- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Wostrikoff, K.
- Articles by Girard-Bascou, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Wostrikoff, K.
- Articles by Girard-Bascou, J.
TCA1, a Single Nuclear-Encoded Translational Activator Specific for petA mRNA in Chlamydomonas reinhardtii Chloroplast
K. Wostrikoffa, Y. Choqueta, F.-A. Wollmana, and J. Girard-Bascouaa UPR/CNRS 1261, Institut de Biologie Physico-Chimique, 75005 Paris, France
Corresponding author: J. Girard-Bascou, UPR/CNRS 1261, Institut de Biologie Physico-Chimique, 13 rue P. et M. Curie, 75005 Paris, France., girard{at}ibpc.fr (E-mail)
Communicating editor: P. J. PUKKILA
| ABSTRACT |
|---|
We isolated seven allelic nuclear mutants of Chlamydomonas reinhardtii specifically blocked in the translation of cytochrome f, a major chloroplast-encoded subunit of the photosynthetic electron transport chain encoded by the petA gene. We recovered one chloroplast suppressor in which the coding region of petA was now expressed under the control of a duplicated 5' untranslated region from another open reading frame of presently unknown function. Since we also recovered 14 nuclear intragenic suppressors, we ended up with 21 alleles of a single nuclear gene we called TCA1 for translation of cytochrome b6f complex petA mRNA. The high number of TCA1 alleles, together with the absence of genetic evidence for other nuclear loci controlling translation of the chloroplast petA gene, strongly suggests that TCA1 is the only trans-acting factor. We studied the assembly-dependent regulation of cytochrome f translationknown as the CES processin TCA1-mutated contexts. In the presence of a leaky tca1 allele, we observed that the regulation of cytochrome f translation was now exerted within the limits of the restricted translational activation conferred by the altered version of TCA1 as predicted if TCA1 was the ternary effector involved in the CES process.
THE well-developed tools for genetic analysis in Chlamydomonas reinhardtii offer a unique opportunity to study the regulation of chloroplast gene expression in vivo and more specifically the control exerted by the nucleus on post-transcriptional steps such as mRNA maturation, stabilization, and translation. As discussed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In C. reinhardtii, the rate of translation of several chloroplast-encoded polypeptides also depends on the presence of those polypeptides with which they ultimately assemble in an oligomeric protein (for reviews see ![]()
![]()
![]()
![]()
![]()
![]()
The aim of this study is to dissect genetically the specific nuclear control of petA translation and to explore the links between the CES process and the translation of petA mRNA mediated by trans-acting factors of nuclear origin.
| MATERIALS AND METHODS |
|---|
Media, culture conditions, and strains:
Wild-type and mutant strains were grown on Tris-acetate-phosphate (TAP) medium, pH 7.2, at 25° under dim light (56 µE m-2 sec-1), unless otherwise indicated. To assay phototrophic growth, cells were streaked on minimal medium plates and allowed to grow under an illumination of 80 µE m-2 sec-1 for 10 days. Antibiotic resistance tests were performed as described in ![]()
For genetic crosses and chloroplast transformation we used wild-type strains of C. reinhardtii from our laboratory that are derived from the original 137c strains. The nuclear mutant strains used in this study were mcd1-F16, mt- (![]()
11 (![]()
![]()
petD, mt+ and
petA, mt+ (![]()
Genetic analysis:
As a convention, all crosses are indicated with the mt+ parent first, i.e., the strain whose chloroplast genome is transmitted to the whole progeny. For gametogenesis, the cells were grown for 34 days on TAP plates containing one-tenth the usual amount of nitrogen. Mating, germination, and tetrad analysis were performed according to ![]()
![]()
Isolation of mutant strains:
Eight mutants deficient in cytochrome f synthesis are described in this work. Six of these, tca1-1, tca1-3, tca1-4, tca1-5, tca1-6, and mca1-792, were identified among a population of UV-mutagenized CC125 (mt+) cells (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Isolation of diploid strains:
Vegetative diploids were isolated according to published protocols (![]()
Isolation of revertant strains:
Revertants were isolated from tca1, mt+ strains using various mutagenic agents. UV mutagenesis was conducted as described in ![]()
![]()
Transformation experiments:
Cells were transformed by tungsten particle bombardment as previously described (![]()
![]()
Nucleic acid manipulation:
Plasmids pWQ encompassing the wild-type petD gene,
petB containing a deletion of cytochrome b6-coding sequences (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Chloroplast DNA manipulation:
Purified chloroplast DNA was isolated as described in ![]()
![]()
|
|
|
|
|
|
Oligonucleotides used for sequencing and/or PCR:
- pUN121codH: GGTTGAAGGTAATTCCATGACCG
- pUN121revH: GCTCAACAGCCTGCTCAGGGTCAA
- R1cod1: CGTTACAGGCATGAGCTAGTA
- R1cod2: GAATTTTAGTGGCAGTTGCCTCCT
- R1cod3: GTTACTACTTCCTCGAGACAGAACC
- R1rev1: CTGGTTAGAGTCTATCGAGCA
- FT7Sac: CGCGAGCTCAGATATAATATATGTTGAGAAG
- AAAAAAAATAAAATTTAAATAGT
- PETArevA: ACAGCTTGTGGTACTTCGATTTCAACTGCT
- PETAAUG: GCGGATCCATGGACATAATTTTATTAA
- TCTTAAAACG
Protein isolation, separation, and analysis:
Pulse-labeling experiments, protein isolation, separation, and analysis were carried out on cells grown to a density of 2 x 106 cells ml-1, according to ![]()
| RESULTS |
|---|
Identification of nuclear mutants deficient in cytochrome f synthesis:
More than 80 mutants lacking cytochrome b6f activity have been generated by either UV mutagenesis (![]()
![]()
![]()
11, a mutant strain previously described (![]()
![]()
![]()
Genetic analysis of tca1 mutants:
The seven class I mutants (Cyt b6f- phenotype) affected in cytochrome f synthesis were backcrossed with the wild-type strain (Cyt b6f+ phenotype) to determine the inheritance of the mutant phenotype. All tetrads showed a 2:2 segregation for the Cyt b6f-:Cyt b6f+ phenotypes, indicating that the Cyt b6f- phenotype was due to a single nuclear mutation. We tested the recessivity of the tca1-1 mutation by generating heterozygous vegetative diploids that exhibited the same fluorescence induction kinetics and phototrophic growth as did wild-type vegetative diploid cells. The seven tca1 mutants were analyzed in recombination and complementation tests (Table 1). We used a rapid recombination test to detect mutations at the same locus. The progeny of individual zygotes derived from pairwise crosses between all mutants, except tca1-5, were tested for phototrophy on minimal medium. None gave rise to a recombinant progeny capable of phototrophic growth. Thus, all genetic distances were below 2.4 cM, indicative of a tight linkage. By contrast, no linkage was detected in crosses with the five class II mutant strains since phototrophic recombinants were recovered at high frequency (see Table 1, where mca1-792 is taken as representative of class II mutants). Percentages of zygotes giving rise to wild-type progeny, which corresponds to the frequency of tetratype and nonparental ditype tetrads, were high indicating that the mutations probably affect two independent genes. In C. reinhardtii, complementation tests between photosynthetic mutants can be performed by testing the fluorescence induction kinetics of layers of young zygotes obtained from pairwise crosses (![]()
|
The 5' UTR of petA mRNA is the target of TCA1:
We investigated the putative role of the petA-5' UTR as a target for the translational control mediated by the TCA1 nuclear gene product. To this end, we analyzed the expression of two chloroplast chimeric genes, AFFF and FKR12, in TCA1 or tca1 nuclear contexts. AFFF is a chimeric gene where the regular 5' UTR of the petA gene has been substituted by the atpA-5' UTR that preserves the phototrophic property of the AFFF strain (![]()
![]()
In AFFF, mt+ x tca1-1, mt- crosses, the whole progeny from 12 tetrads was phototrophic. As shown for one representative tetrad in Fig 2B, the rate of cytochrome f synthesis was similar in the four daughter cells. Accordingly, cytochrome f accumulated to the same extent in the four members of the tetrad (Fig 2B, bottom). No changes in petA mRNA levels were observed among the tetrad progeny (data not shown). Thus, translation of cytochrome f driven by the atpA-5' UTR is no longer dependent upon the wild-type allele of the TCA1 gene. This observation demonstrates that the mRNA target for TCA1 includes elements from the petA-5' UTR.
In FKR12, mt+ x tca1-1, mt- crosses, the two tca1 meiotic products were detected by their Cyt b6f- fluorescence phenotype that was confirmed by their deficiency in cytochrome f and their inability to grow on minimum medium. The other two TCA1 members of the tetrads showed a Cyt b6f+ phenotype, accumulated cytochrome f, and were phototrophic (Fig 3B). In five representative tetrads, none of the tca1-1 progeny grew on antibiotic-supplemented medium (50 µg ml-1 spectinomycin plus 4 µg ml-1 streptomycin), in contrast to the TCA1 progeny that were antibiotic resistant (Fig 3C). We took the loss of antibiotic resistance in the tca1-1 context as indicative of a lack of translation of the FKR12 chimeric mRNA. The 5' UTR of the petA mRNA was thus sufficient to confer TCA1 sensitivity to a reporter gene. This observation demonstrates that the mRNA target for TCA1 is located within the petA-5' UTR.
Reversion strategy of tca1 mutants:
The molecular identification of TCA1 partners in the control of petA translation should be tractable by generating extragenic suppressor mutations either in the chloroplast or in the nuclear genome of a primary tca1 mutation. Therefore we undertook a search for chloroplast revertants, aimed at the characterization of cis-acting elements controlling translation within the petA-5' UTR, and a search for nuclear revertants to identify other possible nuclear gene products interacting with the TCA1 factor.
All tca1 mutants showed weak frequencies of spontaneous reversion, ranging from <10-9 to 3.10-7, as indicated in the diagonal of Table 1. A search for phototrophic revertants induced by mutagenesis was conducted most extensively with tca1-1, mt+ and tca1-2, mt+ strains. We used EMS and UV, which cause preferentially nuclear mutations, and FdUrd, which is known to reduce chloroplast polyploidy and induce chloroplast mutations preferentially (![]()
![]()
|
Genetic analysis of revertant strains:
To determine the genetic origin of the suppression events, each mt+ revertant strain was backcrossed with a mt- strain bearing the original tca1 mutation. The suppressed and Cyt b6f- phenotypes should segregate 2:2 if the suppression event is due to a single nuclear mutation whereas the suppressed phenotype should be transmitted to the whole progeny if it is due to a chloroplast mutation (Table 2). For 16 revertants, a 2:2 segregation of the suppressed and Cyt b6f- phenotypes was observed either in tetrads or statistically on batches of meiotic products. This was indicative of a single nuclear mutational event at the origin of the reversion. However, for some of these revertant strains, we noted that the level of cytochrome f varied over time as well as among the progeny after a cross. For example, cytochrome f accumulated to
50% of the wild-type level in the original tca1-1 r3, mt+ strain but dropped down to
15% in a mt- progeny from a tca1-1 r3, mt+ x tca1-1, mt- cross. From a further backcross of this tca1-1 r3, mt- strain with the original tca1-1, mt+ strain, six meiotic products with a suppressed phenotype showed variable cytochrome f accumulation ranging from 15 to 30% of the wild-type amount. These variations point to the possible instability of the TCA1 mutated factor whose steady-state concentration may then depend on the genetic background in each strain.
Fourteen of these 16 nuclear revertants due to monogenic nuclear suppression were crossed with the wild type to test the linkage of the suppressor and tca1 mutations. No meiotic progeny yielded recombinant clones of Cyt b6f- phenotype, indicating low genetic distances between forward and reverse mutations (Table 2). Thus, all these 14 nuclear suppressor mutations were tightly linked to the original tca1 mutations as one would expect for intragenic suppressors. We thus most likely obtained 14 new alleles of TCA1 but got no genetic evidence for additional TCA nuclear genes.
Four suppressors were not analyzed further because they failed to show either predicted monogenic Mendelian inheritance or chloroplast uniparental inheritance or they showed poor spore viability after meiosis.
In a backcross of the FdUrd-induced r1 revertant from tca1-2, mt+ strain with a tca1-2, mt- strain, the whole progeny from 10 tetrads exhibited the suppressed phenotype. We then used a mt- clone from the progeny to perform a symmetric backcross with a tca1-2, mt+ mutant strain. This cross yielded only clones of Cyt b6f- phenotype among the progeny from 6 tetrads. Thus, the suppressed phenotype was transmitted only by the mt+ parental strain, indicative of a chloroplast suppressor mutation.
Characterization of the chloroplast suppressor event in the r1 revertant:
The r1 revertant strain of tca1-2 strain contained both the original tca1-2 nuclear mutation and a chloroplast suppressor mutation that we called SuC. It was crossed to the wild type to recover progeny carrying the suppressor mutation in a wild-type nuclear context. From two tetrads, the two TCA1 progeny were distinguished from the tca1-2 members by transformation with the FKR12 chimeric gene (Fig 5B): the chimeric construct conferred spectinomycin resistance to the TCA1 strains, while tca1-2 mutation prevented its expression (see Fig 3). However, cytochrome f accumulated to about the same amount in the whole tetrads (Fig 5A) and in the parental r1 revertant mt+ strain. In this experiment cytochrome f accumulated to
20% of the wild-type level while it accumulated to
50% in a first experiment (Fig 4; a similar situation was discussed above with tca1-1 r3 mutant strains). Thus, the chloroplast mutation SuC allowed only a limited accumulation of cytochrome f, even in a wild-type nuclear context. Interestingly, the petA mRNA accumulating in the r1 revertant strain and in the four members of the tetrad was of larger size than the wild-type petA mRNA and its accumulation was reduced (Fig 5C).
To determine the specificity of the chloroplast suppressor SuC, the SuC, tca1-2, mt+ revertant strain was crossed with tca1-1, tca1-3, and mca1-792 mutant strains. The whole tetrad progeny from these crosses (10, 3, and 6 tetrads tested, respectively) displayed the suppressed phenotype in fluorescence tests (data not shown). Furthermore, cytochrome f accumulated to the same level as in the parental SuC, tca1-2 strain in two tetrads analyzed (data not shown). Thus, the chloroplast SuC mutation suppressed other tca1 or mca1 mutations. We then investigated whether the CES process mentioned in the Introduction still occurred in this chloroplast revertant strain. We introduced a deletion of the petB gene encoding cytochrome b6 by biolistic transformation of the chloroplast genome from r1 revertant strain with plasmid
petB (see MATERIALS AND METHODS). While cytochrome b6 deletion mutants exhibit a 10-fold reduction of cytochrome f expression (![]()
petB, tca1-2 displayed no reduction of cytochrome f expression compared to the original SuC, tca1-2 strain (data not shown).
Thus, the chloroplast suppression turned out to confer a TCA1-, MCA1-, and CES-independent expression of the petA gene. Since the 5' UTR of petA mRNA is the target of both factors and of the CES process, this suggested, together with the larger size of the petA mRNA accumulated in the SuC strains, that the 5' UTR region was deeply altered in these strains.
Molecular characterization of the chloroplast suppression event:
To characterize the putative rearrangement in the petA region in SuC, tca1-2 strains, HindIII and BglII digests of purified chloroplast DNA isolated from the mutant and wild-type strains were compared by Southern blot analysis. The 3.5-kb HindIII fragment (
, Fig 6A), containing the coding sequence for mature cytochrome f and the downstream regions detected with probe A, remained unaffected, as expected from the accumulation of a functional cytochrome f (Fig 6B, lane A). Conversely, probe B, corresponding to the petA-5' UTR, clearly showed the absence of any hybridizing fragment in the SuC, tca1-2 strain (Fig 6B, lane B). Thus, the petA-5' UTR, the target of TCA1 and MCA1 factors and of the CES process, has been lost as a result of the mutation that leads to the suppressed phenotype. This was confirmed by hybridization with probe C, corresponding to the HindIII fragment upstream of the cytochrome f coding sequence (Fig 6A). This 2.3-kb fragment (
) was not detected any longer in the SuC, tca1-2 strain, which contained instead two new hybridizing fragments of 2.0 (
) and 0.5 kb (
; Fig 6B, lane C). The 2.0-kb HindIII fragment was subcloned into pUN121 and sequenced. The characterization of the rearrangement was completed by sequencing a PCR product amplified using oligonucleotides primers derived from the sequence of the cloned fragment and from the petA coding region (see MATERIALS AND METHODS). In the SuC, tca1-2 strain, the deleted region of the petA-5' UTR is replaced by 1.1 kb of unidentified sequences. To address the origin of this sequence, Southern blots of chloroplast BglII digestion products were probed with a HindIII-HinfI fragment internal to the inserted region (probe D, see Fig 6D). As depicted in Fig 6B, lane D, this probe hybridized to the BglII fragments Bg13 and Bg11 in the wild-type and SuC, tca1-2 strains. This assignment was consistent with other features of the sequence of the insert such as the presence of a tRNAval and of XhoI and BglII restriction sites (![]()
This rearrangement leads to a chimeric gene encoding a new protein made of the cytochrome f sequence, including 19 of the 31 residues from its transit peptide fused in frame with 93 amino acids corresponding to the N-terminal part of a 469-amino-acid open reading frame (ORF469) present in the Bg13-Bg11 region (Fig 6C). The fusion preserves the 7-amino-acid hydrophobic core of the cytochrome f transit peptide described by ![]()
![]()
![]()
![]()
5% of the wild-type level of a transcript of higher molecular weight as depicted in Fig 5C.
Study of the CES process in strains with partially restored TCA1 activity:
As mentioned in the Introduction, the CES process for cytochrome f is likely to operate through a ternary effector that would interact with the petA-5' UTR. This effector should modulate the translational efficiency of petA mRNA, depending on its binding to unassembled cytochrome f. The above experiments indicated that the TCA1 factor and the CES process both involved as a target the petA-5' UTR. We wondered whether the partially restored translation of cytochrome f in a nuclear tca1-suppressed strain, which should express a mutated version of the TCA1 factor, still showed sensitivity to the CES process. To this end we studied the CES process in a revertant strain carrying a leaky TCA1 allele, tca1-1 r3, mt-, which accumulated
15% of wild-type cytochrome f (Fig 7A and Fig 8A). We investigated the expression of the petA gene in tetrads obtained from crosses between tca1-1 r3, mt- and two types of chloroplast transformants in which cytochrome f translation was either repressed or enhanced.
|
|
The first type of cross involved the
petD, mt+ strain and consequently displays a cytochrome f synthesis reduced by
90% as illustrated in Fig 7A. We analyzed four tetrads from a
petD, mt+ x tca1-1 r3, mt- cross. The whole progeny inherited the
petD deletion and lacked subunit IV, as illustrated in Fig 7A. We observed a Mendelian segregation of cytochrome f accumulation: two members of the tetrads accumulated
15% of wild-type cytochrome f, while this accumulation was reduced to
3% in the other two members of the tetrad (see Fig 7A). We observed changes in the petA mRNA levels among these various strains (data not shown). However, as previously reported (![]()
![]()
For the second type of cross, we used the KF303-Q304St, mt+ strain that expresses a mutated version of cytochrome f deleted for the last 14 residues of the C-terminal domain. As shown in Fig 8, this strain behaves similarly to the FK283St strain lacking the whole C-terminal domain (![]()
![]()
| DISCUSSION |
|---|
TCA1 is a nuclear-encoded activator required for the initiation of translation of petA mRNA:
We performed a genetic identification of a nuclear factor specifically required for the expression of the chloroplast petA gene encoding cytochrome f, a major subunit of cytochrome b6f complexes from the thylakoid membranes. Mutations in the TCA1 gene still allow a reduced but significant accumulation of the petA mRNA but impair the synthesis of cytochrome f. The lower stability of the untranslated petA mRNA in a tca1 context correlates with a block at the stage of translation initiation since we showed, using chimeric genes, that the target for TCA1 is located entirely in the 5' UTR region of the petA transcript. As the seven TCA1 mutations presented in this study were recessive, we conclude that the TCA1 product acts as a specific translational activator and not as a translational repressor. The reason for the destabilization of petA mRNA in tca1 mutants is unclear. In a tca1 mutant nuclear context, the accumulation of the petA messenger is reduced (Fig 1B) but not that of the chimeric FKR transcript (Fig 3D). A comparative analysis of several other studies shows that there is no simple relationship between translation and stability of chloroplast mRNAs in Chlamydomonas. The tda1-F54 nuclear mutant strain, impaired in the translation of the
-subunit of the ATP synthase complex, showed a threefold increase of the level of atpA mRNA (![]()
![]()
![]()
![]()
![]()
Are there other TCA factors?
The number of nuclear genes required for the achievement of a given step in the expression of one chloroplast gene in C. reinhardtii is probably higher than estimated from our current knowledge. In most cases, these nuclear genes were identified by a single mutant allele, indicating that we are far from genetic saturation and that other genes remain to be discovered. The situation is widely different for cytochrome f. Although we used several mutagenic agents to carry out a large-scale screening of cytochrome b6f-deficient mutants, we identified only a single nuclear gene, TCA1, controlling cytochrome f translation, out of seven independent mutants deficient in cytochrome f translation. The five other nuclear mutations responsible for a deficiency of cytochrome f synthesis lacked mature petA mRNA and were all located in another unlinked gene called MCA1, identified for the first time by the M
11 mutation (![]()
In yeast mitochondria, where extensive screens have been used, a limited number of specific translational activators have been characterized for each mitochondrial gene (for a review, see ![]()
In maize, a nuclear gene, Crp1, has also been shown to affect cytochrome f translation (![]()
![]()
![]()
![]()
![]()
Chloroplast suppression:
Only one chloroplast suppression event was obtained after several FdUrd treatments of tca1 mutant strains (Table 2). Furthermore, while chloroplast point mutations induced with FdUdr have been found on the 5' UTR of psbC or psaB (![]()
![]()
![]()
![]()
![]()
![]()
The rearrangement led to the disruption of the 31-amino-acid transit peptide of the apocytochrome f by deleting the first 12 amino acids but preserved the hydrophobic core required for the translocation of the protein (![]()
TCA1, a candidate to act as the ternary effector involved in the CES process that controls cytochrome f translation:
The CES process that controls cytochrome f synthesis is an assembly-dependent autoregulation of translation that involves a regulatory motif carried by the C-terminal domain of the unassembled protein and the 5' UTR of the petA mRNA (![]()
-subunit of the ATP synthase complex (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The present analysis of cytochrome f expression in a strain carrying a leaky allele of TCA1 showed that the mutated TCA1 factor became limiting in the CES process, as expected from a ternary CES effector. First, cytochrome f expression could no longer be stimulated in that leaky tca1 strain, even in the absence of the C-terminal regulatory motif of cytochrome f: The rate of synthesis of C-ter truncated mutated cytochrome f and wild-type cytochrome f remained similar in the tca1 leaky strain, although these two protein versions showed a threefold difference in their expression levels in a wild-type nuclear context. Second, due to the absence of subunit IV, cytochrome f accumulation in the tca1 leaky strain dropped from 15 to 3% of the wild-type level. The 5-fold repression observed in the presence of this tca1 leaky allele compared to the 10-fold repression observed in a wild-type TCA1 context can be attributed to the tca1 leaky allele. This tca1 leaky allele could correspond either to a drop in the concentration of a fully functional TCA1 factor or to a mutated TCA1 factor with altered function. Thus, the characteristics of the CES-mediated up- and downregulation of cytochrome f synthesis in the presence or absence of the tca1 leaky allele are consistent with TCA1 being the CES ternary effector. The molecular identification of TCA1 should open the way to a refined characterization of the mechanism underlying the regulation of cytochrome f synthesis by the CES process.
| ACKNOWLEDGMENTS |
|---|
We are grateful to D. Culler and S. Merchant for providing us with some of the mutant strains used in this work. We thank S. Bujaldon for technical assistance and D. Drapier and R. Kuras for critical reading of the manuscript and stimulating discussion during the course of this work. We also thank J. Maul and D. Stern for providing unpublished sequences from the Chloroplast genome sequencing project. This work was supported by CNRS/UPR1261. K. Wostrikoff was supported by a fellowship from the French Ministère de l'Education Nationale, de la Recherche et de la Technologie.
Manuscript received March 20, 2001; Accepted for publication June 22, 2001.
| LITERATURE CITED |
|---|
BARKAN, A. and M. GOLDSCHMIDT-CLERMONT, 2000 Participation of nuclear gene in chloroplast gene expression. Biochimie 82:559-572[Medline].
BARKAN, A., M. WALKER, M. NOLASCO, and D. JOHNSON, 1994 A nuclear mutation in maize blocks the processing and translation of several chloroplast mRNAs and provides evidence for the differential translation of alternative mRNA forms. EMBO J. 13:3170-3181[Medline].
BAYMANN, F., F. ZITO, R. KURAS, L. MINAI, and W. NITSCHKE et al., 1999 Functional characterization of Chlamydomonas mutants defective in cytochrome f maturation. J. Biol. Chem. 274:22957-22967
BENNOUN, P. and D. BEAL, 1997 Screening algal mutant colonies with altered thylakoid electrochemical gradient through fluorescence and delayed luminescence digital imaging. Photosynth. Res. 51:161-165.
BENNOUN, P., and P. DELEPELAIRE, 1982 Isolation of photosynthesis mutants in Chlamydomonas, pp. 2538 in Methods in Chloroplast Molecular Biology, edited by M. EDELMAN, N.-H. CHUA AND R. B. HALLICK. Elsevier Biomedical Press, Amsterdam/New York.
BENNOUN, P., M. SPIERER-HERZ, J. ERICKSON, J. GIRARD-BASCOU, and Y. PIERRE et al., 1986 Characterization of photosystem II mutants of Chlamydomonas reinhardii lacking the psbA gene. Plant Mol. Biol. 6:151-160.
BUSCHLEN, S., Y. CHOQUET, R. KURAS, and F. A. WOLLMAN, 1991 Nucleotide sequences of the continuous and separated petA, petB and petD chloroplast genes in Chlamydomonas reinhardtii. FEBS Lett. 284:257-262[Medline].
CHOQUET, Y. and O. VALLON, 2000 Synthesis, assembly and degradation of thylakoid membrane proteins. Biochimie 82:615-634[Medline].
CHOQUET, Y., M. RAHIRE, J. GIRARD-BASCOU, J. ERICKSON, and J. D. ROCHAIX, 1992 A chloroplast gene is required for the light-independent accumulation of chlorophyll in Chlamydomonas reinhardtii. EMBO J. 11:1697-1704[Medline].
CHOQUET, Y., D. B. STERN, K. WOSTRIKOFF, R. KURAS, and J. GIRARD-BASCOU et al., 1998 Translation of cytochrome f is autoregulated through the 5' untranslated region of petA mRNA in Chlamydomonas chloroplasts. Proc. Natl. Acad. Sci. USA 95:4380-4385
DE VITRY, C., J. OLIVE, D. DRAPIER, M. RECOUVREUR, and F. A. WOLLMAN, 1989 Posttranslational events leading to the assembly of photosystem II protein complex: a study using photosynthesis mutants from Chlamydomonas reinhardtii. J. Cell Biol. 109:991-1006
DRAGER, R. G., J. GIRARD-BASCOU, Y. CHOQUET, K. L. KINDLE, and D. B. STERN, 1998 In vivo evidence for 5'
3' exoribonuclease degradation of an unstable chloroplast mRNA. Plant J. 13:85-96[Medline].
DRAPIER, D., J. GIRARD-BASCOU, and F.-A. WOLLMAN, 1992 Evidence for nuclear control of the expression of the atpA and atpB chloroplast genes in Chlamydomonas. Plant Cell 4:283-295
DRAPIER, D., H. SUZUKI, H. LEVY, B. RIMBAULT, and K. L. KINDLE et al., 1998 The chloroplast atpA gene cluster in Chlamydomonas reinhardtii. Functional analysis of a polycistronic transcription unit. Plant Physiol. 117:629-641
ERICKSON, J. M., M. RAHIRE, P. MALNOE, J. GIRARD-BASCOU, and Y. PIERRE et al., 1986 Lack of the D2 protein in a Chlamydomonas reinhardtii psbD mutant affects photosystem II stability and D1 expression. EMBO J. 5:1745-1754[Medline].
FAN, W. H., M. A. WOELFLE, and G. MOSIG, 1995 Two copies of a DNA element, 'Wendy', in the chloroplast chromosome of Chlamydomonas reinhardtii between rearranged gene clusters. Plant Mol. Biol. 29:63-80[Medline].
FISK, D. G., M. B. WALKER, and A. BARKAN, 1999 Molecular cloning of the maize gene crp1 reveals similarity between regulators of mitochondrial and chloroplast gene expression. EMBO J. 18:2621-2630[Medline].
FOX, T. D., 1996 Genetics of mitochondrial translation, pp. 733758 in Translational Control, edited by J. W. B. HERSHEY, M. B. MATHEWS and N. SONENBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
GAMBLE, P. E. and J. E. MULLET, 1989 Translation and stability of proteins encoded by the plastid psbA and psbB genes are regulated by a nuclear gene during light-induced chloroplast development in barley. J. Biol. Chem. 264:7236-7243
GIRARD, J., N.-H. CHUA, P. BENNOUN, G. H. SCHMID, and M. DELOSME, 1980 Studies of mutants deficient in the photosystem I reaction centers in Chlamydomonas reinhardtii. Curr. Genet. 2:215-221.
GIRARD-BASCOU, J., Y. CHOQUET, M. SCHNEIDER, M. DELOSME, and M. DRON, 1987 Characterization of a chloroplast mutation in the psaA2 gene of Chlamydomonas reinhardtii. Curr. Genet. 12:489-495[Medline].
GIRARD-BASCOU, J., Y. PIERRE, and D. DRAPIER, 1992 A nuclear mutation affects the synthesis of the chloroplast psbA gene production Chlamydomonas reinhardtii. Curr. Genet. 22:47-52[Medline].
GIRARD-BASCOU, J., Y. CHOQUET, N. J. GUMPEL et al., 1995 Nuclear control of the expression of the chloroplast pet genes in Chlamydomonas reinhardtii, pp. 683686 in Photosynthesis: From Light to Biosphere, edited by P. MATHIS. Kluwer Academic Publishers, Dordrecht, The Netherlands.
GOLDSCHMIDT-CLERMONT, M., 1991 Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker of site-directed transformation of Chlamydomonas. Nucleic Acids Res. 19:4083-4089
GOLDSCHMIDT-CLERMONT, M., J. GIRARD-BASCOU, Y. CHOQUET, and J. D. ROCHAIX, 1990 Trans-splicing mutants of Chlamydomonas reinhardtii. Mol. Gen. Genet. 223:417-425[Medline].
GUMPEL, N. J., L. RALLEY, J. GIRARD-BASCOU, F. A. WOLLMAN, and J. H. NUGENT et al., 1995 Nuclear mutants of Chlamydomonas reinhardtii defective in the biogenesis of the cytochrome b6f complex. Plant Mol. Biol. 29:921-932[Medline].
HARRIS, E. H., 1989 The Chlamydomonas Source Book: A Comprehensive Guide to Biology and Laboratory Use. Academic Press, San Diego.
HIGGS, D. C., R. KURAS, K. L. KINDLE, F. A. WOLLMAN, and D. B. STERN, 1998 Inversions in the Chlamydomonas chloroplast genome suppress a petD 5' untranslated region deletion by creating functional chimeric mRNAs. Plant J. 14:663-671[Medline].
JENSEN, K. H., D. L. HERRIN, F. G. PLUMLEY, and G. W. SCHMIDT, 1986 Biogenesis of photosystem II complexes: transcriptional, translational, and posttranslational regulation. J. Cell Biol. 103:1315-1325
KHREBTUKOVA, I. and R. J. SPREITZER, 1996 Elimination of the Chlamydomonas gene family that encodes the small subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase. Proc. Natl. Acad. Sci. USA 93:13689-13693
KIM, J., P. G. KLEIN, and J. E. MULLET, 1994 Vir-115 gene product is required to stabilize D1 translation intermediates in chloroplasts. Plant Mol. Biol. 25:459-467[Medline].
KUCHKA, M., S. MAYFIELD, and J.-D. ROCHAIX, 1988 Nuclear mutations specifically affect the synthesis and/or degradation of the chloroplast-encoded D2 polypeptide of photosystem II in Chlamydomonas reinhardtii. EMBO J. 7:319-324[Medline].
KURAS, R. and F.-A. WOLLMAN, 1994 The assembly of cytochrome b6f complexes: an approach using genetic transformation of the green alga Chlamydomonas reinhardtii.. EMBO J. 13:1019-1027[Medline].
KURAS, R., S. BUSCHLEN, and F. A. WOLLMAN, 1995a Maturation of pre-apocytochrome f in vivo. A site-directed mutagenesis study in Chlamydomonas reinhardtii. J. Biol. Chem. 270:27797-27803
KURAS, R., F.-A. WOLLMAN, and P. JOLIOT, 1995b Conversion of cytochrome f to a soluble form in vivo in Chlamydomonas reinhardtii. Biochemistry 34:7468-7475[Medline].
KURAS, R., C. DE VITRY, Y. CHOQUET, J. GIRARD-BASCOU, and D. CULLER et al., 1997 Molecular genetic identification of a pathway for heme binding to cytochrome b6. J. Biol. Chem. 272:32427-32435
LEMAIRE, C., J. GIRARD-BASCOU, F.-A. WOLLMAN, and P. BENNOUN, 1986 Studies on the cytochrome b6f complex I. Characterization of the complex subunits in Chlamydomonas reinhardtii. Biochim. Biophys. Acta 851:229-238.
LI, H. H., J. QUINN, D. CULLER, J. GIRARD-BASCOU, and S. MERCHANT, 1996 Molecular genetic analysis of plastocyanin biosynthesis in Chlamydomonas reinhardtii. J. Biol. Chem. 271:31283-31289
MCCORMAC, D. J. and A. BARKAN, 1999 A nuclear gene in maize required for the translation of the chloroplast atpB/E mRNA. Plant Cell 11:1709-1716
NILSSON, B., M. UHLEN, S. JOSEPHSON, S. GATENBECK, and L. PHILIPSON, 1983 An improved positive selection plasmid vector constructed by oligonucleotide mediated mutagenesis. Nucleic Acids Res. 11:8019-8030
RATTANACHAIKUNSOPON, P., C. ROSCH, and M. R. KUCHKA, 1999 Cloning and characterization of the nuclear AC115 gene of Chlamydomonas reinhardtii. Plant Mol. Biol. 39:1-10[Medline].
ROCHAIX, J. D., M. KUCHKA, S. MAYFIELD, M. SCHIRMER-RAHIRE, and J. GIRARD-BASCOU et al., 1989 Nuclear and chloroplast mutations affect the synthesis or stability of the chloroplast psbC gene product in Chlamydomonas reinhardtii. EMBO J. 8:1013-1021[Medline].
SAKAMOTO, W., N. R. STURM, K. L. KINDLE, and D. B. STERN, 1994 petD mRNA maturation in Chlamydomonas reinhardtii chloroplasts: role of 5' endonucleolytic processing. Mol. Cell. Biol. 14:6180-6186
SMITH, T. A. and B. D. KOHORN, 1994 Mutations in a signal sequence for the thylakoid membrane identify multiple protein transport pathways and nuclear suppressors. J. Cell Biol. 126:365-374
STAMPACCHIA, O., J. GIRARD-BASCOU, J. L. ZANASCO, W. ZERGES, and P. BENNOUN et al., 1997 A nuclear-encoded function essential for translation of the chloroplast psaB mRNA in Chlamydomonas. Plant Cell 9:773-782[Abstract].
STURM, N. R., R. KURAS, S. BUSCHLEN, W. SAKAMOTO, and K. L. KINDLE et al., 1994 The petD gene is transcribed by functionally redundant promoters in Chlamydomonas reinhardtii chloroplasts. Mol. Cell. Biol. 14:6171-6179
TAKAHASHI, Y., M. GOLDSCHMIDT-CLERMONT, S. Y. SOEN, L. G. FRANZEN, and J. D. ROCHAIX, 1991 Directed chloroplast transformation in Chlamydomonas reinhardtii: insertional inactivation of the psaC gene encoding the iron sulfur protein destabilizes photosystem I. EMBO J. 10:2033-2040[Medline].
WOLLMAN, F. A., L. MINAI, and R. NECHUSHTAI, 1999 The biogenesis and assembly of photosynthetic proteins in thylakoid membranes. Biochim. Biophys. Acta 1411:21-85[Medline].
WU, H. Y. and M. R. KUCHKA, 1995 A nuclear suppressor overcomes defects in the synthesis of the chloroplast psbD gene product caused by mutations in two distinct nuclear genes of Chlamydomonas. Curr. Genet. 27:263-269[Medline].
WURTZ, E. A., J. E. BOYNTON, and N. W. GILLHAM, 1977 Perturbation of chloroplast DNA amounts and chloroplast gene transmission in Chlamydomonas reinhardtii by 5-fluorodeoxyuridine. Proc. Natl. Acad. Sci. USA 74:4552-4556
WURTZ, E. A., B. B. SEARS, D. K. RABERT, H. S. SHEPHERD, and N. W. GILLHAM et al., 1979 A specific increase in chloroplast gene mutations following growth of Chlamydomonas in 5-fluorodeoxyuridine. Mol. Gen. Genet. 170:235-242[Medline].
XIE, Z., D. CULLER, B. W. DREYFUSS, R. KURAS, and F. A. WOLLMAN et al., 1998 Genetic analysis of chloroplast c-type cytochrome assembly in Chlamydomonas reinhardtii: one chloroplast locus and at least four nuclear loci are required for heme attachment. Genetics 148:681-692
XU, R., S. E. BINGHAM, and A. N. WEBBER, 1993 Increased mRNA accumulation in a psaB frame-shift mutant of Chlamydomonas reinhardtii suggests a role for translation in psaB mRNA stability. Plant Mol. Biol. 22:465-474[Medline].
YOHN, C. B., A. COHEN, C. ROSCH, M. R. KUCHKA, and S. P. MAYFIELD, 1998 Translation of the chloroplast psbA mRNA requires the nuclear-encoded poly(A)-binding protein, RB47. J. Cell Biol. 142:435-442
ZERGES, W., 2000 Translation of mRNAs encoded by chloroplast genomes. Biochimie 82:583-601[Medline].
ZERGES, W. and J. D. ROCHAIX, 1994 The 5' leader of a chloroplast mRNA mediates the translational requirements for two nucleus-encoded functions in Chlamydomonas reinhardtii. Mol. Cell. Biol. 14:5268-5277
ZERGES, W., J. GIRARD-BASCOU, and J. D. ROCHAIX, 1997 Translation of the chloroplast psbC mRNA is controlled by interactions between its 5' leader and the nuclear loci TBC1 and TBC3 in Chlamydomonas reinhardtii. Mol. Cell. Biol. 17:3440-3448
ZITO, F., R. KURAS, Y. CHOQUET, H. KOSSEL, and F.-A. WOLLMAN, 1997 Mutations of cytochrome b6 in Chlamydomonas reinhardtii disclose the functional significance for a proline to leucine conversion by petB editing in maize and tobacco. Plant Mol. Biol. 33:79-86[Medline].
This article has been cited by other articles:
![]() |
C. Loiselay, N. J. Gumpel, J. Girard-Bascou, A. T. Watson, S. Purton, F.-A. Wollman, and Y. Choquet Molecular Identification and Function of cis- and trans-Acting Determinants for petA Transcript Stability in Chlamydomonas reinhardtii Chloroplasts Mol. Cell. Biol., September 1, 2008; 28(17): 5529 - 5542. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Raynaud, C. Loiselay, K. Wostrikoff, R. Kuras, J. Girard-Bascou, F.-A. Wollman, and Y. Choquet Evidence for regulatory function of nucleus-encoded factors on mRNA stabilization and translation in the chloroplast PNAS, May 22, 2007; 104(21): 9093 - 9098. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shao, O. Vallon, R. Dent, K. K. Niyogi, and C. F. Beck Defects in the Cytochrome b6/f Complex Prevent Light-Induced Expression of Nuclear Genes Involved in Chlorophyll Biosynthesis Plant Physiology, July 1, 2006; 141(3): 1128 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. de Vitry, Y. Ouyang, G. Finazzi, F.-A. Wollman, and T. Kallas The Chloroplast Rieske Iron-Sulfur Protein: AT THE CROSSROAD OF ELECTRON TRANSPORT AND SIGNAL TRANSDUCTION J. Biol. Chem., October 22, 2004; 279(43): 44621 - 44627. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Choquet, F. Zito, K. Wostrikoff, and F.-A. Wollman Cytochrome f Translation in Chlamydomonas Chloroplast Is Autoregulated by its Carboxyl-Terminal Domain PLANT CELL, June 1, 2003; 15(6): 1443 - 1454. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Wostrikoff, K.
- Articles by Girard-Bascou, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Wostrikoff, K.
- Articles by Girard-Bascou, J.














