Genetics, Vol. 158, 1505-1512, August 2001, Copyright © 2001

Strong Diversifying Selection on Domains of the Plasmodium falciparum Apical Membrane Antigen 1 Gene

Spencer D. Polleya and David J. Conwaya
a Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London WC1E 7HT, United Kingdom

Corresponding author: David J. Conway, Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel St., London WC1E 7HT, United Kingdom., david.conway{at}lshtm.ac.uk (E-mail)

Communicating editor: D. CHARLESWORTH


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The surface-accessible ectodomain region of the Plasmodium falciparum apical membrane antigen 1 (AMA1) is a malaria vaccine candidate. The amino acid sequence may be under selection from naturally acquired immune responses, and previous analyses with a small number of allele sequences indicate a non-neutral pattern of nucleotide variation. To investigate whether there is selection to maintain polymorphism within a population, and to identify the parts of the ectodomain under strongest selection, a sample of 51 alleles from a single endemic population was studied. Analyses using Fu and Li's D and F tests, Tajima's D test, and the McDonald-Kreitman test (with the chimpanzee parasite P. reichenowi as outgroup) show significant departure from neutrality and indicate the selective maintenance of alleles within the population. There is also evidence of a very high recombination rate throughout the sequence, as estimated by the recombination parameter, C, and by the rapid decline in linkage disequilibrium with increasing nucleotide distance. Of the three domains (I–III) encoding structures determined by disulfide bonds, the evidence of selection is strongest for Domains I and III. We predict that these domains in particular are targets of naturally acquired protective immune responses in humans.


A major factor in the evolution of parasites is likely to be the evasion of host immune responses. Where such responses have a memory component, as in vertebrates, rare pathogen alleles encoding antigenic types infrequently recognized by the host will have a selective, frequency-dependent advantage (BRUNHAM et al. 1993 Down). Patterns of nucleotide polymorphism within antigen genes under such selection should statistically depart from those predicted by neutral evolution models (TAJIMA 1989A Down; FU and LI 1993 Down). The ability to identify regions of antigen genes that are under such selection may help in finding targets of naturally acquired immunity in complex pathogens, such as the malaria parasite Plasmodium falciparum (CONWAY 1997 Down). A study on a major blood stage antigen gene (msp1) in P. falciparum identified a particular region likely to be under balancing selection, and a clear predictive association between the presence of antibodies to this region of the protein and protection from clinical malaria was subsequently shown (CONWAY et al. 2000A Down).

There is evidence that positive selection may be operating on several other antigen genes of P. falciparum (HUGHES and HUGHES 1995 Down; CONWAY 1997 Down; ESCALANTE et al. 1998 Down). These include the apical membrane antigen 1 (AMA1) gene, which encodes a membrane-bound protein on the erythrocyte-invading merozoite stage. Experimental studies in primates (infected with P. fragile or P. knowlesi) and rodents (infected with P. chabaudi) have shown that immunization with AMA1 protects against challenge infection (DEANS et al. 1988 Down; COLLINS et al. 1994 Down; and CREWTHER et al. 1996 Down). This protection was parasite strain-dependent in the mouse P. chabaudi system, suggesting that protective immune responses may be directed to polymorphic epitopes of AMA1 (CREWTHER et al. 1996 Down). Preliminary studies have shown the existence of antibodies, and responsive T cells, to P. falciparum AMA1 in humans living in endemic African populations (THOMAS et al. 1994 Down; LAL et al. 1996 Down; RILEY et al. 2000 Down), but protective epitopes have not yet been demonstrated.

Previous sequence analysis of the AMA1 gene in P. falciparum has revealed an excessive level of nonsynonymous vs. synonymous polymorphism, and this suggests that the locus is under diversifying selection, even though part of the effect is due to codon bias in this A + T rich parasite (HUGHES and HUGHES 1995 Down; ESCALANTE et al. 1998 Down; VERRA and HUGHES 2000 Down). A recent comparison with the sequence from P. reichenowi (a closely related parasite of chimpanzees), applying the McDonald-Kreitman test, demonstrates a non-neutral excess of nonsynonymous polymorphic sites in P. falciparum (KOCKEN et al. 2000 Down). This effect is apparently on the region of the gene encoding the mature protein ectodomain (rather than the N-terminal signal and prosequence, which is cleaved). Analyses that require a large sample of sequences from a single population (TAJIMA 1989A Down, TAJIMA 1989B Down; FU and LI 1993 Down) have not been performed effectively due to the small number and diverse origin of sequences available.

Here, 51 AMA1 ectodomain gene sequences are sampled from one endemic African population. Comprehensive analyses with several independent tests show evidence of positive selection and recombination across the entire sequence. The signature of selection is seen most strongly in two regions previously identified as encoding domains defined by several disulfide bridges (Domains I and III). These new data provide very strong evidence for diversifying selection on AMA1, and the specific distribution of this effect in regions of the antigen is of relevance to vaccine research.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Sample selection and DNA extractions:
Blood samples from subjects in Ibadan, South-West Nigeria, who were naturally infected with P. falciparum, had been previously prepared for parasite DNA analysis (CONWAY et al. 1999 Down, CONWAY et al. 2000A Down, CONWAY et al. 2000B Down). The P. falciparum AMA1 gene was amplified from 49 of these samples that had each appeared to contain only a single clone infection as determined by typing of the polymorphic msp1 gene (CONWAY et al. 1999 Down, CONWAY et al. 2000A Down).

AMA1 amplification and sequencing:
Malaria parasites in the human host are haploid, and thus each contains only one allele of the single locus AMA1 gene. Codons 143–598, encompassing the region of the AMA1 gene encoding the mature protein ectodomain, were sequenced in each sample. Three overlapping templates encoding codons 143–350, codons 312–379, and codons 344–598 were separately amplified by PCR using primers AMA1F143 (5'-GACTTCCATCAGGGAAATGTCC-3') and AMA1R350 (5'-TTAGGTTGATCCGAAGCACTCAA-3'); AMA1F312 (5'-CGGATTATGGGTCGATGGAAATTG-3') and AMA1R379 (5'-CTGCTTTAAAAGCACCAGTGGGAAG-3' and AMA1F344 (5'-TTGAGTGCTTCGGATCAACCTAA-3') and AMA1R598 (5'-GCCTCAGGATCTAACATTTCATC-3'), respectively, using 40 rounds of amplification (codon numbers taken from HODDER et al. 1996 Down). Fig 1 shows a representation of the regions of the AMA1 gene sequenced and the primers used. The resulting 624-bp, 202-bp, and 769-bp amplification products were agarose gel purified using the Gel Extraction spin kit (QIAGEN, Crawley, UK), as per manufacturer's protocol for preparation of templates for direct sequencing, and sequenced using big dye (Applied Biosystems, Warrington, UK) termination chemistry in both forward and reverse directions. The reactions were run on an ABI prism 377 automated sequencer and forward and reverse reactions from each allele were aligned and analyzed to ensure sequence fidelity using the Sequence Navigator software (Applied Biosystems). The three fragments from each allele were then aligned against a reference sequence (EMBL reference U33277) to create a single contiguous sequence. For two isolates, which were each found to contain two different parasite alleles, the PCR products were cloned into pGEM-T vector using the TA cloning kit (Promega, Madison, WI) and five random clones were sequenced from each. From these two isolates, a fourth region (1038 bp, codons 147–492) was also amplified from the original genomic DNA using primers AMA1F146 (5'GGAAATGTCCAGTATTTGGTAAAGG3') and AMA1R492 (5'CACATGGGCATTTTAAACTGTC3') and cloned and sequenced in forward and reverse orientations, to assemble the allelic sequences into distinct haplotypes. Any singleton polymorphisms that occurred in the data set were confirmed by independent amplification of the template from the original genomic DNA and resequencing to ensure that they were not errors.



View larger version (11K):
In this window
In a new window
Download PPT slide
 
Figure 1. Sequencing strategy for the AMA1 gene and the positions of primers used to amplify products. PCR products are shown above the coding region of AMA1 as solid lines, while primers are represented by an arrow. The codon numbers for the open reading frame (shown by the bottom scheme) are taken from the HB3 sequence (EMBL reference U33277), with the domains of AMA1 as described by HODDER et al. 1996 Down shown as shaded boxes.

Sequence alignment and analysis:
A single contiguous sequence of 1311 nucleotides (excluding outer primers) was derived for each of the 51 AMA1 alleles in the sample (one from each of 47 isolates and two from each of the remaining 2 isolates). These were aligned using the CLUSTAL program in MEGALIGN (DNAStar) and exported as a NEXUS alignment for statistical analyses using the DnaSP3.52 software (ROZAS and ROZAS 1999 Down). Analyses of recombination and tests of neutrality were as follows.

Analysis of recombination and linkage disequilibrium:
Analysis of recombination in AMA1 was performed on the alignment of 51 sequences to calculate the minimum number of recombination events that have occurred throughout the sequence (HUDSON and KAPLAN 1985 Down) and to estimate the recombination parameter, C, equal to 4Nr where N is the effective population size and r is the probability of recombination between adjacent nucleotides per generation (HUDSON 1987 Down). The D' (LEWONTIN 1964 Down) and R2 (HILL and ROBERTSON 1968 Down) indices of linkage disequlibrium were considered quantitatively between sites at which rare alleles had a frequency of >0.1, and the relationship between linkage disequilibrium and distance between nucleotide sites was plotted.

Tajima's D test:
This tests for a departure from the neutral evolution model by comparing the estimations of nucleotide diversity ({theta}), calculated alternatively from {pi} (average pairwise nucleotide diversity) and the total number of mutations. Under a panmictic constant-size neutral model, the expectations of {pi} and {theta} are the same, but under balancing selection rare alleles have an advantage and are thus maintained at intermediate frequencies, yielding a positive value of D (TAJIMA 1989A Down). The analysis was performed on each of the three domains of the ectodomain of AMA1, in addition to the whole sequence, which was also analyzed using a sliding window approach.

Fu and Li's D and F tests:
In these tests, departures from neutrality are identified as a deviation between estimates of {theta}, derived from the number of mutations in external branches of the phylogeny, and from the total number of mutations (giving the index D) or from the the average pairwise diversity (giving the index F). A deficit of mutations in external branches results in positive values of D and F, indicative of the presence of unusually ancient alleles that are probably maintained by balancing selection (FU and LI 1993 Down). The AMA1 sequence of the closely related species P. reichenowi (accession no. AJ252087; KOCKEN et al. 2000 Down) was used as an outgroup for these analyses. The analysis was performed on each of the three domains (I–III) and on the whole sequence, which was also analyzed using a sliding window approach.

Coalescent simulations:
Tajima's and Fu and Li's tests have been predicted to give conservative estimates of the departure from neutrality when recombination has occurred between alleles (TAJIMA 1989A Down; WALL 1999 Down). Therefore, critical values of Tajima's and Fu and Li's indices under neutrality were also calculated, assuming differing levels of recombination using coalescent simulations (HUDSON 1990 Down), and compared to the actual values observed with the data set. The 95% confidence intervals of the neutral distributions were calculated using 10,000 coalescent simulations in DnaSP3.52, and statistical significance was inferred where the observed value lay outside these (P < 0.05). In these cases, the 99% confidence intervals were also calculated to determine whether the data were also significant at a higher level (P < 0.01).

The McDonald-Kreitman test:
This tests for different ratios of synonymous to nonsynonymous changes within and between species (MCDONALD and KREITMAN 1991 Down). The P. reichenowi AMA1 sequence was used for the interspecific comparison with P. falciparum (KOCKEN et al. 2000 Down). The analysis was performed on each of the three domains (I–III) of the ectodomain of AMA1, in addition to the whole ectodomain sequence. Codons with a complex evolutionary history that were ignored by the computer analysis were analyzed by eye according to the guidelines given in DNAsp3.5. Fisher's exact test was then applied to the data to test for significant nonrandomness, and skew from randomness was also calculated as the "neutrality index" (Rand AND KANN 1996 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Sequence diversity:
The sequences of 51 alleles of AMA1 sampled from the Nigerian population were determined and aligned for analysis. Sequences are available as an alignment (EMBL accession no. ALIGN_000019; individual sequence accession nos. AJ408300–50). Within the 1311-bp region sequenced there were 62 polymorphic sites (the polymorphic nucleotides of all 51 alleles are shown in Fig 2). Fifty-seven of these sites were dimorphic (two alleles), and the remaining 5 were trimorphic (three alleles). Eighteen of the nucleotide polymorphisms are novel to this data set, all of which cause amino acid replacements. Average pairwise nucleotide diversity per site ({pi}) was 0.01642. Fig 3A shows a sliding window plot of {pi} across the entire region. A representation of the positions of the three previously determined domains of AMA1 is shown above the plot, each bounded by terminal cysteine codons (as in Table 1). Although the polymorphic sites are distributed throughout the gene, 38 of them are in Domain I, while Domains II and III have only 9 polymorphic sites each. Similarly, the pairwise diversity is highest in Domain I ({pi} = 0.027).



View larger version (63K):
In this window
In a new window
Download PPT slide
 
Figure 2. Polymorphic nucleotides in 1311 bp sequenced from 51 Nigerian alleles of P. falciparum AMA1 (full alignment available as EMBL accession no. ALIGN_000019 at the following URL address: ftp://ftp.ebi.ac.uk/pub/databases/embl/align/). The three synonymous polymorphisms are shown in italics, including site 603, which is part of a codon with a complex evolutionary history. Nucleotide positions in the gene are written vertically above the polymorphic sites.



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 3. Sliding window plot of (A) average pairwise diversity ({pi}), (B) Tajima's D value, and (C) Fu and Li's D and F values across AMA1. A window size of 100 nucleotides was used for the analysis of {pi}, while a window size of 200 nucleotides was used for the analysis of Tajima's D and Fu and Li's D and F . The three domains of AMA1 are represented within the first plot as lines labeled DI, DII, and DIII, representing Domains I, II, and III, respectively.


 
View this table:
In this window
In a new window

 
Table 1. Summary of statistics for AMA1 and tests for departure from neutrality

Recombination and linkage disequilibrium:
In total there were 45 different allele sequences among the 51 sampled (Fig 2). The HUDSON and KAPLAN 1985 Down algorithm estimated a minimum number of 24 recombination events having occurred among the sequences. The recombination parameter, C, equal to 4Nr (HUDSON 1987 Down), was estimated at 0.158 between adjacent sites and 207 for the whole sequence. Linkage disequilibrium was calculated for the data set using dimorphic sites at which the frequency of the minor allele was at least 0.1. Fig 4 shows the relationship between nucleotide distance between pairs of sites and R2 and D' indices of linkage disequilibrium. Both R2 and D' decline rapidly with distance, and most of the statistically significant linkage disequilibrium is between sites <500 bp apart. The high value of the recombination parameter, and the very rapid decay of linkage disequilibrium, are independent and concordant indicators of a very high meiotic recombination rate in the gene.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 4. Linkage disequlibrium across the AMA1 gene as calculated using (A) R2 and (B) D'. Those pairs of sites that show significant linkage disequilibrium as calculated by Fisher's exact test are shown as solid circles, while all other pairs of sites are represented by small crosses.

Tajima's D test:
Table 1 shows positive values of D for the region as a whole and each domain separately. The D value for Domain III shows a significant positive departure from zero. Fig 3B shows a sliding window plot for Tajima's D value, illustrating that Domain III emerges as the most highly positive. This results from a greater number of nucleotide alleles at intermediate frequencies compared with expectations under neutrality.

Fu and Li's D and F tests:
Table 1 gives the D and F values for each domain in isolation and the region as a whole. Values for the whole of the ectodomain, and for Domain I on its own, are significantly greater than zero. These result from a significantly fewer number of mutations occurring in external branches of a phylogeny compared to that predicted by either the average pairwise diversity or the total number of mutations. This is evidence that there are long internal branches in the phylogeny of this gene, which is consistent with balancing selection-maintaining alleles in both Domain I and the sequenced region as a whole, as seen in a sliding window plot of D and F (Fig 3C).

Coalescent simulations:
Table 2 shows the upper 95% confidence intervals for the expected values of Tajima's D and Fu and Li's F under neutrality and the observed values for the sequence as a whole and for each domain (I–III). These are given for different levels of recombination (C), ranging from 0 to 100 (the maximum range available in the DnaSP 3.52 program, which is less than the value of 207 estimated above, and so still tends toward conservatism). The simulations show that when C is set at the relatively modest value of 20, the observed data depart from neutrality more significantly than was apparent in Table 1. For example, Tajima's D value shows a significant departure from zero for the sequence as a whole (P < 0.01), and Domain III is also highly significant (P < 0.01). When C is set at 50, the observed Tajima's D value for Domain I on its own is also significant (P < 0.05). For Fu and Li's F test, the sequence as a whole and Domain I on its own show a highly significant depature from 0 when C is set at 20 (P < 0.01), and the test for Domain III approaches significance. In contrast, Domain II fails to show a significant departure from neutrality with any test, assuming any level of recombination.


 
View this table:
In this window
In a new window

 
Table 2. Results of Tajima's D test and Fu and Li's F test with recombination

McDonald-Kreitman test:
Table 3 gives the results of the McDonald-Kreitman test for the whole sequence and for the domains taken individually, comparing polymorphism within P. falciparum and fixed differences between P. falciparum and P. reichenowi. The sequence as a whole shows a significant departure from neutrality with a high excess of intraspecific nonsynonymous polymorphisms. All three of the domains show the same trend, indicating that diversifying selection is occurring across the whole of the sequence, and this is statistically significant for Domain I. The small number of fixed differences between species in Domains II and III means that the test has less power for these domains.


 
View this table:
In this window
In a new window

 
Table 3. Summary of results of McDonald and Kreitman analysis of AMA1


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The signature of natural selection on particular domains of the P. falciparum AMA1 gene is very strong. Previous analyses of a small number of alleles indicated that positive selection had probably operated (HUGHES and HUGHES 1995 Down; ESCALANTE et al. 1998 Down; VERRA and HUGHES 2000 Down), in particular on the surface-associated ectodomain (KOCKEN et al. 2000 Down). By studying a large number of alleles sampled from a single population, the present study aimed to test independently for selection and to locate the regions of the sequence under the strongest selection. Several different tests were used, which complement and re-enforce each other, giving strongly consistent results.

The three domains (I–III) defined as disulfide-bonded structures (HODDER et al. 1996 Down) show different patterns of nucleotide diversity, with Domain I having a higher number of polymorphic sites and nucleotide diversity than Domains II and III. There is significant evidence for balancing selection on Domain I, as shown by Tajima's D and Fu and Li's D and F tests. There is also significant evidence for balancing selection on Domain III, as shown by Tajima's D test and Fu and Li's F tests approaching significance (note that the smaller number of polymorphic sites in this domain gives less power than for the analysis of Domain I). In contrast with Domains I and III, there was no significant evidence of selection on Domain II.

Recombination is very frequent in the AMA1 gene, as shown by the high estimate of the recombination parameter, C, and the very rapid decline in linkage disequilibrium with increasing distance between nucleotide sites (there is no significant linkage disequilibrium between pairs of sites more than ~600 nucleotides apart). This is similar to the rapid decline in linkage disequilibrium with distance already reported in the P. falciparum gene msp1, in this and most other African populations studied (CONWAY et al. 1999 Down), and reflects the high meiotic recombination rate throughout the P. falciparum genome (SU et al. 1999 Down). If the average recombination rate in the genome is considered, determined experimentally by SU et al. 1999 Down as 1 cM per 17 kb of sequence, this equates to a probability of recombination between adjacent nucleotides, r = 6 x 10-7 (i.e., the reciprocal of 1 M = 1.7 Mb). With this value of r, we can estimate the genetically effective population size N, using the recombination parameter equation C = 4Nr (HUDSON 1987 Down), as we have an estimate here of C = 0.158 (between adjacent nucleotides). Thus, N = C /4r = 6.6 x 104, which is very similar to estimates for African populations of ~104 derived by ANDERSON et al. 2000 Down using an entirely different approach (based on estimates of heterozygosity and mutation rates of microsatellite loci).

Recombination is predicted to make Tajima's and Fu and Li's tests conservative in identifying statistically significant positive deviations from neutrality. When recombination is accounted for by use of coalescent simulations, more significant departures from neutrality can be observed. It is only by the use of this approach that the ectodomain sequence as a whole, and Domain I on its own, shows a clear positive departure from neutrality with Tajima's D test. The D value for Domain II, by contrast, stays well within the 95% confidence intervals, even when the highest level of recombination is used to generate the neutral expectations. With Fu and Li's F test, Domains II and III do not show significant departure from neutrality, although the results do tend toward significance for Domain III (P < 0.1) when the 95% confidence intervals under neutrality are calculated assuming a high level of recombination.

Some effects on Tajima's (and similarly on Fu and Li's) indices can be due to population substructure, or changes in population size, in ways that can mimic the patterns of selection (TAJIMA 1989B Down; FU 1996 Down; WALL 1999 Down). Here, we studied alleles from a single population sample to avoid substructure generated by pooling alleles from different populations. Theoretically, if a population size declines drastically, the number of segregating sites is reduced more markedly than the average number of nucleotide differences (TAJIMA 1989C Down), and this can result in transiently positive values for D . Analysis of microsatellite allele frequency distributions does not suggest that any such decline has occurred recently in African populations of P. falciparum (ANDERSON et al. 2000 Down). The stable, high endemicity of malaria in the area from which samples were studied here is typical in much of Africa, and thus the positive Tajima's D values obtained here can be attributed to balancing selection. In an expanding population, conversely, there would be a tendency for Tajima's D values to be negative (TAJIMA 1989C Down). There is evidence to indicate that P. falciparum emerged and expanded from a small founding population in Africa some thousands, or tens of thousands, of years ago (CONWAY et al. 2000B Down), and thus any skewing of neutral Tajima's D values would be in the opposite direction to that observed in the data.

The McDonald-Kreitman test using the allele sequences obtained here gives a consistent, but even more highly statistically significant, result than that obtained previously with a small number of other alleles. The present analysis has more power, as there are more polymorphic nucleotides in the new sample of 51 alleles. This test could theoretically be affected if there were differences in the relative codon usage of the two species analyzed (NEI and KUMAR 2000 Down). However, comparison of codon prevalence between the P. falciparum and P. reichenowi AMA1 sequences shows a virtually identical pattern, and there is no evidence from other genes to suggest a difference in the codon bias in these closely related species. The large number of polymorphic sites in this study allows an analysis of individual domains, with Domain I clearly showing a significant excess of intraspecific nonsynonymous polymorphisms. This positive trend is also seen, although not significantly, in the other two domains, which have fewer polymorphic nucleotides.

Taken together, the sequence analyses presented here on a new population data set clearly show that the P. falciparum AMA1 gene is under selection, which is maintaining nucleotide polymorphisms, particularly those that are nonsynonymous. The strongest selection appears to act on sequences encoding Domains I and III, and we hypothesize that this is produced by the host immune system mounting an effective response to epitopes within these domains of the protein. We predict that immunological studies will demonstrate that human antibodies to polymorphic sequences in one or both of these domains inhibit parasites and protect against malaria.


*  ACKNOWLEDGMENTS

We thank Ayoade Oduola and Olumide Ogundahunsi for original sample collection and Jennie Lloyd and Zsusanna Mikes for technical assistance. We are also grateful to Ziheng Yang and Michael Gaunt for comments on the analyses and to Martin Holland and Kevin Tetteh for comments on the manuscript. This work was supported by the UK Medical Research Council (grant G9803180).

Manuscript received January 31, 2001; Accepted for publication May 14, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ANDERSON, T. J. C., B. HAUBOLD, J. T. WILLIAMS, J. G. ESTRADA-RFANCO, and L. RICHARDSON et al., 2000  Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol. Biol. Evol. 17:1467-1482[Abstract/Free Full Text].

BRUNHAM, R. C., F. A. PLUMMER, and R. S. STEPHENS, 1993  Bacterial antigenic variation, host immune response, and pathogen-host coevolution. Infect. Immun. 61:2273-2276[Free Full Text].

COLLINS, W. E., D. PYE, P. E. CREWTHER, K. L. VANDENBERG, and G. G. GALLAND et al., 1994  Protective immunity induced in squirrel monkeys with recombinant apical membrane antigen-1 of Plasmodium fragile. Am. J. Trop. Med. Hyg. 51:711-719.

CONWAY, D. J., 1997  Natural selection on polymorphic malaria antigens and the search for a vaccine. Parasitol. Today 13:26-29[Medline].

CONWAY, D. J., C. ROPER, A. M. ODUOLA, D. E. ARNOT, and P. G. KREMSNER et al., 1999  High recombination rate in natural populations of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 96:4506-4511[Abstract/Free Full Text].

CONWAY, D. J., D. R. CAVANAGH, K. TANABE, C. ROPER, and Z. S. MIKES et al., 2000a  A principal target of human immunity to malaria identified by molecular population genetic and immunological analyses. Nat. Med. 6:689-692[Medline].

CONWAY, D. J., C. FANELLO, J. M. LLOYD, B. M. A.-S. AL-JOUBORI, and A. H. BALOCH et al., 2000b  Origin of Plasmodium falciparum malaria is traced by mitochondrial DNA. Mol. Biochem. Parasitol. 111:163-171[Medline].

CREWTHER, P. E., M. L. MATTHEW, R. H. FLEGG, and R. F. ANDERS, 1996  Protective immune responses to apical membrane antigen 1 of Plasmodium chabaudi involve recognition of strain-specific epitopes. Infect. Immun. 64:3310-3317[Abstract].

DEANS, J. A., A. M. KNIGHT, W. C. JEAN, A. P. WATERS, and S. COHEN et al., 1988  Vaccination trials in rhesus-monkeys with a minor, invariant, Plasmodium knowlesi 66 kd merozoite antigen. Parasite Immunol. 10:535-552[Medline].

ESCALANTE, A. A., A. A. LAL, and F. J. AYALA, 1998  Genetic polymorphism and natural selection in the malaria parasite Plasmodium falciparum. Genetics 149:189-202[Abstract/Free Full Text].

FU, Y.-X., 1996  Statistical tests of neutrality for DNA samples from a population. Genetics 143:557-570[Abstract].

FU, Y.-X. and W.-H. LI, 1993  Statistical tests of neutrality of mutations. Genetics 133:693-709[Abstract].

HILL, W. G. and A. ROBERTSON, 1968  Linkage disequilibrium in finite populations. Theor. Appl. Genet. 38:226-231.

HODDER, A. N., P. E. CREWTHER, M. L. MATTHEW, G. E. REID, and R. L. MORITZ et al., 1996  The disulfide bond structure of Plasmodium apical membrane antigen-1. J. Biol. Chem. 271:29446-29452[Abstract/Free Full Text].

HUDSON, R. R., 1987  Estimating the recombination parameter of a finite population model without selection. Genet. Res. 50:245-250[Medline].

HUDSON, R. R., 1990  Gene genealogies and the coalescent process. Oxford Surv. Evol. Biol. 7:1-44.

HUDSON, R. R. and N. L. KAPLAN, 1985  Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164[Abstract/Free Full Text].

HUGHES, M. K. and A. L. HUGHES, 1995  Natural-selection on Plasmodium surface-proteins. Mol. Biochem. Parasitol. 71:99-113[Medline].

KOCKEN, C. H., D. L. NARUM, A. MASSOUGBODJI, B. AYIVI, and M. A. DUBBELD et al., 2000  Molecular characterisation of Plasmodium reichenowi apical membrane antigen-1 (AMA-1), comparison with P. falciparum AMA-1, and antibody-mediated inhibition of red cell invasion. Mol. Biochem. Parasitol. 109:147-156[Medline].

LAL, A. A., M. A. HUGHES, D. A. OLIVEIRA, C. NELSON, and P. B. BLOLAND et al., 1996  Identification of T-cell determinants in natural immune responses to the Plasmodium falciparum apical membrane antigen-1 (AMA-1) in an adult population exposed to malaria. Infect. Immun. 64:1054-1059[Abstract].

LEWONTIN, R. C., 1964  The interaction of selection and linkage. I. General considerations: heterotic models. Genetics 49:49-67[Free Full Text].

MCDONALD, J. H. and M. KREITMAN, 1991  Adaptive protein evolution at the Adh locus in Drosophila. Nature 351:652-654[Medline].

NEI, M., and S. KUMAR, 2000 Molecular Evolution and Phylogenetics. Oxford University Press, New York.

RAND, D. M. and L. M. KANN, 1996  Excess amino acid polymorphism in mitochondrial DNA: contrasts among genes from Drosophila, mice, and humans. Mol. Biol. Evol. 13:735-748[Abstract].

RILEY, E. M., G. E. WAGNER, M. F. OFORI, J. G. WHEELER, and B. D. AKANMORI et al., 2000  Lack of association between maternal antibody and protection of African infants from malaria infection. Infect. Immun. 68:5856-5863[Abstract/Free Full Text].

ROZAS, J. and R. ROZAS, 1999  DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175[Abstract/Free Full Text].

SU, X-Z., M. T. FERDIG, Y. HUANG, C. Q. HUYNH, and A. LIU et al., 1999  A genetic map and recombination parameters of the human malaria parasite P. falciparum.. Science 286:1351-1353[Abstract/Free Full Text].

TAJIMA, F., 1989a  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595[Abstract/Free Full Text].

TAJIMA, F., 1989b  DNA polymorphism in a subdivided population: the expected number of segregating sites in the two-subpopulation model. Genetics 123:229-240[Abstract/Free Full Text].

TAJIMA, F., 1989c  The effect of population size on DNA polymorphism. Genetics 123:597-601[Abstract/Free Full Text].

THOMAS, A. W., J. F. TRAPE, C. ROGIER, A. GONCALVES, and V. E. ROSARIO et al., 1994  High prevalence of natural antibodies against Plasmodium falciparum 83-kilodalton apical membrane antigen (PF83/AMA-1) as detected by capture-enzyme-linked immunosorbent assay using full-length baculovirus recombinant PF83/AMA-1. Am. J. Trop. Med. Hyg. 51:730-740.

VERRA, F. and A. L. HUGHES, 2000  Evidence for ancient balanced polymorphism at the Apical Membrane Antigen-1 (AMA-1) locus of Plasmodium falciparum. Mol. Biochem. Parasitol. 105:149-153[Medline].

WALL, J. D., 1999  Recombination and the power of statistical tests of neutrality. Genet. Res. Camb. 74:65-79.




This article has been cited by other articles:


Home page
Am J Trop Med HygHome page
F. B. Ntumngia, A. M. McHenry, J. W. Barnwell, J. Cole-Tobian, C. L. King, and J. H. Adams
Genetic Variation among Plasmodium vivax Isolates Adapted to Non-Human Primates and the Implication for Vaccine Development
Am J Trop Med Hyg, February 1, 2009; 80(2): 218 - 227.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Duan, J. Mu, M. A. Thera, D. Joy, S. L. Kosakovsky Pond, D. Diemert, C. Long, H. Zhou, K. Miura, A. Ouattara, et al.
Population structure of the genes encoding the polymorphic Plasmodium falciparum apical membrane antigen 1: Implications for vaccine design
PNAS, June 3, 2008; 105(22): 7857 - 7862.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. J. Remarque, B. W. Faber, C. H. M. Kocken, and A. W. Thomas
A Diversity-Covering Approach to Immunization with Plasmodium falciparum Apical Membrane Antigen 1 Induces Broader Allelic Recognition and Growth Inhibition Responses in Rabbits
Infect. Immun., June 1, 2008; 76(6): 2660 - 2670.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Miura, H. Zhou, O. V. Muratova, A. C. Orcutt, B. Giersing, L. H. Miller, and C. A. Long
In Immunization with Plasmodium falciparum Apical Membrane Antigen 1, the Specificity of Antibodies Depends on the Species Immunized
Infect. Immun., December 1, 2007; 75(12): 5827 - 5836.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
R. H. Orsi, D. R. Ripoll, M. Yeung, K. K. Nightingale, and M. Wiedmann
Recombination and positive selection contribute to evolution of Listeria monocytogenes inlA
Microbiology, August 1, 2007; 153(8): 2666 - 2678.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Dutta, S. Y. Lee, A. H. Batchelor, and D. E. Lanar
Structural basis of antigenic escape of a malaria vaccine candidate
PNAS, July 24, 2007; 104(30): 12488 - 12493.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. M. Gunasekera, T. Wickramarachchi, D. E. Neafsey, I. Ganguli, L. Perera, P. H. Premaratne, D. Hartl, S. M. Handunnetti, P. V. Udagama-Randeniya, and D. F. Wirth
Genetic Diversity and Selection at the Plasmodium vivax Apical Membrane Antigen-1 (PvAMA-1) Locus in a Sri Lankan Population
Mol. Biol. Evol., April 1, 2007; 24(4): 939 - 947.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
D. J. Conway
Molecular Epidemiology of Malaria
Clin. Microbiol. Rev., January 1, 2007; 20(1): 188 - 204.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. S. Guttman, S. J. Gropp, R. L. Morgan, and P. W. Wang
Diversifying Selection Drives the Evolution of the Type III Secretion System Pilus of Pseudomonas syringae
Mol. Biol. Evol., December 1, 2006; 23(12): 2342 - 2354.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. M. Coley, K. Parisi, R. Masciantonio, J. Hoeck, J. L. Casey, V. J. Murphy, K. S. Harris, A. H. Batchelor, R. F. Anders, and M. Foley
The Most Polymorphic Residue on Plasmodium falciparum Apical Membrane Antigen 1 Determines Binding of an Invasion-Inhibitory Antibody.
Infect. Immun., May 1, 2006; 74(5): 2628 - 2636.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Baum, D. Richard, J. Healer, M. Rug, Z. Krnajski, T.-W. Gilberger, J. L. Green, A. A. Holder, and A. F. Cowman
A Conserved Molecular Motor Drives Cell Invasion and Gliding Motility across Malaria Life Cycle Stages and Other Apicomplexan Parasites
J. Biol. Chem., February 24, 2006; 281(8): 5197 - 5208.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. S. Harris, J. L. Casey, A. M. Coley, R. Masciantonio, J. K. Sabo, D. W. Keizer, E. F. Lee, A. McMahon, R. S. Norton, R. F. Anders, et al.
Binding Hot Spot for Invasion Inhibitory Molecules on Plasmodium falciparum Apical Membrane Antigen 1
Infect. Immun., October 1, 2005; 73(10): 6981 - 6989.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. K. A. Tetteh, D. R. Cavanagh, P. Corran, R. Musonda, J. S. McBride, and D. J. Conway
Extensive Antigenic Polymorphism within the Repeat Sequence of the Plasmodium falciparum Merozoite Surface Protein 1 Block 2 Is Incorporated in a Minimal Polyvalent Immunogen
Infect. Immun., September 1, 2005; 73(9): 5928 - 5935.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. E. Neafsey, D. L. Hartl, and M. Berriman
Evolution of Noncoding and Silent Coding Sites in the Plasmodium falciparum and Plasmodium reichenowi Genomes
Mol. Biol. Evol., July 1, 2005; 22(7): 1621 - 1626.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
E. M. Malkin, D. J. Diemert, J. H. McArthur, J. R. Perreault, A. P. Miles, B. K. Giersing, G. E. Mullen, A. Orcutt, O. Muratova, M. Awkal, et al.
Phase 1 Clinical Trial of Apical Membrane Antigen 1: an Asexual Blood-Stage Vaccine for Plasmodium falciparum Malaria
Infect. Immun., June 1, 2005; 73(6): 3677 - 3685.
[Abstract] [Full Text] [PDF]


Home page
Am J Trop Med HygHome page
J. C. RAYNER, T. M. TRAN, V. CORREDOR, C. S. HUBER, J. W. BARNWELL, and M. R. GALINSKI
DRAMATIC DIFFERENCE IN DIVERSITY BETWEEN PLASMODIUM FALCIPARUM AND PLASMODIUM VIVAX RETICULOCYTE BINDING-LIKE GENES
Am J Trop Med Hyg, June 1, 2005; 72(6): 666 - 674.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Healer, T. Triglia, A. N. Hodder, A. W. Gemmill, and A. F. Cowman
Functional Analysis of Plasmodium falciparum Apical Membrane Antigen 1 Utilizing Interspecies Domains
Infect. Immun., April 1, 2005; 73(4): 2444 - 2451.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Yang
The power of phylogenetic comparison in revealing protein function
PNAS, March 1, 2005; 102(9): 3179 - 3180.
[Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Cortes, M. Mellombo, R. Masciantonio, V. J. Murphy, J. C. Reeder, and R. F. Anders
Allele Specificity of Naturally Acquired Antibody Responses against Plasmodium falciparum Apical Membrane Antigen 1
Infect. Immun., January 1, 2005; 73(1): 422 - 430.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
P. V. Lalitha, L. A. Ware, A. Barbosa, S. Dutta, J. K. Moch, J. D. Haynes, B. B. Fileta, C. E. White, and D. E. Lanar
Production of the Subdomains of the Plasmodium falciparum Apical Membrane Antigen 1 Ectodomain and Analysis of the Immune Response
Infect. Immun., August 1, 2004; 72(8): 4464 - 4470.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. T. Herbeck, D. J. Funk, P. H. Degnan, and J. J. Wernegreen
A Conservative Test of Genetic Drift in the Endosymbiotic Bacterium Buchnera: Slightly Deleterious Mutations in the Chaperonin groEL
Genetics, December 1, 2003; 165(4): 1651 - 1660.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. D. Polley, W. Chokejindachai, and D. J. Conway
Allele Frequency-Based Analyses Robustly Map Sequence Sites Under Balancing Selection in a Malaria Vaccine Candidate Antigen
Genetics, October 1, 2003; 165(2): 555 - 561.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
S. Nair, J. T. Williams, A. Brockman, L. Paiphun, M. Mayxay, P. N. Newton, J.-P. Guthmann, F. M. Smithuis, T. T. Hien, N. J. White, et al.
A Selective Sweep Driven by Pyrimethamine Treatment in Southeast Asian Malaria Parasites
Mol. Biol. Evol., September 1, 2003; 20(9): 1526 - 1536.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. S. Mueller, A. Renard, F. Boato, D. Vogel, M. Naegeli, R. Zurbriggen, J. A. Robinson, and G. Pluschke
Induction of Parasite Growth-Inhibitory Antibodies by a Virosomal Formulation of a Peptidomimetic of Loop I from Domain III of Plasmodium falciparum Apical Membrane Antigen 1
Infect. Immun., August 1, 2003; 71(8): 4749 - 4758.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Anisimova, R. Nielsen, and Z. Yang
Effect of Recombination on the Accuracy of the Likelihood Method for Detecting Positive Selection at Amino Acid Sites
Genetics, July 1, 2003; 164(3): 1229 - 1236.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Baum, A. W. Thomas, and D. J. Conway
Evidence for Diversifying Selection on Erythrocyte-Binding Antigens of Plasmodium falciparum and P. vivax
Genetics, April 1, 2003; 163(4): 1327 - 1336.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Cortes, M. Mellombo, I. Mueller, A. Benet, J. C. Reeder, and R. F. Anders
Geographical Structure of Diversity and Differences between Symptomatic and Asymptomatic Infections for Plasmodium falciparum Vaccine Candidate AMA1
Infect. Immun., March 1, 2003; 71(3): 1416 - 1426.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. C. Kennedy, J. Wang, Y. Zhang, A. P. Miles, F. Chitsaz, A. Saul, C. A. Long, L. H. Miller, and A. W. Stowers
In Vitro Studies with Recombinant Plasmodium falciparum Apical Membrane Antigen 1 (AMA1): Production and Activity of an AMA1 Vaccine and Generation of a Multiallelic Response
Infect. Immun., December 1, 2002; 70(12): 6948 - 6960.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. A. Gerber, A. B. Lopez, S. J. Shook, and F. P. Doerder
Polymorphism and Selection at the SerH Immobilization Antigen Locus in Natural Populations of Tetrahymena thermophila
Genetics, April 1, 2002; 160(4): 1469 - 1479.
[Abstract] [Full Text] [PDF]