
In a new window
Download PPT slide
 
Figure 3. sid2-1 sic1{Delta} cells arrest preanaphase as large-budded cells with a 2C DNA content. Strains MJ58 (SID2 sic1{Delta} GAL1-SIC1) and MJ193 (sid2-1 sic1{Delta} GAL1-SIC1) were grown in YPGal overnight to log phase and the cultures were split. Dextrose was added (2%) to half the cultures at time 0 to repress SIC1 expression from the GAL1 promoter. Cell number (A), budding distribution (B), DNA content by FACS analysis (C), and nuclear and spindle morphology (D) were examined. In B and D, the cells were fixed 6 hr after addition of dextrose.




View larger version (125K):
In this window
In a new window
Download PPT slide
 
Figure 4. sid2-21 cells arrest as large-budded cells with a 2C DNA content, a single nucleus, and a short spindle. Strains 1037 (sid2-21) and 914 (SID2) were grown overnight to log phase in YPD at 25° and then shifted to 37°. Colony-forming units (A), budding distribution (B), DNA content by FACS analysis (C), and nuclear and spindle morphology (D) were examined. In B and D, the cells were fixed 4 hr after shift to 37°.



View larger version (19K):
In this window
In a new window
Download PPT slide
 
Figure 5. Clb5p and Clb2p are only slightly stabilized in sid2-1 {alpha}-factor-arrested cells. Strains (A) MJ316 (SID2 sic1{Delta} GAL1-SIC1 CLB5HA), MJ317 (sid2-1 sic1{Delta} GAL1-SIC1 CLB5HA), and MJ319 (SID2 sic1{Delta} GAL1-SIC1 CLB5{Delta}DBHA) and (B) MJ288 (SID2 sic1{Delta} GAL1-SIC1 CLB2HA), MJ282 (sid2-1 sic1{Delta} GAL1-SIC1 CLB2HA), and MJ292 (cdh1{Delta}/hct1{Delta} sic1{Delta} GAL1-SIC1 CLB2HA) were grown overnight to log phase and arrested with 0.1 µM {alpha}-factor for 3 hr. (A) Clb5p levels were examined at 1-hr intervals after the addition of {alpha}-factor and (B) Clb2p levels were examined before and after the arrest. The samples were processed by immunoprecipitation followed by immunoblotting.



View larger version (85K):
In this window
In a new window
Download PPT slide
 
Figure 6. sid2-1 interacts genetically with S phase cyclins. (Top) Strains LY986 (SID2 sic1{Delta} GAL1-SIC1), LY987 (sid2-1 sic1{Delta} GAL1-SIC1), LY989 (SID2 sic1{Delta} GAL1-SIC1 clb5{Delta}), LY991 (sid2-1 sic1{Delta} GAL1-SIC1 clb5{Delta}), LY985 (SID2 sic1{Delta} GAL1-SIC1 clb5{Delta} clb6{Delta}), and LY988 (sid2-1 sic1{Delta} GAL1-SIC clb5{Delta} clb6{Delta}) were grown overnight to stationary phase in YPGal and 5 µl of 10-fold serial dilutions were plated on YPGal and YPD and incubated for 3–4 days at 30°. (Bottom) Strains MJ322 (sid2-1 sic1{Delta} GAL1-SIC1), MJ321 (sid2-1 sic1{Delta} GAL1-SIC1 CLB5{Delta}DBHA), MJ323 (SID2 sic1{Delta} GAL1-SIC1), and MJ319 (SID2 sic1{Delta} GAL1-SIC1 CLB5{Delta}DBHA) were grown and plated as described for the top.



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 7. DNA replication is delayed in sid2-1 mutant strains. Strains MJ55 (SID2 sic1{Delta} GAL1-SIC1), MJ160 (sid2-1 sic1{Delta} GAL1-SIC1), LY914 (SID2 SIC1), and LY1118 (sid2-1 SIC1) were grown overnight to log phase and arrested with 0.1 µM {alpha}-factor for 3 hr. The cultures were then released into YPD and progression into S phase was followed by FACS analysis (A and B) and onset of budding (C and D). Asynchronous cultures of strains LY914 and LY1118 were analyzed by FACS analysis and budding index (E and F).

Sid2p, while predominantly cytoplasmic, has a functional nuclear import signal:
Determining the timing of Sid2p expression or its intracellular localization might aid our understanding of how and when Sid2p functions. To detect Sid2p, we tagged the genomic locus of SID2 with protein A and detected it by Western blot. SID2-PrA strains do not show a growth defect and have a wild-type FACS profile (data not shown). In addition, SID2-PrA sic1{Delta} strains are viable. This indicates that the protein A tag does not interfere with Sid2p function. A strain containing the tagged SID2 gene was arrested with {alpha}-factor and released into YPD. Protein extracts were made at 12-min intervals following the {alpha}-factor release and Sid2p levels were found to remain constant throughout the cell cycle (data not shown).

We could not detect Sid2-PrA by immunofluorescent staining of either logarithmically growing or hydroxyurea (HU)-arrested cells, perhaps because the level of expression is low or the localization is diffuse. Following fractionation of the Sid2-protein A-containing strain, Sid2p protein was visualized by Western blot and found to be predominately cytoplasmic, although a small amount of nuclear Sid2p could be detected (Fig 2A). Interestingly, analysis of Sid2p's localization using a one-hybrid assay (RHEE et al. 2000 Down) suggests that Sid2p has a functional nuclear localization signal (NLS; Fig 2B). A fusion protein containing a modified lexA DNA-binding domain, the GAL4 transcriptional activation domain, and Sid2p (NIASID2) could enter the nucleus and activate transcription from a lexA-operator-driven lacZ reporter gene. In contrast, a control fusion containing the cytoplasmic protein VirE2, which is of similar size to Sid2p, could not activate transcription from the reporter gene (NIAE2, Fig 2B; RHEE et al. 2000 Down). Levels of transcriptional activation from the Sid2p-containing construct were lower than that from a control construct containing the NLS from SV40 T antigen (NEAE2). Taken together with the fractionation experiments, these data suggest that Sid2p has a functional NLS, although it may be weak or subject to regulation.

sid2-1 sic1{Delta} and sid2-21 cells have a preanaphase arrest:
To characterize the effect of the sid2-1 mutation, we analyzed the morphology of sid2-1 and SID2 cells (both sic1{Delta} GAL1-SIC1) in the absence of SIC1 expression by shifting cultures from YPGal (SIC1 expressed) to YPD (SIC1 repressed). sid2-1 sic1{Delta} cells slowed proliferation and then arrested 6 hr after repression of GAL1-SIC1, showing only minimal increases in cell number at later time points (Fig 3A). There was no decrease in viability up to 5 hr after the shift to dextrose-containing media and a slight decrease in viability (less than fourfold) by 10 hr after the shift (data not shown). sid2-1 sic1{Delta} cells accumulated with large buds at the arrest point (Fig 3B and Fig D). Repression of SIC1 slightly decreased the number of unbudded cells in the SID2 strain but otherwise had little effect on the distribution of cell morphologies (Fig 3B).

Similarly, we compared the morphology of wild-type SID2 cells and cells containing a temperature-sensitive allele, sid2-21, after incubation at the nonpermissive temperature. sid2-21 cells began to die by 3 hr after shift to 37° (Fig 4A). After 4 hr of incubation at 37°, the sid2-21 cells accumulated with large buds similar to the sid2-1 sic1{Delta}-arrested cells (Fig 4B and Fig D). The distribution of cell morphologies of SID2 cells, in contrast, was unaffected by the temperature shift (Fig 4B).

The arrest of sid2-1 sic1{Delta} and sid2-21 cells was further examined using FACS to analyze DNA content. By 6 hr after repression of GAL1-SIC1, the DNA content of SID2 sic1{Delta} cells was predominately 2C, though a small 1C peak was also observed (Fig 3C). Cells deleted for sic1 have a short G1 phase probably due to the lack of S phase cyclin/CDK (Clb5/Clb6p-Cdc28p) inhibition (SCHWOB et al. 1994 Down). The DNA content of the mutant sid2-1 sic1{Delta} cells also shifted primarily to an ~2C peak. However, in contrast to the SID2 sic1{Delta} cells, the sid2-1 sic1{Delta} population at 6 hr after shift to YPD had a less distinct 1C peak, and the 2C peak was much broader, having a shoulder of cells with DNA content between 1C and 2C (Fig 3C). These data indicate that, although the mutant cells were able to replicate at least most of their DNA in the absence of SIC1 expression, they may have some defect associated with DNA synthesis.

The DNA contents of the SID2 and sid2-21 populations of cells were similar at 25°, with cells approximately equally distributed between two distinct peaks at 1C and 2C (Fig 4C). For the SID2 cells, this profile remained constant after the temperature shift to 37°. In contrast, 2 hr after the shift to the nonpermissive temperature, the sid2-21 cells accumulated with a DNA content intermediate between the 1C and 2C peaks. By 4 hr at the nonpermissive temperature, the DNA content of the sid2-21 cells shifted to a broad, ~2C peak (Fig 4C). These data indicate that, like the sid2-1 sic1{Delta} cells, the sid2-21 mutant cells appear to replicate most or all of their DNA under nonpermissive conditions. However, the accumulation of cells in S phase at 2 hr suggests that sid2 mutants may have a defect in DNA replication (see also below).

To characterize the defect in the sid2 mutants more completely, sid2-1 sic1{Delta}, SID2 sic1{Delta}, sid2-21, and SID2 cells were stained with DAPI and tubulin was visualized by indirect immunofluorescence. In contrast to the SID2 sic1{Delta} and SID2 cells that were at various cell cycle stages, the sid2-1 sic1{Delta} and sid2-21-arrested cells appeared to be preanaphase with a single nucleus and a short spindle (Fig 3D and Fig 4D). The arrest morphology of sid2 sic1{Delta} and sid2-21 cells suggests that, unlike other mutations that are lethal in combination with sic1{Delta}, the primary defect of the sid2 mutants is not in the reduction of Clb2p-CDK activity. Mutants that fail to inactivate Clb2p-CDK activity arrest primarily in telophase with elongated spindles and DNA segregated between the mother and bud (SURANA et al. 1993 Down). The arrest phenotype demonstrated by the sid2-1 sic1{Delta} and sid2-21 cells has some similarities to phenotypes demonstrated by mutants that affect DNA replication or APC activation. Of these, the slow S phase observed in the sid2-21 mutant strains is most consistent with a defect in DNA replication.

Both S and M phase B-type cyclins are only slightly stabilized in sid2-1 mutants:
One possibility, based on the morphology of sid2-1 sic1{Delta} cells, was that sid2-1 affected APC activity. It has previously been demonstrated that a number of mutants that affect APC activity are lethal in combination with deletion of sic1 (TOYN et al. 1997 Down; SCHWAB et al. 1997 Down; KRAMER et al. 1998 Down). Mutants that fail to activate the APC have defects in the degradation of Clb2p (IRNIGER et al. 1995 Down; ZACHARIAE et al. 1996 Down; KRAMER et al. 1998 Down). In addition, Clb5p degradation appears, at least in part, also to be regulated by the APC (IRNIGER and NASMYTH 1997 Down; SHIRAYAMA et al. 1999 Down). Failure to degrade the B-type cyclins (caused by a mutation in an APC component), coupled with lack of inhibition of the CDK kinase (caused by deletion of sic1), appears to result in levels of CDK kinase that are too high to allow progression through mitosis. We therefore analyzed Clb5p and Clb2p stability in sid2-1 sic1{Delta} cells to determine whether increased B-type cyclin levels could contribute to the observed phenotypes.

An asynchronous culture of a genomically tagged CLB5HA strain was treated with {alpha}-factor, which blocks CLB5 expression (EPSTEIN 1992 Down). Clb5p turnover was examined by following protein levels during the arrest. A strain in which Clb5-HAp's destruction box was removed was used as a positive control (CLB5{Delta}DBHA). The levels of Clb5-HAp resulting from the deletion of the destruction box do not affect the viability of cells even in the absence of sic1 (Fig 6). The percentage of unbudded cells at each hourly time point was comparable for all three strains, indicating that they arrested with similar kinetics (data not shown). Clb5-HAp levels in the sid2-1 strain were slightly higher than in the SID2 strain, though Clb5-HAp was not stabilized to the degree that it was upon removal of the destruction box (Fig 5A), suggesting that this defect is not sufficient to explain the arrest of sid2-1 cells.

To assay the stability of Clb2p in sid2-1 cells, CLB2HA cells were arrested with {alpha}-factor as described above. In wild-type strains, Clb2p is degraded at this G1 arrest point (AMON et al. 1994 Down). While the sid2-1 cells did not uniformly arrest at 1C as determined by FACS analysis, the profile was comparable to the SID2 strain (data not shown). Clb2-HAp was present at a slightly higher level in sid2-1 {alpha}-factor-arrested cells than in SID2 {alpha}-factor-arrested cells (Fig 5B). Cdh1p/Hct1p targets Clb2p for degradation by the APC in late mitosis, and G1 cells deleted for CDH1/HCT1 show greatly increased levels of Clb2p compared to wild type (SCHWAB et al. 1997 Down; see also Fig 5B). Clb2-HAp was not stabilized in sid2-1 cells to the degree that it was in cdh1{Delta}/hct1{Delta} cells. Taken together, these results suggest that while SID2 may have some role in decreasing Clb5p and Clb2p-CDK kinase activity, it is most likely very minor as Clb stability is not affected to the degree that it is by removing either the destruction box (Clb5p) or CDH1/HCT1 (Clb2p). This suggests that Sid2p is not a component of the APC and that the arrest of sid2-1 sic1{Delta} cells is not likely to be due primarily to a defect in APC activity (see DISCUSSION).

sid2-1 interacts genetically with S phase cyclins:
As sid2-1 sic1{Delta} cells had a preanaphase arrest and sid2-1 did not appear to affect APC function, we thought it likely that sid2-1 was causing a defect in DNA replication. We therefore analyzed the effects of deleting the S phase cyclins, CLB5 and CLB6, on the growth of sid2-1 sic1{Delta} cells. If Sic1p rescues sid2-1 by inhibiting the kinase activity of S phase cyclin-CDK complexes, then deleting these genes should mimic Sic1p expression. A deletion of CLB5 partially suppressed the growth defect of sid2-1 sic1 cells, and the clb5 clb6 double deletion almost completely rescued sid2-1 sic1 cells (Fig 6, top). Deleting CLB6 alone did not have a detectable effect (data not shown). Since the removal of these S phase activators rescued the arrest caused by sid2-1 in sic1 cells, we hypothesized that increasing S phase cyclin levels would have the opposite effect. The destruction box of the more potent of these two cyclins, CLB5, was removed (CROSS et al. 1999 Down) and sid2-1 sic1{Delta} GAL1-SIC1 CLB5{Delta}DBHA strains were constructed. The CLB5{Delta}DBHA construct results in partial stabilization of Clb5-HAp (Fig 5A). sid2-1 cells that contained CLB5{Delta}DBHA showed at least a 10-fold decrease in plating efficiency compared to strains with wild-type Clb5 levels when grown in the absence of SIC1 (Fig 6, bottom). The CLB5{Delta}DBHA construct did not appear to have an effect on SID2 sic1{Delta} cells. Taken together, these interactions suggest that Sid2p's major function is related to DNA replication, since the main (but not the only) biological function of CLB5 and CLB6 is to trigger replication (SCHWOB and NASMYTH 1993 Down; SEGAL et al. 1998 Down).

sid2 mutants may accumulate DNA damage during replication:
sic1{Delta} cells exhibit accelerated entry into DNA replication presumably resulting from premature Clb5p- and Clb6p-associated Cdc28 kinase activity (SCHWOB et al. 1994 Down). It is possible, therefore, that sid2 sic1{Delta} synthetic lethality could be the result of DNA damage or synthesis defects occurring because of unregulated replication. This would be consistent with the preanaphase arrest observed for the sid2-1 sic1 mutants, since DNA damage results in a checkpoint-dependent preanaphase arrest. To analyze the progression of the mutant cells in S phase, we used {alpha}-factor to synchronize the cells in G1 and monitored DNA synthesis by FACS analysis. SID2, sid2-1, SID2 sic1{Delta} GAL1-SIC1, and sid2-1 sic1{Delta} GAL1-SIC1 strains were released from the {alpha}-factor arrest into YPD. All cells began budding and replicating their DNA at approximately the same time, by about 40 min after the {alpha}-factor release (Fig 7). Due to the speed and partial asynchrony of DNA replication, the SID2 strains do not accumulate detectably at an intermediate stage between 1C and 2C while replicating their DNA. Only a decrease in the 1C peak and a commensurate increase in the 2C peak could be observed. At the same time intervals, however, sid2-1 cells, regardless of their SIC1 genotype, do accumulate at a point between 1C and 2C and are delayed in reaching a completed 2C state (Fig 7). Consistent with the profiles for the sid2-1 SIC1 strain, the replication delay for sid2-1 sic1{Delta} GAL1-SIC1 cells is also observed when strains are released into YPGal where GAL1-SIC1 is expressed (data not shown). It may be that errors or DNA damage occur during DNA replication due to the sid2-1 mutation, since damage slows the rate of S phase progression due to a Mec1- and Rad53-dependent checkpoint (PAULOVICH and HARTWELL 1995 Down), and sufficient DNA damage can cause arrest with a nearly 2C DNA content.

We were interested in determining whether replication was completed in sid2 strains and used field inversion gel electrophoresis to probe the structure of chromosomes in sid2 mutant strains. Chromosomes isolated from cells blocked in replication fail to band properly on similar gel systems (HENNESSY et al. 1991 Down). This is most likely due to the presence of replication forks and bubbles, which make the chromosomes heterogeneous in size and alter their migration properties. As expected, DNA isolated from cells blocked in S phase by treatment with hydroxyurea failed to band (Fig 8, lane 9), while DNA from a wild-type strain in log phase demonstrated a characteristic chromosome banding pattern (Fig 8, lanes 1–4). Under permissive conditions, DNA isolated from a sid2-21 mutant strain migrated similarly to wild type (lane 5). In contrast, under nonpermissive conditions, the DNA isolated from the sid2-21 mutant showed much less banding than the wild-type strain (Fig 8, lanes 6–8). When taken together with the FACS analysis, these data suggest that, although the sid2-21 mutant cells may replicate most of their DNA, they still have some replication forks or bubbles present at the time of arrest. In some experiments, there was slighly more banding in the mutant at 37° than in the hydroxyurea-treated sample. It is likely that this is either the result of a less complete arrest or the presence of fewer forks and bubbles in the sid2-21-arrested cells.



View larger version (57K):
In this window
In a new window
Download PPT slide
 
Figure 8. Chromosomes isolated from sid2-21 strains show decreased banding on an inverted field gel. Strains 1036 (SID2) and 1037 (sid2-21) were grown to early log phase in YPD. Aliquots of the cultures were removed, the cultures shifted to 37°, and incubation continued for 6 hr. The DNA replication inhibitor HU was added to an aliquot of strain 1036 and incubated for 3 hr at 30°. Chromosomal DNA was isolated from each sample, separated on a field inversion gel, and stained with ethidium bromide. Numbers represent the hours the sample was incubated at 37° before chromosome isolation.

If DNA replication is slow and fails to be completed in the sid2 mutant strains because of the accumulation of damage, it is possible that sid2-1 mutants would be sensitive to DNA damaging agents or compounds that affect DNA replication, since then damage would be occurring for two independent reasons. sid2-1 sic1{Delta} GAL1-SIC1 strains were ~100-fold more sensitive to HU treatment than SID2 sic1{Delta} GAL1-SIC1 strains (Fig 9A). A similar effect of HU was found when sid2-1 SIC1 strains were grown on YPD, where GAL1-SIC1 was repressed (data not shown). Following UV treatment, a less dramatic decrease in plating efficiency, of ~5- to 10-fold, was found when comparing sid2-1 to SID2 strains (data not shown). In contrast, neither sid2-1 nor sid2-21 strains showed any sensitivity to the microtubule depolymerizing drug, benomyl, when assayed at a range of drug concentrations (data not shown).



View larger version (71K):
In this window
In a new window
Download PPT slide
 
Figure 9. (A) sid2-1 cells are sensitive to hydroxyurea. Strain MJ163 (sid2-1 sic1{Delta} GAL1-SIC1) was transformed with either a plasmid containing SID2 (pMJ02) or vector (RS415). The strains were grown overnight to stationary phase in SCGal-Leu. Strains LY909 (SID2 sic1{Delta} GAL1-SIC1) and LY907 (sid2-1 sic1{Delta} GAL1-SIC1) were grown overnight to stationary phase in YPGal. Five microliters of 10-fold serial dilutions were plated on YPGal and YPGal with 200 mM hydroxyurea. (B) sid2-1 rad9 cells are slow growing or dead. Spores from a diploid strain formed by crossing KK1 (MAT{alpha} sic1{Delta} GAL1-SIC1 rad9{Delta}) and MJ163 (MATa sid2-1 sic1{Delta} GAL1-SIC1) were dissected on YPGal and incubated at 30° for 3–4 days. The observed or predicted genotype of each spore colony is noted below the tetrad plate.

It may be that the sid2-1 mutation is directly or indirectly (by affecting DNA repair) causing DNA damage, which is then exacerbated by UV or HU to a point of decreased colony formation even with GAL1-SIC1 expression. A defect of sid2-1 cells in a checkpoint pathway could also cause HU and UV sensitivity, but this is less likely because of the delay observed during DNA replication in sid2-1 strains and the cell cycle arrest phenotype observed with the sid2-1 sic1{Delta} strains.

To determine whether sid2 mutant cells were accumulating DNA damage and to test the hypothesis that sid2-1 sic1 cells arrest because of defects in DNA replication or repair, we analyzed sid2 rad9 cells. RAD9 is required for the G2 cell cycle arrest caused by DNA damage or incomplete replication (WEINERT and HARTWELL 1988 Down, WEINERT and HARTWELL 1993 Down). We constructed diploid strains heterozygous for sid2-1 and rad9{Delta} and homozygous for sic1{Delta} and GAL-SIC1. Tetrad analysis showed that sid2-1 rad9{Delta} spore colonies were either dead or extremely slow growing, even when GAL1-SIC1 was expressed (Fig 9B and Table 3). Furthermore, analysis of the sid2-1 rad9{Delta} cells showed that the preanaphase Cdc- arrest of sid2 sic1{Delta} cells depends on RAD9 (Table 4). The demonstration that RAD9 is required both for the full viability of sid2-1 cells and for the cell cycle arrest of sid2 sic1{Delta} is consistent with the hypothesis that sid2-1 results in defects in DNA replication or repair.


 
View this table:
In this window
In a new window

 
Table 3. rad9 sid2-1 double mutants have a defect in growth and viability


 
View this table:
In this window
In a new window

 
Table 4. rad9 sid2-1 double mutants fail to demonstrate the preanaphase arrest observed in RAD9 sid2-1 strains


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Identification of genes synthetically lethal with sic1{Delta}:
SIC1 encodes a nonessential B-type cyclin/CDK inhibitor that functions at both the G1/S transition and the exit from mitosis. Sic1p decreases Clb5/6p-associated kinase activity at the G1/S stage in the cell cycle, delaying initiation of DNA replication. This is thought to provide the cell time to prepare properly for DNA replication (load origins, synthesize nucleotides, etc.; TANAKA et al. 1997 Down; VALLEN and CROSS 1999 Down). As Clb5/6p-Cdc28p may affect the activity of the DNA replication machinery (DUNCKER et al. 1999 Down), Sic1p might also act during S phase to alter the rate of elongation. A major event in the exit from mitosis is the degradation of Clb2p. Sic1p most likely works in parallel to the destruction of Clb2p by inhibiting the kinase activity of any remaining Clb2p associated with Cdc28p. To understand more completely the regulation of these two cell cycle transitions, mutations synthetically lethal with sic1{Delta} were isolated. Mutations in two genes already known to interact genetically with SIC1, DBF2 and CDC15, were recovered. The products of both of these genes are thought to assist Sic1p in regulating the exit from mitosis, although their mechanisms of action are not yet completely established (DONOVAN et al. 1994 Down; JASPERSEN et al. 1998 Down).

We found a novel gene, SID2, in this screen. We show that SID2 is an essential gene (see also HUANG et al. 1997 Down) encoding a protein stable throughout the cell cycle. sid2-1 sic1{Delta} and sid2-21ts strains arrest as large-budded cells with a single nucleus, a short spindle, and DNA content that is close to 2C. This is indicative of a preanaphase arrest and is likely to be due to a defect in the preceding S phase. In contrast, cells arrested because of a failure to exit from mitosis due to high Cdc28p/Clb2p kinase activity have two separated nuclei and an extended spindle (SURANA et al. 1993 Down; JASPERSEN et al. 1998 Down). This phenotype is indeed observed with dbf2 sic1 double mutants (TOYN et al. 1997 Down). sid2-1 is the only mutation currently known to be synthetically lethal with sic1{Delta} that causes an earlier cell cycle arrest phenotype.

Both S and M phase B-type cyclins (Clb5p and Clb2p) appear to be slightly stabilized in cells containing the sid2-1 mutation. This minor effect is unlikely to account for the sid2-1 sic1 lethal phenotype, although we cannot fully rule this out. The complete viability of sic1 CLB5{Delta}DBHA strains (Fig 6B) argues <