- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Natarajan, L.
- Articles by Eisenmann, D. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Natarajan, L.
- Articles by Eisenmann, D. M.
The Divergent Caenorhabditis elegans ß-Catenin Proteins BAR-1, WRM-1 and HMP-2 Make Distinct Protein Interactions but Retain Functional Redundancy in Vivo
Lakshmi Natarajana, Nina E. Witwera, and David M. Eisenmannaa Department of Biological Sciences, University of Maryland, Baltimore County, Baltimore, Maryland 21250
Corresponding author: David M. Eisenmann, Department of Biological Sciences, University of Maryland, Baltimore County, 1000 Hilltop Cir., Baltimore, MD 21250., eisenman{at}umbc.edu (E-mail)
Communicating editor: B. J. MEYER
| ABSTRACT |
|---|
ß-Catenins function both in cell adhesion as part of the cadherin/catenin complex and in Wnt signal transduction as transcription factors. Vertebrates express two related proteins, ß-catenin and plakoglobin, while Drosophila has a single family member, Armadillo. Caenorhabditis elegans expresses three ß-catenin-related proteins, BAR-1, HMP-2, and WRM-1, which are quite diverged in sequence from each other and other ß-catenins. While BAR-1 and WRM-1 are known to act in Wnt-mediated processes, and HMP-2 acts in a complex with cadherin/
-catenin homologs, it is unclear whether all three proteins retain the other functions of ß-catenin. Here we show that BAR-1, like vertebrate ß-catenin, has redundant transcription activation domains in its amino- and carboxyl-terminal regions but that HMP-2 and WRM-1 also possess the ability to activate transcription. We show via yeast two-hybrid analysis that these three proteins display distinct patterns of protein interactions. Surprisingly, we find that both WRM-1 and HMP-2 can substitute for BAR-1 in C. elegans when expressed from the bar-1 promoter. Therefore, although their mutant phenotypes and protein interaction patterns strongly suggest that the functions of ß-catenin in other species have been segregated among three diverged proteins in C. elegans, these proteins still retain sufficient similarity to display functional redundancy in vivo.
ß-CATENIN proteins function in two important processes during metazoan development. First, ß-catenin is a component of the cadherin-catenin complex of proteins that function in cell adhesion at adherens junctions (reviewed in ![]()
![]()
-catenin, which itself can bind to
-actinin or vinculin and link to the actin cytoskeleton. The ability to make and break cell contacts via modulation of the cadherin-catenin complex is important to proper cell migration and morphogenesis during development (![]()
![]()
The second role for ß-catenin proteins during development is as transcription factors acting in Wnt signaling pathways (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
ß-Catenin proteins have a common structure consisting of amino- and carboxyl-terminal domains flanking a well-conserved central domain (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Drosophila melanogaster has a single ß-catenin gene, which encodes a protein, Armadillo, that functions in both Wnt signaling and adhesion, and these functions are independently mutable (![]()
![]()
![]()
-catenin at adherens junctions but also functions in cell adhesion at desmosomal junctions, a function not shared by ß-catenin (see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Three proteins related to ß-catenin have been identified through genetic screens in the nematode Caenorhabditis elegans: HMP-2, WRM-1, and BAR-1. Mutations in the hmp-2 gene cause defects in cell migration and morphogenesis during embryogenesis, and the HMP-2 protein localizes at sites of epithelial cell contact in the embryo with an
-catenin homolog (HMP-1) and a cadherin homolog (HMR-1; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Although all three C. elegans ß-catenin homologs have the conserved structure of ß-catenin proteins, they are more diverged in primary sequence than other members of the family, making the relationship between the C. elegans proteins and ß-catenin, plakoglobin, and p120 unclear. In addition, it is not known whether each of the three C. elegans proteins can perform both adhesion and Wnt signaling functions. We previously proposed that the functions of ß-catenin may have been segregated among these three proteins, with BAR-1 and WRM-1 functioning in Wnt signaling only, and HMP-2 functioning in a cadherin-catenin complex only (![]()
![]()
| MATERIALS AND METHODS |
|---|
Database searching and phylogenetic analysis:
To search for additional ß-catenin homologs in C. elegans the advanced BLAST program (![]()
![]()
|
Genetics and molecular biology:
Standard C. elegans genetic procedures were followed in this work (![]()
![]()
![]()
![]()
BAR-1 structure/function analysis in yeast:
We created fusions of all or portions of the bar-1 cDNA to the coding region for the Gal4 DNA-binding domain (1147) in the vector pAS1 (gift of Steve Elledge). Plasmids (BAR-1 residues in parentheses) contain the indicated bar-1 regions inserted into the pAS1 polylinker. pDE227 (1811) contains the full-length bar-1 open reading frame (ORF) flanked by NdeI sites from the cDNA plasmid pDE219 (![]()
Plasmids were transformed into the yeast strain PJ69-4A (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4
gal80
GAL2-ADE2 LYS2::GAL1-HIS3 met-2::GAL7-lacZ; gift of Philip James; ![]()
![]()
ß-Galactosidase activity was assayed using the Gal-Screen chemiluminescent reporter system from Tropix (Bedford, MA; ![]()
HMP-2 and WRM-1 yeast constructs:
Fusions of WRM-1 and HMP-2 to the Gal4 DNA-binding domain were made by PCR using wrm-1 (gift of C. Rocheleau and C. Mello) and hmp-2 cDNAs (gift of M. Costa and J. Priess) as templates. PCR products were cloned into the pAS1 polylinker using appropriate enzymes. The following primers were used: WRM-1FL, ODE158 and ODE160; WRM-1R112, ODE172 and ODE173; HMP-2FL, ODE169 and ODE170; and HMP-2R19, ODE157 and ODE107. For HMP-2R19 an internal NcoI/BamHI fragment was used. Plasmids were transformed into yeast and analyzed as described above.
Yeast two-hybrid analysis:
For yeast two-hybrid analysis (![]()
ß-Catenin::Gal4 activation domain fusion protein plasmids were made by PCR on appropriate cDNA templates and insertion of PCR products into the plasmid pACT (gift of S. Elledge). pDE280 (BAR-1) was made using ODE61 and ODE62; pSP12 (HMP-2) was made using ODE177 and ODE170; pLN2 (WRM-1) was made using ODE126 and ODE127; pAS1CYH2-ß-cat (mouse ß-catenin) was a gift of S. Kaech and S. Kim. The interacting protein fusion plasmids were the following: pAH8 (APR-1) and pAH10 (NT APR-1, residues 1486, gifts of A. Hajnal); pRL182 (POP-1, gift of R. Lin); pCCM369 (LIT-1, gift of T. Shin and C. Mello); pAS2-1N (NT EGL-27, residues 1637) and pAS2-1C (CT EGL-27, residues 6281129, gifts of T. Ratliff and M. Herman); pACT2-
-cat (mouse
-catenin, gift of S. Kaech and S. Kim); pVB10LN (LIN-25 residues 116565), pVB11LN (LIN-25 residues 473938), and pVB12LN (LIN-25 residues 7321139, gifts of S. Tuck); and pDE268 (HMP-1 residues 8514) and pDE290 (delNTPOP-1, residues 56487). pDE290 was made by PCR on pRL182 (contains pop-1 cDNA) with ODE176 and ODE143 and insertion of the product into pAS1. pDE268 was made by PCR on hmp-1 cDNA (gift of B. Raich and J. Hardin) with ODE86 and ODE87 and insertion of the product into pAS1. pSE1111, encoding Snf4::Gal4 activation domain, and pSE1112, encoding Snf1::Gal4DBD, served as controls (gifts of S. Elledge).
BAR-1 structure/function analysis in C. elegans:
pDE204 contains the bar-1 genomic region (5.1 kb upstream and 0.8 kb downstream of the open reading frame) and can rescue a bar-1(ga80) mutation (![]()
![]()
NTBAR-1, amino acids (aa) 14, 90811] was made using ODE49 and ODE40. pDE291 (BAR-1
CT1, aa 1758) was made by combining a PvuII-SpeI fragment made using ODE32 and ODE148 with an XbaI-PvuII fragment from pDE219. pDE292 (BAR-1
CT2, aa 1667) was made by combining a PvuII-SpeI fragment made using ODE32 and ODE149B with an XbaI-Pvu2 fragment from pDE219. Both pDE291 and pDE292 contain two stop codons at the 3' BamHI site, so the resulting bar-1 ORF terminates prematurely but still has the rest of the bar-1 final exon and 3' untranslated region sequences intact. pDE293 (BAR-1
NT
CT, aa 14, 90667) was made by combining a 0.35-kb BamHI/XhoI fragment from pDE282 with a 2.3-kb XhoI/PstI fragment from pDE292 and ligating into pDE204 digested with BamHI and PstI.
Each construct was injected into bar-1(ga80) mutants and transgenic lines were identified as described above. To score the vulval phenotype of these strains, >100 non-Unc L4 hermaphrodites were picked to a separate plate and scored the next day as adults for the retention of older embryos or larvae (egg-laying defective/Egl phenotype) or for a protruding vulva (Pvl phenotype). To examine vulval morphology in these strains >50 non-Unc L4 hermaphrodites were placed on a slide in M9 plus 10 mM sodium azide and the number of induced cells was determined by examining the morphology of the vulval induction in each animal. Animals with fewer than three induced vulval precursor cells (VPCs) were considered to have an Underinduced phenotype.
HMP-2/WRM-1/Armadillo rescue of bar-1(ga80):
pDE249 (bar-1p::arm) was made by PCR with ODE50 and ODE54 on an arm cDNA (gift of R. Nusse) and insertion of the product between the BamHI sites of pDE204. The resulting ORF encodes residues 14 of BAR-1 and 5843 of Armadillo. For wrm-1 and hmp-2 constructs, internal BamHI sites in the cDNAs required the use of pDE204NBX, which contains NotI, BglII, and XhoI restriction sites introduced between the BamHI sites of pDE204, destroying the second BamHI site. pJBH2 (bar-1p::hmp-2), was made by PCR on a hmp-2 cDNA with ODE106 and ODE107. The PCR product was inserted into pDE204NBX digested with NotI. The resulting ORF encodes residues 15 of BAR-1, the amino acids RRP, and residues 2678 of HMP-2. pJBW1 (bar-1p::wrm-1) was made by PCR on the wrm-1 cDNA with ODE126 and ODE127. The product was ligated into pDE204NBX digested with BamHI and XhoI. The resulting ORF encodes residues 14 of BAR-1 and residues 2796 of WRM-1 with a V3L change. The resulting plasmids were injected into bar-1(ga80) mutant animals and transgenic lines were analyzed for their Egl and Underinduced phenotypes as described above.
Oligonucleotides:
The following oligonucleotides were used in this work: ODE32, GCCACCAAAGAGATGGGTGACTTGAGAG; ODE40, CATATGAATGTGCAACAAATATCCGACTGG; ODE49, GGATCCGATCCCCACTCTTTCAGATCAGC; ODE50, GGATCCAGCCCAGAATCGAACCATGTCGC; ODE54, GATTCCGGGATCCGGGATGGAATCAAAGC; ODE57, GGTCATATGAGCATGACCACCCCACGAAGC; ODE61, GGACCTAGATCTGAACCTAGTTATTAACC; ODE62, AGATCTAATCVACTATTCCTAGAAGGATAATAATCAGACG; ODE86, GGATCCATGCGTATTTCAACATCGACGAAGTGC; ODE87, GGATCCCCCGCTCACAGTCTTCAACAATATGTGC; ODE106, GCGGCCGCTTCTTCACTCTACCAACTCTTATTCG; ODE107, GCGGCCGCTTACAAATCGGTATCGTACCAATTGTG; ODE126, ATAGATCTGGATTGCGCAGAAAC (causes V3L change); ODE127, CTCGAGATTCATTCACATTAGTTGTCG; ODE143, CCGGAGAAGATCTTTAAATAGTACACATCG; ODE148, GGATCCTACTACGTCTCGGGAGGTCCAATTG; ODE149, AGATCTATTCTCGCTTCTCATACATCATCTTG; ODE149B, GGATCCTTGTCTATTCTCGCTTCTCATACATC; ODE157, CATATGGATCTTCTAACCTACGAAG; ODE158 CCATGTGTGGATTGCGCAGAAAC; ODE160, AGATCTATTCAGACATTAGTTGTCGATGATG; ODE169, CATATGCTTCTTCACTCTACCAACTCTTATTCG; ODE170, GTCGACTTACAAATCGGTATCGTACCAATTGTG; ODE172, CCATGGGCGAATATGTCAGAAATGACCG; ODE173, GTCGACTTCAAATTGACAAAATGAATGCTAGC; ODE174, CATATGAATGTGCAAGAATCTATCGAAGG; ODE176, CCATGGATGTGTTAAAAAGTGCATTTCC; and ODE177, GTCGACTTCTTCACTCTACCAACTCTTATTCG.
| RESULTS |
|---|
C. elegans contains three ß-catenin homologs and a single p120 homolog:
Genes encoding ß-catenin proteins have been found in many metazoan phyla and the encoded proteins share strong conservation at the amino acid level. For example, Drosophila Armadillo is 67% identical to human ß-catenin (Table 1; ![]()
![]()
![]()
![]()
![]()
Given the low percentage identity of the C. elegans proteins to ß-catenin and the presence of three putative ß-catenin homologs in C. elegans, we asked whether any protein more similar to ß-catenin was encoded in the C. elegans genome and whether any of the three C. elegans proteins was more similar to one or more vertebrate ß-catenin-related proteins than it is to ß-catenin. The C. elegans genome was searched for predicted proteins most similar to ß-catenin, plakoglobin, and the following ß-catenin-related proteins: p120 catenin (![]()
![]()
![]()
![]()
![]()
![]()
![]()
These results suggest that while vertebrates appear to have two conserved ß-catenin family members and D. melanogaster has only one, C. elegans has three ß-catenin proteins that have widely diverged in primary sequence from ß-catenins in other species. We previously hypothesized on the basis of the mutant phenotypes of bar-1, wrm-1, and hmp-2 that C. elegans has increased its number of ß-catenin proteins by gene duplication and that these proteins may have segregated the Wnt signaling and cell adhesion functions of ß-catenin and Armadillo among themselves (![]()
BAR-1 contains transcription activation domains in its amino- and carboxyl-terminal domains:
bar-1 activity is required to maintain expression of Hox target genes during two Wnt-mediated postembryonic developmental processes, suggesting that, like ß-catenin, BAR-1 may function to regulate transcription in the nucleus (![]()
![]()
![]()
![]()
A chimeric protein containing the entire BAR-1 open reading frame fused to the DNA-binding domain of the yeast Gal4 transcription factor (Gal4DBD) was expressed in a yeast strain containing Gal4-binding sites upstream of the yeast HIS3 and Escherichia coli lacZ genes (![]()
![]()
![]()
![]()
|
The BAR-1 transcription activation domains are functionally redundant in C. elegans:
Although both the amino- and carboxyl-terminal regions of BAR-1 contain transcription activation domains, it is possible that these regions might contain other functional domains required for BAR-1 activity in C. elegans. To test this we introduced mutated bar-1 cDNAs into a rescuing bar-1 minigene construct (Table 2; ![]()
![]()
![]()
![]()
|
The amino-terminal region of BAR-1 contains consensus GSK3ß phosphorylation sites (![]()
NT BAR-1) was still able to rescue the vulval induction defects of a bar-1(ga80) strain (Table 2), indicating that no sequences in the amino-terminal region are necessary for BAR-1 activity. In these experiments the bar-1 plasmid is present on a mitotically unstable extrachromosomal array, so full rescue of the bar-1(ga80) mutant phenotype is not observed. The
NT BAR-1 construct was also introduced into wild-type animals to look for a dominant positive phenotype, since deletion of the amino terminus or mutation of the GSK3ß phosphorylation sites leads to a stabilized ß-catenin protein capable of activating the transcription of Wnt-responsive genes in vertebrates and Drosophila (![]()
![]()
![]()
NT BAR-1 from the bar-1 promoter (data not shown). However, expression of
NT BAR-1 from the heat shock promoter can cause defects in vulval development (J. GLEASON and D. EISENMANN, unpublished results).
BAR-1 proteins lacking the last one-half of the carboxyl-terminal domain (
CT1 BAR-1; residues 1759) or the entire region carboxyl terminal to the Armadillo repeats (
CT2 BAR-1; residues 1667) were also analyzed. Both of these truncated proteins could rescue the bar-1 vulval mutant phenotype as well as the full-length bar-1 construct (Table 2). Together these results suggest that neither the amino- nor the carboxyl-terminal portion of BAR-1 is necessary for bar-1 activity in C. elegans. As both regions are able to activate transcription in yeast and a known function of ß-catenin proteins is the activation of target gene expression, this suggests that BAR-1 may have transcription activation domains that are functionally redundant in vivo. To address this, a protein truncated at both its amino- and carboxyl-termini (
NT
CT2BAR-1) was tested. Fifty-six percent of bar-1(ga80) animals carrying this transgene displayed vulval mutant phenotypes when examined by dissecting microscope, compared to 45% for bar-1(ga80) alone, and 50% of animals displayed defects in vulval induction when examined by Nomarski microscopy, compared to 59% for bar-1(ga80) alone (Table 2). The fact that
NT
CT2BAR-1 does not rescue the bar-1(ga80) vulval mutant phenotype, while both
NTBAR-1 and
CT2 BAR-1 do, indicates that the transcription activation domains identified in the yeast experiments are necessary and redundant for BAR-1 function in vivo.
The WRM-1 and HMP-2 proteins can also activate transcription in yeast:
We wished to address whether each of the three C. elegans ß-catenin proteins retains all the functions of ß-catenin and Armadillo or whether these functions have been segregated among the three proteins. For example, it could be the case that HMP-2, which functions in a process with C. elegans cadherin and
-catenin homologs (![]()
50% (Fig 2). Thus, this analysis shows that all three C. elegans ß-catenin proteins can activate transcription in a heterologous system and therefore retain this function of ß-catenin/Armadillo.
|
BAR-1, WRM-1, and HMP-2 make specific protein-protein interactions:
Although the three C. elegans proteins retain the transcription activation function of ß-catenin, it remains possible that other functions of ß-catenin/Armadillo are dispersed among the proteins, a possibility suggested by the different phenotypes of hmp-2, bar-1, and wrm-1 mutants. To address this issue we used two-hybrid analysis in yeast (![]()
![]()
![]()
-catenin HMP-1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
-catenin. Interaction between two fusion proteins in this yeast assay leads to transcription from the HIS3 and lacZ reporter genes, as shown by growth on plates lacking histidine and plates containing X-Gal, respectively.
The results of this analysis are shown in Fig 3 and show that the three C. elegans ß-catenin proteins make distinct protein-protein interactions that are consistent with previous genetic data. For example, HMP-2 interacts with the C. elegans
-catenin homolog HMP-1, and hmp-1 and hmp-2 mutants have similar phenotypes (![]()
-catenin, indicating that although HMP-2 is only 27% identical to vertebrate ß-catenin, it has retained the sequences necessary for a functional interaction with vertebrate
-catenin. In a similar assay, HMP-2 was also shown to physically interact with the cadherin homolog HMR-1 (![]()
-catenin.
|
BAR-1 and WRM-1 did interact with known Wnt signaling pathway components. Both interacted with the TCF/LEF homolog POP-1, although the interaction with BAR-1 was stronger based on the ability of the BAR-1 + POP-1 strain to grow on plates containing 50 mM 3AT, while the WRM-1 + POP-1 strain could grow only on plates containing 3 mM 3AT (3AT is a competitive inhibitor of the HIS3 reporter gene). The physical and functional interaction of BAR-1 with POP-1 was described recently in yeast and vertebrate culture cells (![]()
![]()
![]()
![]()
-catenin in this assay. No interaction was detected between vertebrate ß-catenin and any C. elegans protein, nor did any of the ß-catenin proteins interact with any region of EGL-27 or LIN-25.
TCF family members interact with ß-catenin through a conserved region at their amino terminus (![]()
![]()
NTPOP-1) was tested for interactions with BAR-1 and WRM-1. This deletion completely abolished the ability of POP-1 to interact with BAR-1, indicating that POP-1, like other TCF/LEF proteins, interacts with ß-catenins via its amino-terminal domain (see also ![]()
NTPOP-1, suggesting that WRM-1 and BAR-1 may interact with POP-1 in different manners.
In summary, these results indicate that each C. elegans ß-catenin protein has a pattern of protein interactions distinct from that of the other two, and the pattern of interactions suggests that the three C. elegans ß-catenin proteins may have segregated the functions of ß-catenin among themselves, with HMP-2 functioning only in a cadherin-catenin complex and BAR-1 and WRM-1 functioning only in Wnt signaling but with different modalities.
WRM-1, HMP-2, and Armadillo can substitute for BAR-1 in vivo:
To examine the relevance of the yeast data in vivo in C. elegans, we asked whether HMP-2 or WRM-1 could substitute for the function of BAR-1 in vivo and rescue the phenotype of a bar-1 mutant strain. To perform this experiment, full-length hmp-2 or wrm-1 cDNAs were inserted into the same vector previously used for bar-1 structure/function analysis in vivo (pDE-248), resulting in the production of HMP-2 or WRM-1 protein under the same temporal and spatial controls as BAR-1. The results of this analysis are shown in Table 3. Expression of either WRM-1 or HMP-2 from the bar-1 promoter from a multicopy extrachromosomal array rescued the vulval defects of a bar-1 mutant strain and did so nearly as well as a bar-1(+) control. The Drosophila Armadillo protein was also able to substitute for bar-1 activity, indicating that although these proteins show significant divergence in primary sequence, the insect and nematode proteins retain common functions and interactions.
|
WRM-1 and Armadillo are known to function in Wnt signaling, so their ability to substitute for BAR-1 was not completely unexpected; however, the result with HMP-2 was surprising since the yeast two-hybrid analysis suggests that HMP-2 and BAR-1 make different protein interactions. It is clear that the rescue is not due to artifactual rescue by bar-1 promoter sequences or coinjection marker DNA, since the
NT
CT2BAR-1 protein expressed in the same manner was not able to rescue a bar-1(ga80) mutant (Table 2). Since injected transgenic DNAs in C. elegans are present as high copy extrachromosomal arrays, we reasoned that the ability of HMP-2 to rescue bar-1(ga80) might be dependent on a high level of expression of the protein. We therefore injected bar-1(ga80) animals with 10-fold less of the BAR-1- and HMP-2-expressing constructs. Under these conditions, the BAR-1-expressing plasmid could still rescue the bar-1(ga80) vulval phenotype fairly well (35% mutant vs. 27% mutant when injected at 100 µg/ml), while the HMP-2-expressing plasmid rescued poorly if at all (53% mutant vs. 27% when injected at 100 µg/ml; Table 3). This suggests that HMP-2 may be able to substitute for bar-1 function in vivo, but only when overexpressed. Therefore, although the yeast two-hybrid data suggest a segregation of protein-protein interactions among the three C. elegans ß-catenins, both WRM-1 and HMP-2 retain the ability to substitute for BAR-1 in vivo during vulval development when expressed at high levels in the appropriate temporal and spatial pattern, indicating that the three C. elegans proteins display functional redundancy in vivo.
| DISCUSSION |
|---|
ß-Catenin proteins function in cell fate determination via their transduction of Wnt signals and in cell adhesion and morphogenesis via their participation in the cadherin/catenin complex (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have shown that (1) the essentially complete C. elegans genome encodes only these three ß-catenin homologs and a single less-related p120-like protein; (2) all three C. elegans ß-catenins retain the ability to activate transcription when assayed in yeast, with BAR-1 the strongest activator of transcription (three- to fivefold better than HMP-2 and WRM-1); (3) BAR-1 contains transcription activation domains in its amino-terminal and carboxyl-terminal regions, which are functionally redundant in vivo; (4) the three C. elegans ß-catenins make distinct protein-protein interactions on the basis of yeast two-hybrid analysis, with WRM-1 and BAR-1 making contacts with Wnt signaling factors and HMP-2 making contacts with a component of the cadherin-catenin complex; and (5) HMP-2 and WRM-1 (and Drosophila Armadillo) can partially rescue the bar-1 vulval mutant phenotype when expressed from the bar-1 promoter, suggesting that these proteins retain the ability to function in a manner similar to BAR-1 in vivo.
All of the protein interactions we observed using the yeast two-hybrid assay are consistent with genetic results in C. elegans. For example, HMP-2 clearly functions in a cadherin-catenin complex during embryonic development with the
-catenin homolog HMP-1 and the cadherin homolog HMR-1, and we observed an interaction between HMP-2 and HMP-1 (![]()
![]()
![]()
![]()
APR-1 also interacts strongly with BAR-1. Consistent with the observed interaction, loss of apr-1 activity in the VPCs causes bar-1-like defects in cell fate specification and lin-39 expression, suggesting that APR-1 functions in a Wnt signaling pathway with BAR-1 during vulval development (![]()
![]()
![]()
![]()
BAR-1 also interacts with the TCF/LEF homolog POP-1. POP-1 acts in Hox gene regulation and cell fate specification in the progeny of the Q neuroblasts, a Wnt-mediated process that utilizes bar-1 (![]()
![]()
![]()
![]()
![]()
We also observed a weak interaction between POP-1 and WRM-1, an interaction that has been reported previously (![]()
![]()
![]()
![]()
![]()
![]()
Finally, we observed an interaction between WRM-1 and the kinase LIT-1, an interaction that was observed previously (![]()
![]()
![]()
Our model (Fig 4) envisions that an ancestral ß-catenin gene encoding a protein functioning in both adhesion and Wnt signaling was duplicated twice in C. elegans to generate the hmp-2, bar-1, and wrm-1 loci. We hypothesize that over time, HMP-2, WRM-1, and BAR-1 may each have retained only a subset of the protein interactions of the original ß-catenin and that each C. elegans protein may now predominantly perform only one function of ß-catenin. Specifically, HMP-2 may now function only in a cadherin-catenin complex, while BAR-1 and WRM-1 function only in Wnt signaling. Further, BAR-1 appears to function as a canonical ß-catenin in Wnt signaling, cooperating with a TCF/LEF transcription factor to transduce Wnt signal and activate expression of target genes, while WRM-1 appears to act in a noncanonical fashion, cooperating with LIT-1 to derepress target gene expression by inhibiting the ability of POP-1 to bind DNA and repress transcription. However, although the three C. elegans proteins diverged a fair amount in sequence from each and other ß-catenins, they must all still retain the Wnt signaling function of BAR-1 at some level, as both WRM-1 and HMP-2 can partially provide BAR-1 activity to bar-1 null mutants when expressed at high levels. A similar case of proteins showing distinct genetic activities but displaying functional redundancy has been demonstrated with the yeast flocculin gene products (![]()
|
![]()
Our results and those of ![]()
![]()
![]()
Several explanations are possible. First, the interaction between HMP-2 and POP-1 might be sufficiently weak that it is not detected in the yeast assay, but it can still allow HMP-2 to interact with POP-1 when HMP-2 is overexpressed. It is clear that expression of BAR-1 from its own promoter on an extrachromosomal array leads to higher BAR-1 levels than normal, since an antibody to BAR-1 does not stain wild-type worms but does stain worms containing the bar-1 gene on such an array (![]()
![]()
![]()
![]()
If HMP-2 and WRM-1 can function in a manner analogous to BAR-1 in vivo, it raises the possibility that they do so normally during vulval development and that perhaps not all Wnt signaling activity in the VPCs is mediated via BAR-1. However, we found that loss of zygotic activity of hmp-2 by dsRNA-mediated interference does not cause an obvious defect in vulval induction or any other postembryonic process nor does it enhance the penetrance of the bar-1(ga80) phenotype (S. PEYROT and D. EISENMANN, unpublished results). Also, while loss of wrm-1 zygotic function does cause a defect in vulval development, the defect is different from that caused by loss of bar-1 function and may be a secondary consequence of defects in somatic gonad development in these animals (S. PEYROT and D. EISENMANN, unpublished results). To date, there is no evidence that either WRM-1 or HMP-2 functions in wild-type vulval development in a manner similar to that of BAR-1. Therefore, although WRM-1 and HMP-2 can provide BAR-1 function in vivo, they may not normally function in such a manner in wild-type animals. Therefore, this result, combined with the different mutant phenotypes of wrm-1, bar-1, and hmp-2 mutants and the distinct protein interactions seen in the yeast two-hybrid analysis, suggests that the three C. elegans retain some functional redundancy despite their sequence divergence but that each protein may predominantly carry out only one of the functions of vertebrate or Drosophila ß-catenin.
| ACKNOWLEDGMENTS |
|---|
We thank Hui Chen, Pradeep Joshi, Anne Kiang, Sara Peyrot, and Irene Su for creation of various plasmids used in this work. We thank the following individuals for providing reagents: Mike Costa and Jim Priess, Alex Hajnal, Mike Herman, Sue Kaech and Stuart Kim, Rueyling Lin, Roel Nusse, Bill Raich and Jeff Hardin, Christian Rochelau, Tae Ho Shin and Craig Mello, and Steve Elledge. We thank Suzanne Barr, Chuck Bieberich, and Phil Farabaugh for critical reading of the manuscript. This work was supported by a March of Dimes Basil O'Connor Starter Scholar Research Award and by National Science Foundation (NSF) Grant IBN-9817123 to D.M.E. N.W. was supported by a NSF REU supplement to that award.
Manuscript received May 1, 2001; Accepted for publication June 25, 2001.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990 Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
ANASTASIADIS, P. Z. and A. B. REYNOLDS, 2000 The p120 catenin family: complex roles in adhesion, signaling and cancer. J. Cell Sci. 113:1319-1334[Abstract].
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. M. MOORE, J. G. SEIDMAN et al., 1987 Current Protocols in Molecular Biology. Wiley & Sons, New York.
BEHRENS, J., J. P. VON KRIES, M. KUHL, L. BRUHN, and D. WEDLICH et al., 1996 Functional interaction of B-catenin with the transcription factor LEF-1. Nature 382:638-642[Medline].
BEN-ZE'EV, A. and B. GEIGER, 1998 Differential molecular interactions of beta-catenin and plakoglobin in adhesion, signaling and cancer. Curr. Opin. Cell Biol. 10:629-639[Medline].
BIERKAMP, C., K. J. MCLAUGHLIN, H. SCHWARZ, O. HUBER, and R. KEMLER, 1996 Embryonic heart and skin defects in mice lacking plakoglobin. Dev. Biol. 180:780-785[Medline].
BRENNER, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77:71-94
BUTZ, S., J. STAPPERT, H. WEISSIG, R. KEMLER, and P. D. MCCREA et al., 1992 Plakoglobin and beta-catenin: distinct but closely related. Science 257:1142-1144
Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2018
CADIGAN, K. M. and R. NUSSE, 1997 Wnt signaling: a common theme in animal development. Genes Dev. 11:3286-3305
COSTA, M., W. RAICH, C. AGBUNAG, B. LEUNG, and J. HARDIN et al., 1998 A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J. Cell Biol. 141:297-308
COWIN, P. and B. BURKE, 1996 Cytoskeleton-membrane interactions. Curr. Opin. Cell Biol. 8:56-65[Medline].
EASTMAN, Q. and R. GROSSCHEDL, 1999 Regulation of LEF-1/TCF transcription factors by Wnt and other signals. Curr. Opin. Cell Biol. 11:233-240[Medline].
EISENMANN, D. M. and S. K. KIM, 2000 Protruding vulva mutants identify novel loci and Wnt signaling factors that function during Caenorhabditis elegans vulva development. Genetics 156:1097-1116
EISENMANN, D. M., J. N. MALOOF, J. S. SIMSKE, C. KENYON, and S. K. KIM, 1998 The beta-catenin homolog BAR-1 and LET-60 Ras coordinately regulate the Hox gene lin-39 during Caenorhabditis elegans vulval development. Development 125:3667-3680[Abstract].
EPSTEIN, H. F., and D. C. SHAKES, 1995 Caenorhabditis elegans: Modern Biological Analysis of an Organism. Academic Press, San Diego.
FIELDS, S. and O. SONG, 1989 A novel genetic system to detect protein-protein interactions. Nature 340:245-246[Medline].
GREENWALD, I., 1997 Development of the vulva, pp. 519541 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
GUMBINER, B., 1996 Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84:345-357[Medline].
GUO, B., C. A. STYLES, Q. FENG, and G. R. FINK, 2000 A Saccharomyces gene family involved in invasive growth, cell-cell adhesion, and mating. Proc. Natl. Acad. Sci. USA 97:12158-12163
HAEGEL, H., L. LARUE, M. OHSUGI, L. FEDOROV, and K. HERRENKNECHT et al., 1995 Lack of beta-catenin affects mouse development at gastrulation. Development 121:3529-3537[Abstract].
HARRIS, J., L. HONIGBERG, N. ROBINSON, and C. KENYON, 1996 Neuronal cell migration in C. elegans: regulation of Hox gene expression and cell position. Development 122:3117-3131[Abstract].
HATZFELD, M. and C. NACHTSHEIM, 1996 Cloning and characterization of a new armadillo family member, p0071, associated with the junctional plaque: evidence for a subfamily of closely related proteins. J. Cell Sci. 109:2767-2778[Abstract].
HATZFELD, M., G. I. KRISTJANSSON, U. PLESSMANN, and K. WEBER, 1994 Band 6 protein, a major constituent of desmosomes from stratified epithelia, is a novel member of the armadillo multigene family. J. Cell Sci. 107:2259-2270[Abstract].
HECHT, A., C. M. LITTERST, O. HUBER, and R. KEMLER, 1999 Functional characterization of multiple transactivating elements in beta-catenin, some of which interact with the TATA-binding protein in vitro. J. Biol. Chem. 274:18017-18025
HERMAN, M. A, 2001 C. elegans POP-1/TCF functions in a canonical Wnt pathway that controls cell migration and in a noncanonical Wnt pathway that controls cell polarity. Development 128:581-590[Abstract].
HERMAN, M. A., Q. CH'NG, S. M. HETTENBACH, T. M. RATLIFF, and C. KENYON et al., 1999 EGL-27 is similar to a metastasis-associated factor and controls cell polarity and cell migration in C. elegans. Development 126:1055-1064[Abstract].
HIGGINS, D. G., J. D. THOMPSON, and T. J. GIBSON, 1996 Using CLUSTAL for multiple sequence alignments. Methods Enzymol. 266:383-402[Medline].
HOBMAYER, E., M. HATTA, R. FISCHER, T. FUJISAWA, and T. W. HOLSTEIN et al., 1996 Identification of a Hydra homologue of the beta-catenin/plakoglobin/armadillo gene family. Gene 172:155-159[Medline].
HOIER, E. F., W. A. MOHLER, S. K. KIM, and A. HAJNAL, 2000 The Caenorhabditis elegans APC-related gene apr-1 is required for epithelial cell migration and Hox gene expression. Genes Dev. 14:874-886
HOLLAND, P. W., 1999 The future of evolutionary developmental biology. Nature 402:C41-C44[Medline].
HSU, S. C., J. GALCERAN, and R. GROSSCHEDL, 1998 Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with beta-catenin. Mol. Cell. Biol. 18:4807-4818
JAMES, P., J. HALLADAY, and E. A. CRAIG, 1996 Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425-1436[Abstract].
JIANG, L. I. and P. W. STERNBERG, 1998 Interactions of EGF, Wnt and HOM-C genes specify the P12 neuroectoblast fate in C. elegans. Development 125:2337-2347[Abstract].
JIANG, L. I. and P. W. STERNBERG, 1999 An HMG1-like protein facilitates Wnt signaling in Caenorhabditis elegans. Genes Dev. 13:877-889
JIN, Y., R. HOSKINS, and H. HORVITZ, 1994 Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein. Nature 372:780-783[Medline].
KEMLER, R., 1993 From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet. 9:317-321[Medline].
KNOLL, A. H. and S. B. CARROLL, 1999 Early animal evolution: emerging views from comparative biology and geology. Science 284:2129-2137
KODAMA, S., S. IKEDA, T. ASAHARA, M. KISHIDA, and A. KIKUCHI, 1999 Axin directly interacts with plakoglobin and regulates its stability. J. Biol. Chem. 274:27682-27688
KOLLIGS, F. T., B. KOLLIGS, K. M. HAJRA, G. HU, and M. TANI et al., 2000 Gamma-catenin is regulated by the APC tumor suppressor and its oncogenic activity is distinct from that of beta-catenin. Genes Dev. 14:1319-1331
KORSWAGEN, H. C., M. A. HERMAN, and H. C. CLEVERS, 2000 Distinct beta-catenins mediate adhesion and signalling functions in C. elegans. Nature 406:527-532[Medline].
LIN, R., S. THOMPSON, and J. R. PRIESS, 1995 pop-1 encodes an HMG box protein required for the specification of a mesoderm precursor in early C. elegans embryos. Cell 83:599-609[Medline].
MALOOF, J. N., J. WHANGBO, J. M. HARRIS, G. D. JONGEWARD, and C. KENYON, 1999 A Wnt signaling pathway controls hox gene expression and neuroblast migration in C. elegans. Development 126:37-49[Abstract].
MANIATIS, T., 1999 A ubiquitin ligase complex essential for the NF-kappaB, Wnt/Wingless, and Hedgehog signaling pathways. Genes Dev. 13:505-510
MENEGHINI, M. D., T. ISHITANI, J. C. CARTER, N. HISAMOTO, and J. NINOMIYA-TSUJI et al., 1999 MAP kinase and Wnt pathways converge to downregulate an HMG-domain repressor in Caenorhabditis elegans. Nature 399:793-797[Medline].
MERTENS, C., C. KUHN, and W. W. FRANKE, 1996 Plakophilins 2a and 2b: constitutive proteins of dual location in the karyoplasm and the desmosomal plaque. J. Cell Biol. 135:1009-1025
MILLER, J. R. and R. T. MOON, 1996 Signal transduction through beta-catenin and specification of cell fate during embryogenesis. Genes Dev. 10:2527-2539
MORIN, P. J., A. B. SPARKS, V. KORINEK, N. BARKER, and H. CLEVERS et al., 1997 Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275:1787-1790
NATHKE, I. S., C. L. ADAMS, P. POLAKIS, J. H. SELLIN, and W. J. NELSON, 1996 The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134:165-179
NEVELS, M., H. WOLF, and T. DOBNER, 1999 Quantitation of beta-galactosidase from yeast cells using a chemiluminescent substrate. Biotechniques 26:57-58[Medline].
ORSULIC, S. and M. PEIFER, 1996 An in vivo structure-function study of armadillo, the beta-catenin homologue, reveals both separate and overlapping regions of the protein required for cell adhesion and for wingless signaling. J. Cell Biol. 134:1283-1300
PAI, L., S. ORSULIC, A. BEJSOVEC, and M. PEIFER, 1997 Negative regulation of Armadillo, a Wingless effector in Drosophila. Development 124:2255-2266[Abstract].
PEIFER, M. and E. WIESCHAUS, 1990 The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin. Cell 63:1167-1176[Medline].
PEIFER, M., P. D. MCCREA, K. J. GREEN, E. WIESCHAUS, and B. M. GUMBINER, 1992 The vertebrate adhesive junction proteins beta-catenin and plakoglobin and the Drosophila segment polarity gene armadillo form a multigene family with similar properties. J. Cell Biol. 118:681-691
POLAKIS, P., 2000 Wnt signaling and cancer. Genes Dev. 14:1837-1851
REYNOLDS, A. B., L. HERBERT, J. L. CLEVELAND, S. T. BERG, and J. R. GAUT, 1992 p120, a novel substrate of protein tyrosine kinase receptors and of p60v-src, is related to cadherin-binding factors beta-catenin, plakoglobin and armadillo. Oncogene 7:2439-2445[Medline].
ROCHELEAU, C. E., W. D. DOWNS, R. LIN, C. WITTMANN, and Y. BEI et al., 1997 Wnt signaling and an APC-related gene specify endoderm in early C. elegans embryos. Cell 90:707-716[Medline].
ROCHELEAU, C. E., J. YASUDA, T. H. SHIN, R. LIN, and H. SAWA et al., 1999 WRM-1 activates the LIT-1 protein kinase to transduce anterior/posterior polarity signals in C. elegans. Cell 97:717-726[Medline].
RUBINFELD, B., B. SOUZA, I. ALBERT, O. MULLER, and S. H. CHAMBERLAIN et al., 1993 Association of the APC gene product with beta-catenin. Science 262:1731-1734
RUIZ, P., V. BRINKMANN, B. LEDERMANN, M. BEHREND, and C. GRUND et al., 1996 Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart. J. Cell Biol. 135:215-225
SCHMIDT, A., L. LANGBEIN, S. PRATZEL, M. RODE, and H. R. RACKWITZ et al., 1999 Plakophilin 3a novel cell-type-specific desmosomal plaque protein. Differentiation 64:291-306[Medline].
SHIN, T. H., J. YASUDA, C. E. ROCHELEAU, R. LIN, and M. SOTO et al., 1999 MOM-4, a MAP kinase kinase kinase-related protein, activates WRM-1/LIT-1 kinase to transduce anterior/posterior polarity signals in C. elegans.. Mol. Cell 4:275-280[Medline].
SIMCHA, I., M. SHTUTMAN, D. SALOMON, J. ZHURINSKY, and E. SADOT et al., 1998 Differential nuclear translocation and transactivation potential of beta-catenin and plakoglobin. J. Cell Biol. 141:1433-1448
SIROTKIN, H., H. O'DONNELL, R. DASGUPTA, S. HALFORD, B. ST, and B. STJORE ET AL., 1997 Identification of a new human catenin gene family member (ARVCF) from the region deleted in velo-cardio-facial syndrome. Genomics 41:75-83[Medline].
SOLARI, F., A. BATEMAN, and J. AHRINGER, 1999 The Caenorhabditis elegans genes egl-27 and egr-1 are similar to MTA1, a member of a chromatin regulatory complex, and are redundantly required for embryonic patterning. Development 126:2483-2494[Abstract].
SU, L., B. VOGELSTEIN, and K. W. KINZLER, 1993 Association of the APC tumor suppressor protein with catenins. Science 262:1734-1737
TANAHASHI, H. and T. TABIRA, 1999 Isolation of human delta-catenin and its binding specificity with presenilin 1. Neuroreport 10:563-568[Medline].
THORPE, C. J., A. SCHLESINGER, J. C. CARTER, and B. BOWERMAN, 1997 Wnt signaling polarizes an early C. elegans blastomere to distinguish endoderm from mesoderm. Cell 90:695-705[Medline].
TUCK, S. and I. GREENWALD, 1995 lin-25, a gene required for vulval induction in Caenorhabditis elegans. Genes Dev. 9:341-357
VAN DE WETERING, M., R. CAVALLO, D. DOOIJES, M. VAN BEEST, and J. VAN ES et al., 1997 Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88:789-799[Medline].
VON KRIES, J. P., G. WINBECK, C. ASBRAND, T. SCHWARZ-ROMOND, and N. SOCHNIKOVA et al., 2000 Hot spots in beta-catenin for interactions with LEF-1, conductin and APC. Nat. Struct. Biol. 7:800-807[Medline].
WHITE, P., H. ABERLE, and J. P. VINCENT, 1998 Signaling and adhesion activities of mammalian beta-catenin and plakoglobin in Drosophila. J. Cell Biol. 140:183-195
WILLERT, K. and R. NUSSE, 1998 Beta-catenin: a key mediator of Wnt signaling. Curr. Opin. Genet. Dev. 8:95-102[Medline].
YAP, A. S., W. M. BRIEHER, and B. M. GUMBINER, 1997 Molecular and functional analysis of cadherin-based adherens junctions. Annu. Rev. Cell Dev. Biol. 13:119-146[Medline].
YOST, C., M. TORRES, J. MILLER, E. HUANG, and D. KIMELMAN et al., 1996 The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev. 10:1443-1454
This article has been cited by other articles:
![]() |
W. Xu and D. Kimelman Mechanistic insights from structural studies of beta-catenin and its binding partners J. Cell Sci., October 1, 2007; 120(19): 3337 - 3344. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Huang, P. Shetty, S. M. Robertson, and R. Lin Binary cell fate specification during C. elegans embryogenesis driven by reiterated reciprocal asymmetry of TCF POP-1 and its coactivator {beta}-catenin SYS-1 Development, July 15, 2007; 134(14): 2685 - 2695. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pettitt, E. A. Cox, I. D. Broadbent, A. Flett, and J. Hardin The Caenorhabditis elegans p120 catenin homologue, JAC-1, modulates cadherin-catenin function during epidermal morphogenesis J. Cell Biol., July 7, 2003; 162(1): 15 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Siegfried and J. Kimble POP-1 controls axis formation during early gonadogenesis in C. elegans Development, March 3, 2003; 129(2): 443 - 453. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishitani, J. Ninomiya-Tsuji, and K. Matsumoto Regulation of Lymphoid Enhancer Factor 1/T-Cell Factor by Mitogen-Activated Protein Kinase-Related Nemo-Like Kinase-Dependent Phosphorylation in Wnt/{beta}-Catenin Signaling Mol. Cell. Biol., February 15, 2003; 23(4): 1379 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Gleason, H. C. Korswagen, and D. M. Eisenmann Activation of Wnt signaling bypasses the requirement for RTK/Ras signaling during C. elegans vulval induction Genes & Dev., May 15, 2002; 16(10): 1281 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Korswagen, D. Y.M. Coudreuse, M. C. Betist, S. van de Water, D. Zivkovic, and H. C. Clevers The Axin-like protein PRY-1 is a negative regulator of a canonical Wnt pathway in C. elegans Genes & Dev., May 15, 2002; 16(10): 1291 - 1302. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Natarajan, L.
- Articles by Eisenmann, D. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Natarajan, L.
- Articles by Eisenmann, D. M.









