Genetics, Vol. 159, 133-145, September 2001, Copyright © 2001

Genetic Analysis of Endocytosis in Caenorhabditis elegans: Coelomocyte Uptake Defective Mutants

Hanna Faresa,b and Iva Greenwalda
a Department of Biochemistry and Molecular Biophysics, Howard Hughes Medical Institute, Columbia University College of Physicians and Surgeons, New York, New York 10032
b Department of Molecular and Cellular Biology, University of Arizona, Tucson, Arizona 85721

Corresponding author: Hanna Fares, University of Arizona, Department of Molecular and Cellular Biology, Life Sciences South Bldg., Rm. 531, 1007 E. Lowell St., Tucson, AZ 85721., fares{at}email.arizona.edu (E-mail)

Communicating editor: B. J. MEYER


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The coelomocytes of Caenorhabditis elegans are scavenger cells that continuously and nonspecifically endocytose fluid from the pseudocoelom (body cavity). Green fluorescent protein (GFP) secreted into the pseudocoelom from body wall muscle cells is endocytosed and degraded by coelomocytes. We show that toxin-mediated ablation of coelomocytes results in viable animals that fail to endocytose pseudocoelomic GFP, indicating that endocytosis by coelomocytes is not essential for growth or survival of C. elegans under normal laboratory conditions. We examined known viable endocytosis mutants, and performed RNAi for other known endocytosis genes, for coelomocyte uptake defective (Cup) phenotypes. We also screened for new genes involved in endocytosis by isolating viable mutants with Cup defects; this screen identified 14 different genes, many with multiple alleles. A variety of Cup terminal phenotypes were observed, consistent with defects at various steps in the endocytic pathway. Available molecular information indicates that the Cup mutant screen has identified novel components of the endocytosis machinery that are conserved in mammals but not in Saccharomyces cerevisiae, the only other organism for which large-scale genetic screens for endocytosis mutants have been performed.


ENDOCYTOSIS is a basic function of eukaryotic cells that leads to the internalization of fluid from the extracellular medium, nutrient uptake, and the recycling of membrane components. In multicellular organisms, endocytosis has also been adapted by specialized cells for specific functions, including the downregulation of signaling, synaptic vesicle recycling, and antigen presentation. There are various routes by which endocytosis is accomplished, involving different cellular structures: clathrin-coated pits, non-clathrin-coated pits, caveolae, and macropinosomes (WATTS and MARSH 1992 Down; ROBINSON et al. 1996 Down; MUKHERJEE et al. 1997 Down). The particular mechanism used to regulate these pathways depends on the ligand being internalized and the cell type examined. The multiplicity of options adds complexities that suggest that endocytosis should be studied using several different approaches and experimental systems.

Many of the steps in endocytosis have been determined through studies on mammalian tissue culture cells that are technically suited for this kind of analysis (WATTS and MARSH 1992 Down; ROBINSON et al. 1996 Down; MUKHERJEE et al. 1997 Down). In brief, a vesicle containing the internalized medium buds from the membrane. The internalized substances then are sorted as they traverse a series of membranous compartments, called endosomes, before either reaching the lysosomes to be degraded or getting recycled to the surface. Many different protein components of these vesicles have been identified through biochemical methods using mammalian cell culture systems.

Genetic analysis has also been an important tool for dissecting endocytosis. The most extensive and informative screens have been done in the yeast Saccharomyces cerevisiae (RIEZMAN 1985 Down; CHVATCHKO et al. 1986 Down; MUNN and RIEZMAN 1994 Down; WENDLAND et al. 1996 Down; ZHENG et al. 1998 Down). For example, numerous insights into the machinery involved in the trafficking of molecules between the Golgi compartment, endosomes, and the vacuole (yeast lysosome) have emerged from such investigations (LEMMON and TRAUB 2000 Down). In particular, these studies have been crucial in elucidating protein complexes involved in the retrograde transport of molecules to the Golgi compartment.

Multicellular organisms utilize endocytosis in many more contexts than do unicellular organisms, raising the possibility that they exhibit differences in regulating endocytosis. One such difference between yeast cells and mammalian cells, for example, is that the adaptor complexes are not needed for clathrin function or for endocytosis in yeast (HUANG et al. 1999 Down; YEUNG et al. 1999 Down). Although screens for mutants defective in endocytosis have been carried out in mammalian cells (ROBBINS et al. 1983 Down; KRIEGER 1986 Down; COLBAUGH et al. 1988 Down; HOBBIE et al. 1994 Down) and in Dictyostelium discoideum (BACON et al. 1994 Down), the only concerted effort to screen for endocytosis mutants in a multicellular organism has been the study of the receptor-mediated endocytosis of yolk in Caenorhabditis elegans oocytes (GRANT and HIRSH 1999 Down). C. elegans is particularly suited to large-scale genetic screens, and many genes that are conserved in worms and humans are not found in yeast (LANDER et al. 2001 Down; VENTER et al. 2001 Down). Indeed, the molecular analysis of C. elegans endocytosis mutants so far has demonstrated that novel components involved in endocytosis unique to multicellular organisms can be identified using genetic analysis in C. elegans (see DISCUSSION).

Here, we report an approach to studying endocytic pathways in C. elegans, using an assay based on the uptake of fluid-phase markers from the pseudocoelom by coelomocytes. We show that in this coelomocyte uptake (Cup) assay many different fluid-phase markers can be endocytosed by coelomocytes. We describe the behavior of known endocytosis mutants and RNA-mediated interference (RNAi) for known endocytosis genes using the Cup assay and the results of a screen for viable cup mutants. This work establishes the Cup assay as a powerful genetic screen for endocytosis mutants in a multicellular organism.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

C. elegans methods and strains:
General methods for the handling and maintenance of C. elegans are as described previously (BRENNER 1974 Down). The wild-type parent for all strains was C. elegans var. Bristol (BRENNER 1974 Down), except for sequence- tagged site (STS) mapping that used var. Bergerac strain DP13 (WILLIAMS et al. 1992 Down). Standard methods were used for genetic analysis (BRENNER 1974 Down), DNA microinjection (FIRE 1986 Down; MELLO et al. 1991 Down), and double-stranded RNA synthesis and microinjection (FIRE et al. 1998 Down).

Plasmid construction:
pJF25 [pmyo-3::ssGFP] (FARES and GREENWALD 2001 Down) has DNA encoding the first 79 amino acids from SEL-1 (GRANT and GREENWALD 1997 Down), including a signal sequence, fused to green fluorescent protein (GFP; CHALFIE et al. 1994 Down), with the S65T substitution, and under the control of the myo-3 promoter.

pJF43 [phsp::ssGFP] (FARES and GREENWALD 2001 Down) has DNA encoding the SEL-1 (GRANT and GREENWALD 1997 Down) signal sequence-GFP fusion under the control of the hsp16-41 (JONES et al. 1986 Down) heat-shock promoter.

To make a construct expressing the Diphtheria toxin A fragment (catalytic) specifically in coelomocytes, we used plasmid pcc1 (P. SENGUPTA, personal communication), which was made by subcloning a 3993-bp fragment, now known to be the upstream region of unc-122 (P. LORIA and O. HOBERT, personal communication), into plasmid pPD95.77 (A. FIRE, personal communication). pcc1 therefore has a GFP coding sequence with unc-122 5' sequences upstream and unc-54 3'-untranslated sequences downstream. When transformed into worms, GFP is almost exclusively seen in coelomocytes, albeit in a few worms, one or more coelomocytes are not fluorescent or are more weakly fluorescent. In addition, very occasional weak expression is also seen in certain neurons.

We used the polymerase chain reaction (PCR) to amplify a 0.6-kb fragment from plasmid pDT-AK51E (DELANGE et al. 1979 Down) using the primers J197 (CACACAGGATCCAAAATGGGCGCTGATGATGTTGTTGATTC; BamHI site is underlined) and J198 (CACACAGAATTCTCATTAACGATTTCCTGCACAGGC; EcoRI site is underlined). The amplified PCR fragment was restriction digested with BamHI and EcoRI and subcloned into the same sites in pcc1. The resulting plasmid, pJF142, has the Diptheria toxin A fragment bearing a K51E substitution replacing GFP in plasmid pcc1. The Diptheria toxin A fragment bearing a K51E substitution has 10% of the activity of the wild-type protein (DELANGE et al. 1979 Down).

Transgenes and strains:
Extrachromosomal arrays were generated by coinjecting plasmid DNA at 1–50 µg/ml along with the marker plasmids pRF4 [rol-6(su1006)] (MELLO et al. 1991 Down) or pMH86 [dpy-20(+)] (HAN and STERNBERG 1991 Down) into the germline and were integrated by irradiation using standard methods (MELLO and FIRE 1995 Down).

arIs37[pmyo-3::ssGFP] (FARES and GREENWALD 2001 Down) was made by integrating an extrachromosomal array that was made by injecting a DNA mix containing pJF25 [pmyo-3::ssGFP] (62.5 µg/ml) + pMH86 (20 µg/ml) + pBluescript SK+ (100 µg/ml; Stratagene, La Jolla, CA) in a dpy-20(e1282) (HOSONO et al. 1982 Down) background. The isolated integrant was backcrossed eight times to dpy-20(e1282) prior to use. We checked 107 Unc F1 progeny segregating from dpy-20(e1282); arIs37[pmyo-3::ssGFP]/unc-54(e190) hermaphrodites: all were Dpy, suggesting that arIs37[pmyo-3::ssGFP] maps close to unc-54(e190) on chromosome I. However, we were eventually able to construct an unc-54(e190) arIs37[pmyo-3::ssGFP] strain.

arIs36[phsp::ssGFP] (FARES and GREENWALD 2001 Down) was made by integrating an extrachromosomal array that was made by injecting a DNA mix containing pJF43 [phsp::ssGFP] (20 µg/ml) + pMH86 (25 µg/ml) + pBluescript SK+ (100 µg/ml) in a dpy-20(e1282) background. The integrant was backcrossed twice to dpy-20(e1282) prior to use.

arEx218[pcc1::DT-AK51E] was made by injecting a DNA mix containing pJF142 [pcc1::DT-AK51E] (10 µg/ml) + pRF4 (100 µg/ml) into dpy-20(e1282); arIs37[pmyo-3::ssGFP] hermaphrodites.

All other genetic markers used in this article can be found referenced in the C. elegans II book by RIDDLE et al. 1997 Down, except for eat-20(nc4) (SHIBATA et al. 2000 Down), nrf-4(sa528), nrf-5(sa513), and nrf-6(sa525) (CHOY and THOMAS 1999 Down), and spg-(e2335) (L. AVERY, personal communication).

Molecular analysis:
Standard methods were used for the manipulation of recombinant DNA (SAMBROOK et al. 1989 Down). All enzymes were from New England Biolabs (Beverly, MA), unless otherwise indicated. PCR was done using the Expand Long Template PCR system (Boehringer Mannheim, Mannheim, Germany) according to the manufacturer's instructions.

Mutant screen and mapping:
Adult dpy-20(e1282); arIs37 [pmyo-3::ssGFP] hermaphrodites were mutagenized using ethyl methanesulfonate (EMS) as previously described (BRENNER 1974 Down). Five mutagenized parents were placed on a single nematode growth media (NGM; BRENNER 1974 Down) plate that had been previously seeded with Escherichia coli OP50 (BRENNER 1974 Down). The F2 hermaphrodites from each plate were screened for a defect in endocytosis by coelomocytes (evidenced by a change in the amount of GFP in the pseudocoelom and/or coelomocytes) using a modified dissection microscope equipped with fluorescence optics (Zeis, Thornwood, NY). Mutant F2 worms were picked onto individual fresh NGM plates (with OP50).

We mutagenized 720 P0 hermaphrodites and checked the progeny from ~18,000 F1 hermaphrodites. We picked 175 adult F2 mutant hermaphrodites (not independent isolates) of which 97 did not give viable progeny. To ensure independent isolation of mutants, we chose only one mutant from each plate, except for two cases in which the mutant phenotypes were distinguishably different; in both cases, the two mutants picked from the same plate had mutations that mapped to different locations (see below). We also saw many F2 hermaphrodites that had strong accumulations of GFP in the pseudocoelom but that were arrested at earlier larval stages; these were neither counted nor picked to separate plates. Finally, we kept 55 viable mutant hermaphrodites for further analysis.

We first backcrossed the 55 mutant hermaphrodites three times to dpy-20(e1282); arIs37[pmyo-3::ssGFP] males. We then mapped the backcrossed mutations to a region of the genome using STS mapping, as previously described (WILLIAMS et al. 1992 Down). Individual cup mutations were tested by complementation analysis for the Cup phenotype against all cup and rme mutations that mapped to the same region and against some other mutations (see below) in the same region. We thus determined that the 55 mutations defined 14 genes. Three of these, rme-1, rme-6, and rme-8, were previously identified as mutants defective in yolk uptake by oocytes (GRANT and HIRSH 1999 Down). We named the rest cup-1 through cup-11 (cup is the coelomocyte uptake defect); these were mapped further using conventional markers.

cup-1 I: We isolated 48 recombinants from unc-101(m1) glp-4(bn2) arIs37[pmyo-3::ssGFP]/cup-1(ar478) arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 48 Unc non-Glp recombinants, 31 picked up cup-1(ar478). cup-1(ar478) complemented nrf-4(sa528).

cup-2 I: We isolated 55 recombinants from dpy-24(s71) unc-101(m1) arIs37[pmyo-3::ssGFP]/cup-2(ar506) arIs37[pmyo-3::ssGFP] hermaphrodites. None of the 23 Dpy non-Unc recombinants picked up cup-2(ar506). All of the 32 Unc non-Dpy recombinants picked up cup-2(ar506). We also isolated 36 recombinants from unc-13(e51) dpy-24(s71) arIs37[pmyo-3::ssGFP]/cup-2(ar506) arIs37[pmyo-3::ssGFP] hermaphrodites. None of the 36 Dpy non-Unc recombinants picked up cup-2(ar506). Thus, cup-2(ar506) maps close to dpy-24(s71). cup-2(ar506) complemented nrf-4(sa528) and dyf-5(mn400).

cup-3 II: We isolated 38 recombinants from dpy-10(e128) unc-4(e120)/cup-3(ar496); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 15 Dpy non-Unc recombinants, 5 picked up cup-3(ar496). Of the 23 Unc non-Dpy recombinants, 10 picked up cup-3(ar496). cup-3(ar496) complemented nrf-6(sa525) and dyf-13(mn396).

cup-4 III: We isolated 10 recombinants from sma-3(e491) unc-36(e251)/cup-4(ar494); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 6 Sma non-Unc recombinants, 4 picked up cup-4(ar494). Of the 4 Unc non-Sma recombinants, 1 picked up cup-4(ar494).

cup-5 III: We isolated 18 recombinants from sma-3(e491) unc-36(e251)/cup-5(ar465); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 10 Sma non-Unc recombinants, 5 picked up cup-5 (ar465). Of the 8 Unc non-Sma recombinants, 5 picked up cup-5(ar465).

cup-6 III: We isolated 23 recombinants from unc-25(e156) bli-5(e518)/cup-6(ar513); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 20 Unc non-Bli recombinants, 19 picked up cup-6 (ar513). None of the 3 Bli non-Unc recombinants picked up cup-6(ar513). We also isolated 71 recombinants from dpy-18 (e364) unc-64(e246)/cup-6(ar513); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 36 Dpy non-Unc recombinants, 35 picked up cup-6(ar513). None of the 35 Unc non-Dpy recombinants picked up cup-6(ar513). Thus, while cup-6 maps to the extreme right arm of chromosome III, due to the single recombinant from each mapping cross, we cannot confirm its exact location relative to the markers used. cup-6(ar513) complemented dyf-2(m160).

cup-7 IV: We isolated 15 recombinants from lin-1(e1275) unc-33(e204)/cup-7(ar492); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 15 Lin non-Unc recombinants, 6 picked up cup-7 (ar492). cup-7(ar492) complemented unc-17(e245), dpy-13(e184), dpy-9(e2), ced-2(e1752), unc-33(e204), cha-1(p1152), eat-7(ad450), eat-10(ad606), and dyf-3(m185).

cup-8 V: We isolated three recombinants from unc-34(e566) unc-60(e677) dpy-11(e224)/cup-8(ar466); arIs37[pmyo-3::ssGFP] hermaphrodites. All three Unc-34 non-Unc-60 recombinants picked up cup-8(ar466). We then picked 252 F1 Unc-34 hermaphrodites from unc-34(e566) cup-8(ar466)/unc-60(e723); arIs37[pmyo-3::ssGFP] hermaphrodites. Four of these were recombinants between unc-34(e566) and unc-60(e723). Two of these recombinants also picked up cup-8(ar466). cup-8(ar466) complemented nrf-5(sa513).

cup-9 V: We isolated 22 recombinants from sma-1(e30) unc-39(e257)/cup-9(ar467); arIs37[pmyo-3::ssGFP] hermaphrodites. Of the 14 Sma non-Unc recombinants, 6 picked up cup-9 (ar467). Of the 8 Unc non-Sma recombinants, 5 picked up cup-9(ar467). cup-9(ar467) complemented nrf-5(sa513) and dyf-4(m158).

cup-10 V: We isolated 47 Dpy non-Lag recombinants from lag-2(q420) dpy-11(e224)/cup-10(ar479); arIs37[pmyo-3::ssGFP] hermaphrodites: 4 picked up cup-10(ar479). We tested whether cup-10(ar479) could complement deletions in that region (D. BAILLIE, personal communication). cup-10(ar479) did not complement the deficiencies sDf26, sDf28, sDf42, and sDf50. cup-10(ar479) did complement sDf31, sDf32, sDf45, and sDf46. cup-10(ar479) complemented nrf-5(sa513).

cup-11 X: We isolated 15 Unc non-Mup recombinants from mup-2(e2346) unc-6(e78)/cup-11(ar472); arIs37[pmyo-3::ssGFP] hermaphrodites: 9 picked up cup-11(ar472). cup-11(ar472) complemented dyn-1(ky51ts).

Phenotypic analysis of mutants:
To check for defects in yolk uptake by the oocytes, the backcrossed mutant strains and their unmutagenized parent strain were grown on NGM (+OP50) plates at 20° and gravid adult hermaphrodites were checked by Nomarski microscopy for the accumulation of lipid droplets in the pseudocoelom. This test may not be sensitive enough to score mutants that have only a mild defect in oocyte uptake.

To check for defects in the uptake of substances by intestinal cells from the lumen of the gut, we placed three L4 of the backcrossed mutant strains and their wild-type parent on individual NGM (+OP50; no cholesterol) plates at 20°; these NGM plates did not have any added cholesterol and also contained rhodamine-conjugated dextran (Mr 11,000) added at 0.1 mg/ml. Adult F1 hermaphrodites were visually checked by fluorescence microscopy for the uptake of the rhodamine-conjugated dextran by the intestinal cells. The two mutants that did show a defect were retested on regular NGM plates (+OP50) that were not lacking in cholesterol but still had the rhodamine-conjugated dextran.

Injections into the pseudocoelom:
Substances were injected into the pseudocoelom of 7–10 adult dpy-20(e1282); arIs37[pmyo-3:ssGFP] hermaphrodites and kept at 20° on NGM (+OP50) plates. The injected worms were then checked at various times up to 24 hr.

Chemicals:
All chemicals used in this research were purchased from Sigma (St. Louis), except for Lucifer Yellow, Bodipy-conjugated cholesterol, and Transferrin Red, which were purchased from Molecular Probes (Eugene, OR).

Heat-shock experiment:
Hermaphrodites grown at 20° were synchronized by collecting the eggs after bleaching and allowing them to hatch on NGM plates. The starved L1 larvae were put on NGM (+OP50) plates and incubated at 20° for 2 more days until the worms were at the L4 stage. The L4 larvae were then heat-shocked at 33° for 30 min before being returned to 20° and checked at different times.

Microscopy:
Worms were mounted on a 2% agarose pad in 3.5 µl of 1% formaldehyde. Compound microscope images were taken on a Zeiss (Thornwood, NY) Axioplan.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Coelomocytes endocytose fluid from the pseudocoelom:
There are six coelomocytes in the pseudocoelom of adult hermaphrodites; four are present at hatching, and two are generated in the first larval stage (CHITWOOD and CHITWOOD 1974 Down). The coelomocytes are full of membrane-bound compartments of different sizes that can be visualized in the light microscope (Fig 1D). By electron microscopy, the membranes of the coelomocytes appear to have multiple invaginations indicating that they are actively internalizing fluid from the pseudocoelom (WHITE 1988 Down; D. HALL, personal communication). Indeed, GFP secreted into the pseudocoelom from many tissues is taken up predominantly by coelomocytes (FITZGERALD and GREENWALD 1995 Down; GRANT and GREENWALD 1997 Down; FARES and GREENWALD 2001 Down; A. FIRE, personal communication). We made transgenic worms in which GFP is secreted into the pseudocoelom when it is attached to a signal sequence and expressed in body wall muscles. The GFP is endocytosed and subsequently degraded, primarily by the coelomocytes. Such arIs37[pmyo-3::ssGFP] worms (MATERIALS AND METHODS) display diffuse fluorescence in the pseudocoelom and bright fluorescent vesicles in coelomocytes (Fig 1, A–D).



View larger version (64K):
In this window
In a new window
Download PPT slide
 
Figure 1. Coelomocyte uptake of substances introduced into the pseudocoelom. Schematic drawing (A), epifluorescence (B and C), and Nomarski (D) micrographs of a dpy-20(e1282); arIs37[pmyo-3::ssGFP] hermaphrodite. (E and F) Epifluorescence micrographs of a coelomocyte from an N2 hermaphrodite injected with FITC-conjugated BSA and rhodamine-conjugated dextran (Mr 40,000), respectively. (G) Epifluorescence micrograph of a dpy-20(e1282); arIs37[pmyo-3::ssGFP]; arEx218 [pcc1::DT-AK51E] hermaphrodite in which the coelomocytes have been ablated by expression of Diphtheria toxin. B and G are low magnification images of whole worms (anterior is to the left). Note the presence of some GFP in the pseudocoelom and in the coelomocytes (five are seen) in B and the accumulation of GFP in the pseudocoelom in G. (C and D) Higher magnification fluorescence and Nomarski images of the same coelomocyte, respectively. Arrows indicate the coelomocytes in B and vesicles filled with GFP in C and D. The shading represents GFP in A. B, C, and D have already been published (FARES and GREENWALD 2001 Down). Bar, 3.7 µm in C.

To assay whether there is any specificity in uptake by coelomocytes, we injected various substances into the pseudocoelom. Many different substances proved to be endocytosed efficiently by coelomocytes when injected into the pseudocoelom: india ink (WHITE 1988 Down; J. KIMBLE, personal communication), rhodamine-dextran (Mr 40,000; C. WINTER and D. HIRSH, personal communication), fluorescein isothiocyanate (FITC)-BSA (Mr 71,000), FITC-lipopolysaccharide (LPS) from Salmonella typhimurium, FITC-dextran (Mr 35,600), Transferrin Red (Mr 80,500), FITC (Mr 389.4), and rhodamine (Mr 536.1) (Fig 1E and Fig F; data not shown).

We found two substances that were not efficiently endocytosed [FITC-LPS from E. coli and Lucifer Yellow (Mr 521.56)] and two other substances [Bodipy-cholesterol and FITC-conjugated dextran (Mr 2,000,000)] that appeared to be completely excluded. Three of these substances, FITC-LPS (E. coli), Bodipy-cholesterol, and Lucifer Yellow, may not be available for uptake because they appear to adhere to yolk granules (BOSSINGER and SCHIERENBERG 1996 Down; MATYASH et al. 2001 Down), which are rarely taken up by the coelomocytes (D. HALL, personal communication). However, the failure of FITC-conjugated dextran (Mr 2,000,000) to be taken up by coelomocytes suggests that the coelomocytes nonspecifically endocytose soluble material below a certain size from the pseudocoelom, as FITC-dextran of Mr 35,600 is efficiently endocytosed.

Fate of GFP endocytosed by coelomocytes:
To determine the fate of GFP secreted into the pseudocoelom, we did an in vivo pulse chase using a strain carrying a transgene that expresses ssGFP from a heat-shock promoter (phsp::ssGFP). GFP is not produced at the normal growth temperature of 20°, but a brief heat shock at 33° results in a finite pulse of GFP secreted into the pseudocoelom. The fate of the GFP can then be followed as a function of time by returning the worms to 20° (Fig 2). We found that, after the worms are returned to 20°, we could observe the GFP first appearing in the pseudocoelom, then getting successively less bright in the pseudocoelom and more obvious in vesicles in the coelomocytes, before finally disappearing altogether (Fig 2). This suggests that the GFP is taken up and gets degraded, or is rendered otherwise nonfluorescent, by the coelomocytes.



View larger version (58K):
In this window
In a new window
Download PPT slide
 
Figure 2. Behavior of ssGFP after its expression and secretion by heat shock in dpy-20(e1282); arIs36[phsp::ssGFP] hermaphrodites. Worms were grown at 20° (no heat shock), heat-shocked at 33° for 30 min, and put back at 20° for the indicated times shown above the micrographs. The top row of micrographs is at a higher magnification than those in the bottom row. Arrows indicate coelomocytes.

Toxin-mediated ablation of coelomocytes:
Coelomocytes are difficult to kill by laser ablation: apparently coelomocytes reported (via a personal communication in WHITE 1988 Down) to have been eliminated by laser ablation had actually recovered and retained some function (J. KIMBLE, personal communication). To assess the importance of coelomocyte function, we used a coelomocyte-specific promoter (P. SENGUPTA, personal communication; P. LORIA and O. HOBERT, personal communication) to express a variant diphtheria toxin, DT-AK51E (DELANGE et al. 1979 Down). We verified the absence of the coelomocytes by examining the anatomy of dpy-20; arIs37[pmyo-3::ssGFP]; arEx218[pcc1::DT-AK51E] hermaphrodites and the fate of the secreted GFP (MATERIALS AND METHODS). Most hermaphrodites lacked all six coelomocytes and accumulated GFP in the pseudocoelom (Fig 1G), confirming that GFP in the pseudocoelom is removed primarily by coelomocytes. We did not observe any effect on the viability or motility of this strain and were easily able to maintain the extragenic array for several generations, suggesting there is not a strong selection against it. We conclude that coelomocyte function, and in particular endocytosis by coelomocytes, is not necessary for viability and fertility of worms under normal laboratory conditions.

Involvement of genes known to function in membrane trafficking in endocytosis by coelomocytes:
We tested whether proteins that are thought to function in membrane trafficking in other systems, directly or indirectly, play a major role in endocytosis by coelomocytes. We reduced or eliminated the activity of these genes in the arIs37[pmyo-3::ssGFP] worms, either by using characterized mutant alleles or through the use of RNA-mediated interference (MATERIALS AND METHODS). We assayed the effect on coelomocytes by qualitatively examining the level of GFP in the pseudocoelom and the number and size of vesicles containing GFP in the coelomocytes.

Conventional mutations tested: Because in the arIs37 [pmyo-3::ssGFP] hermaphrodites we could reliably score only older larvae and adults for endocytosis by coelomocytes, we used only mutant alleles that did not result in zygotic lethality. We tested the effect on coelomocyte endocytosis of several genes that are known to affect membrane trafficking (snt-1, unc-26, unc-11, unc-13, unc-64, unc-101, dyn-1, pod-1, unc-104, ced-2, ced-5, nrf-5, nrf-6) and others that might influence the actin cytoskeleton (unc-60, unc-115, cyk-1, mig-2, unc-73; Table 1), as well as various miscellaneous mutations used for strain constructions (Table 1 legend). None of the mutations tested, except for dyn-1(ky51ts) (see below), resulted in a noticeable Cup phenotype. Where null alleles were used, we can conclude that the activity of the gene tested is not required for coelomocyte endocytosis. Where hypomorphic alleles were used, it remains possible that the lack of a Cup phenotype reflects residual gene activity.


 
View this table:
In this window
In a new window

 
Table 1. Alleles tested for effects on coelomocyte endocytosis

dyn-1(ky51ts) is a temperature-sensitive mutation in dynamin, a large GTPase that regulates an early step in endocytosis and is involved in other cellular processes (CLARK et al. 1997 Down). At the permissive temperature, 20°, dpy-20(e1282); dyn-1(ky51ts); arIs37[pmyo-3::ssGFP] worms appear indistinguishable from dpy-20(e1282); arIs37 [pmyo-3::ssGFP] worms. However, dpy-20(e1282); dyn-1 (ky51ts); arIs37[pmyo-3::ssGFP] worms that were shifted to 25° soon start displaying a Cup phenotype, characterized by accumulation of GFP in their pseudocoelom and a greatly reduced number of vesicles in coelomocytes (Fig 3).



View larger version (68K):
In this window
In a new window
Download PPT slide
 
Figure 3. Effect of dyn-1(ky51ts) on coelomocyte endocytosis. All images are of dpy-20(e1282); dyn-1(ky51ts); arIs37[pmyo-3::ssGFP] hermaphrodites grown at 20° (A–C) or shifted for 8 hr to 25° (D–F). (B and C; E and F) Higher magnification fluorescence and Nomarski images of the same coelomocytes, respectively. Arrows indicate coelomocytes (not visible in D due to the decreased uptake of GFP). Note the presence of fewer and smaller vesicles in the coelomocytes shown in E as compared to those shown in B.

RNAi: We tested several genes (Table 2) that encode proteins that are homologous, or have domains homologous, to proteins known to function in membrane trafficking. For rme-1 and cup-5, RNAi was very effective and caused a phenotype that is essentially identical to that seen for null mutations in those genes (see below). vps-34, sec-5, and sec-8 also showed a very strong accumulation of GFP in the pseudocoelom of F1 worms, while the accumulation of GFP in worms injected with vps-54 and clh-15 double-stranded RNA (dsRNA) was much weaker, but noticeably higher than in mock-injected worms.


 
View this table:
In this window
In a new window

 
Table 2. RNA interference test of coelomocyte endocytosis

When Cup RNAi phenotypes were observed, it was only in the F1 progeny of parents that had been injected with double-stranded RNA. The injection method appeared to work best for several genes tested: when we tried soaking worms in double-stranded RNA (TABARA et al. 1998 Down), we saw little or no effect (data not shown). Feeding worms bacteria expressing double-stranded RNA (TIMMONS and FIRE 1998 Down) had a similar effect to RNA injection, but was less efficient (data not shown). We therefore could not use RNAi to assay several genes (e.g., clathrin heavy chain, RAB-5, and RAB-11) that are known to be involved in endocytosis but that resulted in lethality in the F1 progeny of the injected worms and/or in sterility in the injected worms.

Screen for new mutants defective in endocytosis by coelomocytes:
We mutagenized dpy-20(e1282); arIs37[pmyo-3::ssGFP] worms with EMS and identified 55 viable mutants that displayed differences in endocytosis by coelomocytes compared to the parent strain. Of these mutations, 53 are recessive and define 14 complementation groups (Table 3; MATERIALS AND METHODS). We found that 3 of these complementation groups correspond to rme-1 rme-6 and rme-8, genes defined in a screen for receptor-mediated endocytosis of yolk (GRANT and HIRSH 1999 Down). The two dominant mutations identified proved to be dominant-negative alleles of rme-1 (GRANT et al. 2001 Down). On the basis of mapping data, inter se complementation tests, and complementation tests with other selected genes in the same region (see MATERIALS AND METHODS), the remainder of the 11 complementation groups appear to define new genes, which we have named cup.


 
View this table:
In this window
In a new window

 
Table 3. Coelomocyte uptake mutants

The coelomocyte phenotype of cup mutants:
In all the mutants isolated, except cup-5(ar465), the gross phenotype we observed was the accumulation of GFP in the pseudocoelom, suggesting a decrease in, or the absence of, endocytosis in coelomocytes. cup-5(ar465) worms had the opposite phenotype: reduced GFP in the pseudocoelom and greatly intensified GFP accumulation in coelomocytes, suggesting enhanced uptake and decreased degradation of GFP by coelomocytes (FARES and GREENWALD 2001 Down).

We examined more closely the phenotype of the coelomocytes in mutant worms grown at 20° (Fig 4). Interestingly, the coelomocytes exhibit a whole range of phenotypes, suggesting that the endocytic pathway is perturbed at several steps and/or in several ways. We show some examples in Fig 4, including almost no uptake of GFP by coelomocytes in cup-10(ar479) worms (Fig 4B), the accumulation of small peripheral GFP-filled compartments in cup-1(ar478) worms (Fig 4C), the accumulation of several vesicles that are full of GFP (indistinguishable from the wild-type profile at this level of analysis) in cup-11(ar472) worms (Fig 4D), the appearance of large vacuoles with little GFP in cup-8(ar466) worms (Fig 4E), and the accumulation of GFP in large vacuoles in cup-5(ar465) worms (Fig 4F).



View larger version (108K):
In this window
In a new window
Download PPT slide
 
Figure 4. Phenotype of coelomocytes in the various cup mutant hermaphrodites. Shown are the fluorescence (1) and corresponding Nomarski micrographs (2) of wild-type worms (A) and worms carrying the following mutations: (B) cup-10(ar479), (C) cup-1(ar478), (D) cup-11(ar472), (E) cup-8 (ar466), and (F) cup-5(ar465). All worms also were dpy-20 (e1282); arIs37[pmyo-3::ssGFP]. F has already been published (FARES and GREENWALD 2001 Down).

Additional phenotypes:
We checked all of the mutants for phenotypes that might indicate defects in endocytosis by other cell types (Table 3). On the basis of our limited analysis, seven of the complementation groups were deficient only in endocytosis by coelomocytes, and seven also affected endocytosis by other tissues.

Uncoordinated phenotype: An Unc phenotype might be indicative of defects in synaptic vesicle recycling (for example, NONET et al. 1993 Down, NONET et al. 1999 Down; HARRIS et al. 2000 Down). The only cup mutants that display an Unc defect are the two alleles of cup-7, which move very slowly and have a slight tendency to curl. All of the other mutants have normal movement.

Oocyte uptake of yolk: Accumulation of yolk in the pseudocoelom may be visualized as bright birefringence using Nomarski microscopy (KIMBLE and SHARROCK 1983 Down). Using this assay, hermaphrodites bearing cup-1(ar478), cup-3(ar496), cup-6(ar513), or cup-7(ar492) accumulated more yolk granules in the pseudocoelom than the wild-type parent strains.

Intestinal uptake: Rhodamine-dextran (Mr 40,000) present in the growth medium is endocytosed by intestinal cells. We examined the cup mutants for intestinal accumulation of rhodamine-dextran in the presence or absence of cholesterol, a membrane component that must be added to the growth medium for continued growth of C. elegans in culture (BRENNER 1974 Down) and that is required for some endocytic pathways (HOEKSTRA and VAN IJZENDOORN 2000 Down). In the presence of supplemented cholesterol, only rme-8(ar486) was defective for uptake of rhodamine-dextran by intestinal cells. However, in the absence of supplemented cholesterol, both cup-1(ar478) and rme-8(ar486) showed a severe defect in rhodamine-dextran uptake in intestinal cells. The defect appeared to fall in an anterior-posterior gradient, with cells in the posterior half showing almost no uptake of the rhodamine-dextran. This gradient might reflect the concentration of the ingested substance, which may progressively decrease during its passage through the lumen. Thus, in nonmutant worms, endocytosis is efficient enough so that posterior cells may still scavenge detectable rhodamine-dextran from the lumen, whereas in cup-1 and rme-8 mutants, endocytosis is sufficiently impaired that rhodamine-dextran accumulation cannot be seen.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have shown that the coelomocytes continuously and efficiently endocytose fluid from the pseudocoelom and are not essential for the survival of the animal. We used the ability of coelomocytes to endocytose the fluid-phase marker GFP from the pseudocoelom as the basis for identifying mutants defective in endocytosis. A reverse genetic approach, using RNA-mediated interference, established that certain known genes are required for coelomocyte endocytosis and that blocking endocytosis leads to a Cup phenotype. A forward genetic screen for mutants identified 14 cup genes, 11 of which appear to be new. Here, we discuss what we have learned about the process of endocytosis in coelomocytes from our genetic analysis and evaluate the potential of the cup mutant screen for identifying new endocytosis genes.

We found that many soluble compounds injected into the pseudocoelom are taken up by the coelomocytes. The compounds that did not get endocytosed can be divided into two categories. One category comprises compounds that appeared to associate with yolk granules, which appear to be excluded from coelomocytes (D. HALL, personal communication) due to their size, hydrophobicity, or some other, unknown, property. The other category has as yet a single member, FITC-dextran (Mr 2,000,000), which did not appear to associate with yolk granules; because a smaller dextran polymer was very efficiently endocytosed by coelomocytes, size may be an important factor in determining the ability of a compound to be taken up. One reason that size may be important is that there is an electron-dense glycocalyx or basement membrane surrounding each coelomocyte (WHITE 1988 Down; D. HALL, personal communication), which may in effect act as a sieve. Analysis of uptake at the electron microscopic level may help resolve this issue.

The large number of compounds that were efficiently endocytosed raises the question of whether coelomocytes take up material from the pseudocoelom by constitutive pinocytosis and/or by scavenger receptors displaying a broad spectrum of ligand recognition (PEARSON 1996 Down). The results of our genetic analysis in C. elegans so far favor the possibility of a receptor-mediated mechanism.

First, the reduction or elimination of dynamin function led to an endocytosis defect in coelomocytes. Dynamin is known to function in the maturation and/or scission of the clathrin pit (SEVER et al. 2000 Down; HILL et al. 2001 Down) and in endocytosis through caveolae (HENLEY et al. 1998 Down). Clathrin itself is very strongly expressed in coelomocytes (Y. ZHANG and D. HIRSH, personal communication) and numerous coated pits and vesicles are found on the surface of these cells (WHITE 1988 Down). This suggests that clathrin-mediated endocytosis may be the major pathway in coelomocytes. An alternative explanation is that in the coelomocytes of C. elegans, dynamin might also be used in other pathways of endocytosis that do not involve receptors.

Second, rme-1 was identified in our genetic screen for cup mutants. RME-1 has been shown to be involved in membrane (and membrane protein) recycling to the plasma membrane (GRANT et al. 2001 Down; LIN et al. 2001 Down). In rme-1 null mutants, the Cup defect is more visible in older worms, as might be the case if scavenger receptors must be depleted from the plasma membrane before a Cup defect is seen. Alternatively, the Cup defect of rme-1 mutant worms could be due to a general depletion of bulk membrane from the surface or due to some function of RME-1 in these cells other than recycling.

Some genes encoding other proteins with characterized roles in vesicle trafficking were also identified as playing roles in coelomocyte endocytosis by virtue of a Cup phenotype in RNAi experiments. vps-34 encodes phosphoinositide 3-kinase (PI-3 kinase), a protein that regulates multiple steps in endocytosis (BACKER 2000 Down). sec-5 and sec-8 encode homologs of the yeast Sec5p and Sec8p, members of the exocyst complex. S. cerevisiae sec mutants, including sec5 and sec8, which accumulate proteins in secretory vesicles, are all defective in endocytosis (RIEZMAN 1985 Down). Vps54p in S. cerevisaie is involved in vacuolar trafficking (CONBOY and CYERT 2000 Down). clh-15 encodes a chloride channel that in human cells is involved in receptor-mediated endocytosis (WANG et al. 2000 Down); the reduction in endocytosis in clh-15(RNAi) worms is less severe than for other genes that affect endocytosis by coelomocytes, possibly because of the existence of multiple genes that encode chloride channels in C. elegans (NEHRKE et al. 2000 Down).

Many genes, some of which are known to function in membrane trafficking, did not seem to be involved in endocytosis by coelomocytes. For example, null alleles of snt-1 Synaptotagmin, unc-26 Synaptojanin, unc-11 AP180, and unc-101 AP1 perturb membrane trafficking in neurons and other tissues in C. elegans but do not cause a Cup phenotype. While it is possible that some of the genes tested may not be expressed in coelomocytes, it is also possible that they are expressed in coelomocytes but only affect one pathway used by coelomocytes to internalize fluid. Furthermore, several of the genes tested have relatives in the C. elegans genome that may afford functional redundancy.

We screened for and identified mutations involved in the uptake of GFP by coelomocytes and identified alleles of 11 new cup genes and 3 previously identified rme genes. In this initial screen, we selected for homozygous viable and fertile Cup mutants. It is likely, therefore, that we have not identified genes that function in endocytosis and that regulate essential processes, like cell-cell signaling during embryonic development. Indeed, during the course of this screen, we saw some indication that there may be a category of endocytosis mutants that are also associated with zygotic or maternal-effect lethality. For several of the cup genes, we identified only single alleles, so we have not achieved saturation for this screen. Some of the alleles we recovered may prove to be non-null alleles of essential genes.

The cup screen described here and the rme screen described by B. GRANT and D. HIRSH (1999) are both powerful screens for endocytosis mutants and thus far have yielded largely complementary sets of genes. We have tested the available cup genes for yolk accumulation, and B. GRANT and D. HIRSH (personal communication) have tested most of the rme genes for a Cup phenotype. Although neither screen has been conducted to saturation, the data so far suggest that roughly one-third to one-half of the genes affect both yolk uptake by oocytes and pseudocoelomic GFP uptake by coelomocytes.

Both the Rme and the Cup screens have identified genes that play important roles in endocytosis in animal cells that do not appear to have homologs in yeast. As mentioned above, rme-1, which was identified in both the Rme and Cup screens, appears to be involved in membrane (and membrane protein) recycling to the plasma membrane (GRANT et al. 2001 Down; LIN et al. 2001 Down). rme-8, also identified in both the Rme and Cup screens, appears to be involved in endocytic vesicle trafficking (ZHANG et al. 2001 Down). Finally, cup-5, which was identified solely by the Cup screen, encodes the C. elegans homolog of human mucolipin-1 (FARES and GREENWALD 2001 Down). Loss of human mucolipin-1 underlies Mucolipidosis Type IV, a lysosomal storage disease that results in severe developmental neuropathology (BARGAL et al. 2000 Down; BASSI et al. 2000 Down; SUN et al. 2000 Down). As we report elsewhere (FARES and GREENWALD 2001 Down), our analysis has revealed that there are striking parallels between the cellular phenotypes and endocytosis defects of cup-5 mutant C. elegans and cells from patients with Mucolipidosis Type IV. We expect that at least some other cup genes will also prove to be components of the endocytosis machinery that are unique to animal cells.

Finally, what is the function of the coelomocytes of C. elegans? In many invertebrates, coelomocytes/hemocytes mediate the cellular immunity of the organism (PANCER et al. 1999 Down). We have not found evidence that the coelomocytes of C. elegans provide a potent defense against bacterial infection; as few as six bacterial cells (OP50) injected into the pseudocoelom can multiply and kill the worm (H. FARES and I. GREENWALD, unpublished observations). This function for coelomocytes may be better explored by comparing the susceptibility of wild type vs. worms lacking coelomocytes to infection; to date, however, the only microorganism reported to invade the pseudocoelom of worms is the fungus Drechmeria coniospora, which extends its hyphae into the pseudocoelom (JANSSON 1994 Down). However, it may be that in C. elegans, the coelomocyte functions more like a liver. The pseudocoelomic fluid serves as the circulatory system for nutrients that are taken up, ingested, degraded, and secreted into the pseudocoelom by the intestinal cells. It is possible that the coelomocytes reprocess that fluid to detoxify it of harmful ingested substances. In that event, it is likely that the absence of coelomocytes would not be harmful to worms grown under laboratory conditions. It is now possible to test this by comparing the susceptibility of wild type vs. worms lacking coelomocytes to toxic material introduced into the growth medium or secreted by bacterial pathogens (TAN and AUSUBEL 2000 Down). With the availability of worms that lack coelomocytes and worms that are defective in endocytosis by coelomocytes, we are now in a better position to determine the biological function of these cells in C. elegans.


*  ACKNOWLEDGMENTS

We are grateful to David Hirsh for inspiring our interest in coelomocytes, Barth Grant and Yinhua Zhang for helpful reagents and discussions throughout the project, Piali Sengupta for the coelomocyte-specific promoter and Paula Loria and Oliver Hobert for additional information about it, David Hall for communicating unpublished observations, and John Collier for the Diphtheria toxin clones. We also thank Alan Coulson and Yuji Kohara for providing cosmids, strains, and cDNA clones, Richard Ruiz and Ilya Temkin for excellent technical assistance, Barth Grant, Oliver Hobert, and Sophie Jarriault for critical reading of the manuscript, and past and present members of the Greenwald, Hirsh, and Hobert laboratories for helpful discussions. Some strains were provided by the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health National Center for Research Resources (NCRR). I.G. is an Investigator of the Howard Hughes Medical Institute. H.F. was a Postdoctoral Associate of the HHMI and was also supported by an award from the Metropolitan Life Foundation to I.G.

Manuscript received May 1, 2001; Accepted for publication May 25, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AALTO, M. K., L. RUOHONEN, K. HOSONO, and S. KERANEN, 1991  Cloning and sequencing of the yeast Saccharomyces cerevisiae SEC1 gene localized on chromosome IV. Yeast 7:643-650[Medline].

ACHSTETTER, T., A. FRANZUSOFF, C. FIELD, and R. SCHEKMAN, 1988  SEC7 encodes an unusual, high molecular weight protein required for membrane traffic from the yeast Golgi apparatus. J. Biol. Chem. 263:11711-11717[Abstract/Free Full Text].

BACKER, J. M., 2000  Phosphoinositide 3-kinases and the regulation of vesicular trafficking. Mol. Cell. Biol. Res. Commun. 3:193-204[Medline].

BACON, R. A., C. J. COHEN, D. A. LEWIN, and I. MELLMAN, 1994  Dictyostelium discoideum mutants with temperature-sensitive defects in endocytosis. J. Cell Biol. 127:387-399[Abstract/Free Full Text].

BARGAL, R., N. AVIDAN, E. BEN-ASHER, Z. OLENDER, and M. ZEIGLER et al., 2000  Identification of the gene causing Mucolipidosis Type IV. Nat. Genet. 26:118-123[Medline].

BASSI, M. T., M. MANZONI, E. MONTI, M. T. PIZZO, and A. BALLABIO et al., 2000  Cloning of the gene encoding a novel integral membrane protein, mucolipidin—and identification of the two major founder mutations causing Mucolipidosis Type IV. Am. J. Hum. Genet. 67:1110-1120[Medline].

BAUMERT, M., P. R. MAYCOX, F. NAVONE, P. DE CAMILLI, and R. JAHN, 1989  Synaptobrevin: an integral membrane protein of 18,000 daltons present in small synaptic vesicles of rat brain. EMBO J. 8:379-384[Medline].

BECKER, M., M. MATZNER, and G. GERISCH, 1999  Drainin required for membrane fusion of the contractile vacuole in Dictyostelium is the prototype of a protein family also represented in man. EMBO J. 18:3305-3316[Medline].

BOSSINGER, O. and E. SCHIERENBERG, 1996  The use of fluorescent marker dyes for studying intercellular communication in nematode embryos. Int. J. Dev. Biol. 40:431-439[Medline].

BRENNER, S., 1974  The genetics of Caenorhabditis elegans. Genetics 77:71-94[Abstract/Free Full Text].

CHALFIE, M., Y. TU, G. EUSKIRCHEN, W. W. WARD, and D. C. PRASHER, 1994  Green fluorescent protein as a marker for gene expression. Science 263:802-805[Abstract/Free Full Text].

CHAVRIER, P., R. G. PARTON, H. P. HAURI, K. SIMONS, and M. ZERIAL, 1990  Localization of low molecular weight GTP binding proteins to exocytic and endocytic compartments. Cell 62:317-329[Medline].

CHEN, H., S. FRE, V. I. SLEPNEV, M. R. CAPUA, and K. TAKEI et al., 1998  Epsin is an EH-domain-binding protein implicated in clathrin-mediated endocytosis. Nature 394:793-797[Medline].

CHITWOOD, B. G., and M. B. CHITWOOD, 1974 Introduction to Nematology. University Park Press, Baltimore.

CHOY, R. K. and J. H. THOMAS, 1999  Fluoxetine-resistant mutants in C. elegans define a novel family of transmembrane proteins. Mol. Cell 4:143-152[Medline].

CHVATCHKO, Y., I. HOWALD, and H. RIEZMAN, 1986  Two yeast mutants defective in endocytosis are defective in pheromone response. Cell 46:355-364[Medline].

CLARK, S. G., D. L. SHURLAND, E. M. MEYEROWITZ, C. I. BARGMANN, and A. M. VAN DER BLIEK, 1997  A dynamin GTPase mutation causes a rapid and reversible temperature-inducible locomotion defect in C. elegans. Proc. Natl. Acad. Sci. USA 94:10438-10443[Abstract/Free Full Text].

COLBAUGH, P. A., C. Y. KAO, S. P. SHIA, M. STOOKEY, and R. K. DRAPER, 1988  Three new complementation groups of temperature-sensitive Chinese hamster ovary cell mutants defective in the endocytic pathway. Somat. Cell Mol. Genet. 14:499-507[Medline].

CONBOY, M. J. and M. S. CYERT, 2000  Luv1p/Rki1p/Tcs3p/Vps54p, a yeast protein that localizes to the late Golgi and early endosome, is required for normal vacuolar morphology. Mol. Biol. Cell 11:2429-2443[Abstract/Free Full Text].

CREUTZ, C. E. and J. R. HARRISON, 1984  Clathrin light chains and secretory vesicle binding proteins are distinct. Nature 308:208-210[Medline].

CREUTZ, C. E., J. L. TOMSIG, S. L. SNYDER, M. C. GAUTIER, and F. SKOURI et al., 1998  The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J. Biol. Chem. 273:1393-1402[Abstract/Free Full Text].

DELANGE, R. J., L. C. WILLIAMS, R. E. DRAZIN, and R. J. COLLIER, 1979  The amino acid sequence of fragment A, an enzymically active fragment of diphtheria toxin. III. The chymotryptic peptides, the peptides derived by cleavage at tryptophan residues, and the complete sequence of the protein. J. Biol. Chem. 254:5838-5842[Abstract/Free Full Text].

FARES, H. and I. GREENWALD, 2001  Regulation of endocytosis by CUP-5, the Caenorhabditis elegans mucolipin-1 homologue. Nat. Genet. 28:64-68[Medline].

FIRE, A., 1986  Integrative transformation of Caenorhabditis elegans. EMBO J. 5:2673-2680[Medline].

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, and S. E. DRIVER et al., 1998  Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811[Medline].

FITZGERALD, K. and I. GREENWALD, 1995  Interchangeability of Caenorhabditis elegans DSL proteins and intrinsic signalling activity of their extracellular domains in vivo. Development 121:4275-4282[Abstract].

GRANT, B. and I. GREENWALD, 1997  Structure, function, and expression of SEL-1, a negative regulator of LIN-12 and GLP-1 in C. elegans. Development 124:637-644[Abstract].

GRANT, B. and D. HIRSH, 1999  Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol. Biol. Cell 10:4311-4326[Abstract/Free Full Text].

GRANT, B., Y. ZHANG, M.-C. PAUPARD, S. X. LIN, and D. H. HALL et al., 2001  Evidence that RME-1, a conserved C. elegans EH domain protein, functions in endocytic recycling. Nat. Cell Biol. 3:573-579[Medline].

HAN, M. and P. W. STERNBERG, 1991  Analysis of dominant-negative mutations of the Caenorhabditis elegans let-60 ras gene. Genes Dev. 5:2188-2198[Abstract/Free Full Text].

HARRIS, T. W., E. HARTWIEG, H. R. HORVITZ, and E. M. JORGENSEN, 2000  Mutations in synaptojanin disrupt synaptic vesicle recycling. J. Cell Biol. 150:589-600[Abstract/Free Full Text].

HENLEY, J. R., E. W. KRUEGER, B. J. OSWALD, and M. A. MCNIVEN, 1998  Dynamin-mediated internalization of caveolae. J. Cell Biol. 141:85-99[Abstract/Free Full Text].

HILL, E., J. VAND DER KAAY, C. P. DOWNES, and E. SMYTHE, 2001  The role of dynamin and its binding partners in coated pit invagination and scission. J. Cell Biol. 152:309-323[Abstract/Free Full Text].

HOBBIE, L., A. S. FISHER, S. LEE, A. FLINT, and M. KRIEGER, 1994  Isolation of three classes of conditional lethal Chinese hamster ovary cell mutants with temperature-dependent defects in low density lipoprotein receptor stability and intracellular membrane transport. J. Biol. Chem. 269:20958-20970[Abstract/Free Full Text].

HOEKSTRA, D. and S. C. VAN IJZENDOORN, 2000  Lipid trafficking and sorting: how cholesterol is filling gaps. Curr. Opin. Cell Biol. 12:496-502[Medline].

HOSONO, R., K. HIRAHARA, S. KUNO, and T. KURIHARA, 1982  Mutants of Caenorhabditis elegans with dumpy and rounded head phenotype. J. Exp. Zool. 235:409-421.

HUANG, K. M., K. D'HONDT, H. RIEZMAN, and S. K. LEMMON, 1999  Clathrin functions in the absence of heterotetrameric adaptors and AP180-related proteins in yeast. EMBO J. 18:3897-3908[Medline].

JANSSON, H.-B., 1994  Adhesion of conidia of Drechmeria coniospora to Caenorhabditis elegans wild type and mutants. J. Nematol. 26:430-435[Medline].

JANTSCH-PLUNGER, V. and M. GLOTZER, 1999  Depletion of syntaxins in the early Caenorhabditis elegans embryo reveals a role for membrane fusion events in cytokinesis. Curr. Biol. 9:738-745[Medline].

JONES, D., R. H. RUSSNAK, R. J. KAY, and E. P. CANDIDO, 1986  Structure, expression, and evolution of a heat shock gene locus in Caenorhabditis elegans that is flanked by repetitive elements. J. Biol. Chem. 261:12006-12015[Abstract/Free Full Text].

KIMBLE, J. and W. J. SHARROCK, 1983  Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev. Biol. 96:189-196[Medline].

KONZOK, A., I. WEBER, E. SIMMETH, U. HACKER, and M. MANIAK et al., 1999  DAip1, a Dictyostelium homologue of the yeast actin-interacting protein 1, is involved in endocytosis, cytokinesis, and motility. J. Cell Biol. 146:453-464[Abstract/Free Full Text].

KOSTICH, M., A. FIRE, and D. M. FAMBROUGH, 2000  Identification and molecular-genetic characterization of a LAMP/CD68-like protein from Caenorhabditis elegans. J. Cell Sci. 113:2595-2606[Abstract].

KRIEGER, M., 1986  Isolation of somatic cell mutants with defects in the endocytosis of low-density lipoprotein. Methods Enzymol. 129:227-237[Medline].

LANDER, E. S., L. M. LINTON, B. BIRREN, C. NUSBAUM, and M. C. ZODY et al., 2001  Initial sequencing and analysis of the human genome. Nature 409:860-921[Medline].

LEE, J., G. D. JONGEWARD, and P. W. STERNBERG, 1994  unc-101, a gene required for many aspects of Caenorhabditis elegans development and behavior, encodes a clathrin-associated protein. Genes Dev. 8:60-73[Abstract/Free Full Text].

LEMMON, S. K. and L. M. TRAUB, 2000  Sorting in the endosomal system in yeast and animal cells. Curr. Opin. Cell Biol. 12:457-466[Medline].

LICHTE, B., R. W. VEH, H. E. MEYER, and M. W. KILIMANN, 1992  Amphiphysin, a novel protein associated with synaptic vesicles. EMBO J. 11:2521-2530[Medline].

LIN, S. X., B. GRANT, D. HIRSH, and F. R. MAXFIELD, 2001  Rme-1 regulates the distribution and function of the endocytic recycling compartment in mammalian cells. Nat. Cell Biol. 3:567-572[Medline].

LUNDQUIST, E. A., R. K. HERMAN, J. E. SHAW, and C. I. BARGMANN, 1998  UNC-115, a conserved protein with predicted LIM and actin-binding domains, mediates axon guidance in C. elegans. Neuron 21:385-392[Medline].

MANIAK, M., R. RAUCHENBERGER, R. ALBRECHT, J. MURPHY, and G. GERISCH, 1995  Coronin involved in phagocytosis: dynamics of particle-induced relocalization visualized by a green fluorescent protein tag. Cell 83:915-924[Medline].

MATYASH, V., C. GEIER, A. HENSKE, B. GREGAN, and S. MUKHERJEE et al., 2001  Distribution and transport of cholesterol in Caenorhabditis elegans. Mol. Biol. Cell 12:1725-1736[Abstract/Free Full Text].

MCKIM, K. S., C. MATHESON, M. A. MARRA, M. F. WAKARCHUK, and D. L. BAILLIE, 1994  The Caenorhabditis elegans unc-60 gene encodes proteins homologous to a family of actin-binding proteins. Mol. Gen. Genet. 242:346-357[Medline].

MELLO, C. and A. FIRE, 1995  DNA transformation. Methods Cell Biol. 48:451-482[Medline].

MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991  Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970[Medline].

MUKHERJEE, S., R. N. GHOSH, and F. R. MAXFIELD, 1997  Endocytosis. Physiol. Rev. 77:759-803[Abstract/Free Full Text].

MUNN, A. L. and H. RIEZMAN, 1994  Endocytosis is required for the growth of vacuolar H(+)-ATPase-defective yeast: identification of six new END genes. J. Cell Biol. 127:373-386[Abstract/Free Full Text].

NEHRKE, K., T. BEGENISICH, J. PILATO, and J. E. MELVIN, 2000  Into ion channel and transporter function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression. Am. J. Physiol. Cell Physiol. 279:C2052-C2066[Abstract/Free Full Text].

NONET, M. L., K. GRUNDAHL, B. J. MEYER, and J. B. RAND, 1993  Synaptic function is impaired but not eliminated in C. elegans mutants lacking synaptotagmin. Cell 73:1291-1305[Medline].

NONET, M. L., A. M. HOLGADO, F. BREWER, C. J. SERPE, and B. A. NORBECK et al., 1999  UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol. Biol. Cell 10:2343-2360[Abstract/Free Full Text].

OTSUKA, A. J., A. JEYAPRAKASH, J. GARCIA-ANOVEROS, L. Z. TANG, and G. FISK et al., 1991  The C. elegans unc-104 gene encodes a putative kinesin heavy chain-like protein. Neuron 6:113-122[Medline].

PANCER, Z., J. P. RAST, and E. H. DAVIDSON, 1999  Origins of immunity: transcription factors and homologues of effector genes of the vertebrate immune system expressed in sea urchin coelomocytes. Immunogenetics 49:773-786[Medline].

PEARSON, A. M., 1996  Scavenger receptors in innate immunity. Curr. Opin. Immunol. 8:20-28[Medline].

QUALMANN, B., J. ROOS, P. J. DIGREGORIO, and R. B. KELLY, 1999  Syndapin I, a synaptic dynamin-binding protein that associates with the neural Wiskott-Aldrich syndrome protein. Mol. Biol. Cell 10:501-513[Abstract/Free Full Text].

RAPPLEYE, C. A., A. R. PAREDEZ, C. W. SMITH, K. L. MCDONALD, and R. V. AROIAN, 1999  The coronin-like protein POD-1 is required for anterior-posterior axis formation and cellular architecture in the nematode Caenorhabditis elegans. Genes Dev. 13:2838-2851[Abstract/Free Full Text].

REDDIEN, P. W. and H. R. HORVITZ, 2000  CED-2/CrkII and CED-10/Rac control phagocytosis and cell migration in Caenorhabditis elegans. Nat. Cell Biol. 2:131-136[Medline].

RICHMOND, J. E., W. S. DAVIS, and E. M. JORGENSEN, 1999  UNC-13 is required for synaptic vesicle fusion in C. elegans. Nat. Neurosci. 2:959-964[Medline].

RIDDLE, D. L., T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS, 1997 C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY.

RIEZMAN, H., 1985  Endocytosis in yeast: several of the yeast secretory mutants are defective in endocytosis. Cell 40:1001-1009[Medline].

ROBBINS, A. R., S. S. PENG, and J. L. MARSHALL, 1983  Mutant Chinese hamster ovary cells pleiotropically defective in receptor-mediated endocytosis. J. Cell Biol. 96:1064-1071[Abstract/Free Full Text].

ROBINSON, M. S., C. WATTS, and M. ZERIAL, 1996  Membrane dynamics in endocytosis. Cell 84:13-21[Medline].

SAIFEE, O., L. WEI, and M. L. NONET, 1998  The Caenorhabditis elegans unc-64 locus encodes a syntaxin that interacts genetically with synaptobrevin. Mol. Biol. Cell 9:1235-1252[Abstract/Free Full Text].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SEKI, N., M. MURAMATSU, S. SUGANO, Y. SUZUKI, and A. NAKAGAWARA et al., 1998  Cloning, expression analysis, and chromosomal localization of HIP1R, an isolog of huntingtin interacting protein (HIP1). J. Hum. Genet. 43:268-271[Medline].

SEVER, S., H. DAMKE, and S. L. SCHMID, 2000  Dynamin: GTP controls the formation of constricted coated pits, the rate limiting step in clathrin-mediated endocytosis. J. Cell Biol. 150:1137-1148[Abstract/Free Full Text].

SHIBATA, Y., T. FUJII, J. A. DENT, H. FUJISAWA, and S. TAKAGI, 2000  EAT-20, a novel transmembrane protein with EGF motifs, is required for efficient feeding in Caenorhabditis elegans. Genetics 154:635-646[Abstract/Free Full Text].

SIMPSON, F., A. A. PEDEN, L. CHRISTOPOULOU, and M. S. ROBINSON, 1997  Characterization of the adaptor-related protein complex, AP-3. J. Cell Biol. 137:835-845[Abstract/Free Full Text].

SINGLETON, D. R., T. T. WU, and J. D. CASTLE, 1997  Three mammalian SCAMPs (secretory carrier membrane proteins) are highly related products of distinct genes having similar subcellular distributions. J. Cell Sci. 110:2099-2107[Abstract].

STACK, J. H. and S. D. EMR, 1994  Vps34p required for yeast vacuolar protein sorting is a multiple specificity kinase that exhibits both protein kinase and phosphatidylinositol-specific PI 3-kinase activities. J. Biol. Chem. 269:31552-31562[Abstract/Free Full Text].

STEEG, P. S., G. BEVILACQUA, L. KOPPER, U. P. THORGEIRSSON, and J. E. TALMADGE et al., 1988  Evidence for a novel gene associated with low tumor metastatic potential. J. Natl. Cancer Inst. 80:200-204[Abstract/Free Full Text].

STEVEN, R., T. J. KUBISESKI, H. ZHENG, S. KULKARNI, and J. MANCILLAS et al., 1998  UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in C. elegans. Cell 92:785-795[Medline].

SUN, M., E. GOLDIN, S. STAHL, J. L. FALARDEAU, and J. C. KENNEDY et al., 2000  Mucolipidosis Type IV is caused by mutations in a gene encoding a novel transient receptor potential channel. Hum. Mol. Genet. 9:2471-2478[Abstract/Free Full Text].

SWAN, K. A., A. F. SEVERSON, J. C. CARTER, P. R. MARTIN, and H. SCHNABEL et al., 1998  cyk-1: a C. elegans FH gene required for a late step in embryonic cytokinesis. J. Cell Sci. 111:2017-2027[Abstract].

TABARA, H., A. GRISHOK, and C. C. MELLO, 1998  RNAi in C. elegans: soaking in the genome sequence. Science 282:430-431[Free Full Text].

TAN, M. W. and F. M. AUSUBEL, 2000  Caenorhabditis elegans: a model genetic host to study Pseudomonas aeruginosa pathogenesis. Curr. Opin. Microbiol. 3:29-34[Medline].

TANG, Z., T. OKAMOTO, P. BOONTRAKULPOONTAWEE, T. KATADA, and A. J. OTSUKA et al., 1997  Identification, sequence, and expression of an invertebrate caveolin gene family from the nematode Caenorhabditis elegans. Implications for the molecular evolution of mammalian caveolin genes. J. Biol. Chem. 272:2437-2445[Abstract/Free Full Text].

TCHEREPANOVA, I., L. BHATTACHARYYA, C. S. RUBIN, and J. H. FREEDMAN, 2000  Aspartic proteases from the nematode Caenorhabditis elegans. Structural organization and developmental and cell-specific expression of asp-1. J. Biol. Chem. 275:26359-26369[Abstract/Free Full Text].

TERBUSH, D. R., T. MAURICE, D. ROTH, and P. NOVICK, 1996  The exocyst is a multiprotein complex required for exocytosis in Saccharomyces cerevisiae. EMBO J. 15:6483-6494[Medline].

TIMMONS, L. and A. FIRE, 1998  Specific interference by ingested dsRNA. Nature 395:854[Medline].

VENTER, J. C., M. D. ADAMS, E. W. MYERS, P. W. LI, and R. J. MURAL et al., 2001  The sequence of the human genome. Science 291:1304-1351[Abstract/Free Full Text].

WANG, S. S., O. DEVUYST, P. J. COURTOY, X. T. WANG, and H. WANG et al., 2000  Mice lacking renal chloride channel, CLC-5, are a model for Dent's disease, a nephrolithiasis disorder associated with defective receptor-mediated endocytosis. Hum. Mol. Genet. 9:2937-2945[Abstract/Free Full Text].

WATTS, C. and M. MARSH, 1992  Endocytosis: What goes in and how? J. Cell Sci. 103:1-8[Free Full Text].

WENDLAND, B., J. M. MCCAFFERY, Q. XIAO, and S. D. EMR, 1996  A novel fluorescence-activated cell sorter-based screen for yeast endocytosis mutants identifies a yeast homologue of mammalian eps15. J. Cell Biol. 135:1485-1500[Abstract/Free Full Text].

WHITE, J., 1988 The anatomy, pp. 81–122 in The Nematode Caenorhabditis elegans, edited by W. WOOD. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

WILLIAMS, B. D., B. SCHRANK, C. HUYNH, R. SHOWNKEEN, and R. H. WATERSTON, 1992  A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131:609-624[Abstract].

WU, Y. C. and H. R. HORVITZ, 1998  C. elegans phagocytosis and cell-migration protein CED-5 is similar to human DOCK180. Nature 392:501-504[Medline].

YEUNG, B. G., H. L. PHAN, and G. S. PAYNE, 1999  Adaptor complex-independent clathrin function in yeast. Mol. Biol. Cell 10:3643-3659[Abstract/Free Full Text].

ZHANG, Y., B. GRANT, and D. HIRSH, 2001  RME-8, a conserved J-domain protein, is required in endocytosis in C. elegans. Mol. Biol. Cell 12:2011-2021[Abstract/Free Full Text].

ZHENG, B., J. N. WU, W. SCHOBER, D. E. LEWIS, and T. VIDA, 1998  Isolation of yeast mutants defective for localization of vacuolar vital dyes. Proc. Natl. Acad. Sci. USA 95:11721-11726[Abstract/Free Full Text].

ZIPKIN, I. D., R. M. KINDT, and C. J. KENYON, 1997  Role of a new Rho family member in cell migration and axon guidance in C. elegans. Cell 90:883-894[Medline].




This article has been cited by other articles:


Home page
J. Cell Sci.Home page
B. Schaheen, H. Dang, and H. Fares
Derlin-dependent accumulation of integral membrane proteins at cell surfaces
J. Cell Sci., July 1, 2009; 122(13): 2228 - 2239.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Parker, D. S. Walker, S. Ly, and H. A. Baylis
Caveolin-2 Is Required for Apical Lipid Trafficking and Suppresses Basolateral Recycling Defects in the Intestine of Caenorhabditis elegans
Mol. Biol. Cell, March 15, 2009; 20(6): 1763 - 1771.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G.-d. Zhu, G. Salazar, S. A. Zlatic, B. Fiza, M. M. Doucette, C. J. Heilman, A. I. Levey, V. Faundez, and S. W. L'Hernault
SPE-39 Family Proteins Interact with the HOPS Complex and Function in Lysosomal Delivery
Mol. Biol. Cell, February 1, 2009; 20(4): 1223 - 1240.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Xiao, D. Chen, Z. Fang, J. Xu, X. Sun, S. Song, J. Liu, and C. Yang
Lysosome Biogenesis Mediated by vps-18 Affects Apoptotic Cell Degradation in Caenorhabditis elegans
Mol. Biol. Cell, January 1, 2009; 20(1): 21 - 32.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
W.-M. Woo, E. C. Berry, M. L. Hudson, R. E. Swale, A. Goncharov, and A. D. Chisholm
The C. elegans F-spondin family protein SPON-1 maintains cell adhesion in neural and non-neural tissues
Development, August 15, 2008; 135(16): 2747 - 2756.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. K. Chun, J. M. McEwen, M. Burbea, and J. M. Kaplan
UNC-108/Rab2 Regulates Postendocytic Trafficking in Caenorhabditis elegans
Mol. Biol. Cell, July 1, 2008; 19(7): 2682 - 2695.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. T. Miedel, Y. Rbaibi, C. J. Guerriero, G. Colletti, K. M. Weixel, O. A. Weisz, and K. Kiselyov
Membrane traffic and turnover in TRP-ML1-deficient cells: a revised model for mucolipidosis type IV pathogenesis
J. Exp. Med., June 9, 2008; 205(6): 1477 - 1490.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Janssen, E. Meelkop, M. Lindemans, K. Verstraelen, S. J. Husson, L. Temmerman, R. J. Nachman, and L. Schoofs
Discovery of a Cholecystokinin-Gastrin-Like Signaling System in Nematodes
Endocrinology, June 1, 2008; 149(6): 2826 - 2839.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Nilsson, B. Conradt, A.-F. Ruaud, C. C.-H. Chen, J. Hatzold, J.-L. Bessereau, B. D. Grant, and S. Tuck
Caenorhabditis elegans num-1 Negatively Regulates Endocytic Recycling
Genetics, May 1, 2008; 179(1): 375 - 387.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Q. Lu, Y. Zhang, T. Hu, P. Guo, W. Li, and X. Wang
C. elegans Rab GTPase 2 is required for the degradation of apoptotic cells
Development, March 15, 2008; 135(6): 1069 - 1080.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. V. Samuelson, C. E. Carr, and G. Ruvkun
Gene activities that mediate increased life span of C. elegans insulin-like signaling mutants
Genes & Dev., November 15, 2007; 21(22): 2976 - 2994.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Brinster, B. Posteraro, H. Bierne, A. Alberti, S. Makhzami, M. Sanguinetti, and P. Serror
Enterococcal Leucine-Rich Repeat-Containing Protein Involved in Virulence and Host Inflammatory Response
Infect. Immun., September 1, 2007; 75(9): 4463 - 4471.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Holmes, A. Flett, D. Coudreuse, H. C. Korswagen, and J. Pettitt
C. elegans Disabled is required for cell-type specific endocytosis and is essential in animals lacking the AP-3 adaptor complex
J. Cell Sci., August 1, 2007; 120(15): 2741 - 2751.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
V. Venegas and Z. Zhou
Two Alternative Mechanisms That Regulate the Presentation of Apoptotic Cell Engulfment Signal in Caenorhabditis elegans
Mol. Biol. Cell, August 1, 2007; 18(8): 3180 - 3192.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. Schaheen, G. Patton, and H. Fares
Suppression of the cup-5 mucolipidosis type IV-related lysosomal dysfunction by the inactivation of an ABC transporter in C. elegans
Development, October 1, 2006; 133(19): 3939 - 3948.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. K. Larsen, S. Tuck, N. J. Faergeman, and J. Knudsen
MAA-1, a Novel Acyl-CoA-binding Protein Involved in Endosomal Vesicle Transport in Caenorhabditis elegans
Mol. Biol. Cell, October 1, 2006; 17(10): 4318 - 4329.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Hayakawa, D. Leonard, S. Murphy, S. Hayes, M. Soto, K. Fogarty, C. Standley, K. Bellve, D. Lambright, C. Mello, et al.
The WD40 and FYVE domain containing protein 2 defines a class of early endosomes necessary for endocytosis
PNAS, August 8, 2006; 103(32): 11928 - 11933.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. C.-H. Chen, P. J. Schweinsberg, S. Vashist, D. P. Mareiniss, E. J. Lambie, and B. D. Grant
RAB-10 Is Required for Endocytic Recycling in the Caenorhabditis elegans Intestine
Mol. Biol. Cell, March 1, 2006; 17(3): 1286 - 1297.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Kubota, M. Sano, S. Goda, N. Suzuki, and K. Nishiwaki
The conserved oligomeric Golgi complex acts in organ morphogenesis via glycosylation of an ADAM protease in C. elegans
Development, January 15, 2006; 133(2): 263 - 273.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G. J. Hermann, L. K. Schroeder, C. A. Hieb, A. M. Kershner, B. M. Rabbitts, P. Fonarev, B. D. Grant, and J. R. Priess
Genetic Analysis of Lysosomal Trafficking in Caenorhabditis elegans
Mol. Biol. Cell, July 1, 2005; 16(7): 3273 - 3288.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Syntichaki and N. Tavernarakis
Genetic Models of Mechanotransduction: The Nematode Caenorhabditis elegans
Physiol Rev, October 1, 2004; 84(4): 1097 - 1153.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Treusch, S. Knuth, S. A. Slaugenhaupt, E. Goldin, B. D. Grant, and H. Fares
Caenorhabditis elegans functional orthologue of human protein h-mucolipin-1 is required for lysosome biogenesis
PNAS, March 30, 2004; 101(13): 4483 - 4488.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. M. Loria, J. Hodgkin, and O. Hobert
A Conserved Postsynaptic Transmembrane Protein Affecting Neuromuscular Signaling in Caenorhabditis elegans
J. Neurosci., March 3, 2004; 24(9): 2191 - 2201.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Chen, X. Li, and I. Greenwald
sel-7, a Positive Regulator of lin-12 Activity, Encodes a Novel Nuclear Protein in Caenorhabditis elegans
Genetics, January 1, 2004; 166(1): 151 - 160.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Dang, Z. Li, E. Y. Skolnik, and H. Fares
Disease-related Myotubularins Function in Endocytic Traffic in Caenorhabditis elegans
Mol. Biol. Cell, January 1, 2004; 15(1): 189 - 196.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Laporte, F. Bedez, A. Bolino, and J.-L. Mandel
Myotubularins, a large disease-associated family of cooperating catalytically active and inactive phosphoinositides phosphatases
Hum. Mol. Genet., October 15, 2003; 12(90002): R285 - 292.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Xue, H. Fares, B. Grant, Z. Li, A. M. Rose, S. G. Clark, and E. Y. Skolnik
Genetic Analysis of the Myotubularin Family of Phosphatases in Caenorhabditis elegans
J. Biol. Chem., September 5, 2003; 278(36): 34380 - 34386.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
K. Strange
From Genes to Integrative Physiology: Ion Channel and Transporter Biology in Caenorhabditis elegans
Physiol Rev, April 1, 2003; 83(2): 377 - 415.
[Abstract] [Full Text] [PDF]