Genetics, Vol. 158, 1457-1476, August 2001, Copyright © 2001

Meiotic Recombination Involving Heterozygous Large Insertions in Saccharomyces cerevisiae: Formation and Repair of Large, Unpaired DNA Loops

Hutton M. Kearneya, David T. Kirkpatrick1,a, Jennifer L. Gerton2,a, and Thomas D. Petesa
a Department of Biology, Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, North Carolina 27599-3280

Corresponding author: Thomas D. Petes, Department of Biology, University of North Carolina, Chapel Hill, NC 27599-3280., tompetes{at}email.unc.edu (E-mail)

Communicating editor: L. S. SYMINGTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Meiotic recombination in Saccharomyces cerevisiae involves the formation of heteroduplexes, duplexes containing DNA strands derived from two different homologues. If the two strands of DNA differ by an insertion or deletion, the heteroduplex will contain an unpaired DNA loop. We found that unpaired loops as large as 5.6 kb can be accommodated within a heteroduplex. Repair of these loops involved the nucleotide excision repair (NER) enzymes Rad1p and Rad10p and the mismatch repair (MMR) proteins Msh2p and Msh3p, but not several other NER (Rad2p and Rad14p) and MMR (Msh4p, Msh6p, Mlh1p, Pms1p, Mlh2p, Mlh3p) proteins. Heteroduplexes were also formed with DNA strands derived from alleles containing two different large insertions, creating a large "bubble"; repair of this substrate was dependent on Rad1p. Although meiotic recombination events in yeast are initiated by double-strand DNA breaks (DSBs), we showed that DSBs occurring within heterozygous insertions do not stimulate interhomologue recombination.


IN Saccharomyces cerevisiae, the exchange of genetic information during meiotic recombination is a highly coordinated process that involves introduction of a double-strand break (DSB) and repair of that break with sequences derived from the homologous chromosome (ROEDER 1997 Down; PAQUES and HABER 1999 Down). The enzyme responsible for DSB formation is the topoisomerase II-related protein Spo11p (KEENEY et al. 1997 Down). Following DSB formation, the 5' ends of the break are resected in a process requiring the Rad50p/Mre11p/Xrs2p complex, generating long, single-stranded DNA tails (ALANI et al. 1990 Down; MCKEE and KLECKNER 1997 Down; NAIRZ and KLEIN 1997 Down; PRINZ et al. 1997 Down). In the modified version of the double-strand break model (SZOSTAK et al. 1983 Down; SUN et al. 1991 Down), the 3'-ended tails invade the homologous chromosome, creating a heteroduplex DNA molecule (Fig 1). The displaced strand is used as a template for repair of the break. Ligation of the products results in double Holliday junction intermediates (SCHWACHA and KLECKNER 1994 Down, SCHWACHA and KLECKNER 1995 Down) that can be resolved as crossovers or noncrossovers.



View larger version (22K):
In this window
In a new window
Download PPT slide
 
Figure 1. Patterns of aberrant segregation associated with meiotic recombination at HIS4. Chromosomes are shown as double-stranded DNA molecules. Sister chromatids are depicted held together at their centromeres (solid ovals). The HIS4 gene is shown as a shaded rectangle; the solid rectangle within the HIS4 gene indicates a large insertion. The steps of recombination are derived from the double-strand break repair model (SZOSTAK et al. 1983 Down; SUN et al. 1991 Down). The top half of the figure shows DSB formation upstream of the mutant allele followed by 5' to 3' resection of the broken ends. In the next step, the wild-type chromosome is invaded by a single strand containing the large insertion. Dotted lines represent repair synthesis. Ligation of the free ends in this intermediate would result in the formation of double Holliday junctions. If the recombination intermediate is resolved without repair of the mispaired loop, a 5:3 aberrant tetrad will be produced. The segregation pattern of the spore colonies when replica plated to medium lacking histidine is shown on the far right. Solid circles represent His+ colonies and open circles represent His- colonies. The spore containing the heteroduplex with the unrepaired loop is shown as a sectored colony, representing a PMS event. Repair by removal of the loop results in a 6:2 gene conversion. Repair by duplication of the loop results in restoration of 4:4 segregation. The bottom half of the figure shows initiation of recombination upstream of the wild-type HIS4 allele. The mutant chromosome is invaded by a wild-type strand and the mutant insertion is displaced to form a mispaired loop. Failure to repair the heteroduplex results in a 3:5 PMS tetrad. Repair by removal of the loop results in restoration of 4:4 segregation, while repair by duplication of the loop results in a 2:6 gene conversion tetrad.

If sequence heterologies are included in the heteroduplex region (either base pair changes or insertion/deletion heterologies), mismatches or unpaired loops will be generated (Fig 1). The repair of these mismatched templates can lead to gene conversion or restoration of Mendelian segregation (PETES et al. 1991 Down). Failure to repair the mismatch will result in a post meiotic segregation (PMS) event. If the heterozygous marker involves an auxotrophic mutation, a PMS event is readily visualized as a sectored spore colony.

One aim of this study is to investigate whether large sequence heterologies can be incorporated into heteroduplexes during meiotic recombination in S. cerevisiae. Insertions (often involving transposable elements) and deletions are common in eukaryotic genomes. Gene conversions of large (>5 kb) heterozygous insertions and deletions have been observed (FINK and STYLES 1974 Down; FOGEL et al. 1981 Down; MCKNIGHT et al. 1981 Down; PUKKILA et al. 1986 Down; VINCENT and PETES 1989 Down), although these conversions have often been attributed to repair of a gapped DNA intermediate rather than repair of a loop within a heteroduplex (SZOSTAK et al. 1983 Down; TRAN et al. 1996 Down). CLIKEMAN et al. 2001 Down recently showed that 2- to 3-kb heterologies can be incorporated into heteroduplexes during mitotic recombination events in yeast. As described below, we find that insertions of up to 5.6 kb can be incorporated into heteroduplex DNA, indicating that meiotic gene conversion of large heterologies can involve DNA loop repair.

A second aim of this study is to identify the proteins involved in the meiotic repair of large, unpaired DNA loops. In a previous study (KIRKPATRICK and PETES 1997 Down), we showed that meiotic repair of a small (26-base) DNA loop involved Msh2p, an enzyme involved in mismatch repair (MMR), and Rad1p, an enzyme involved in nucleotide excision repair (NER). In both mitotic and meiotic cells, the MMR enzymes function to repair DNA mismatches generated either by errors made during DNA replication or by heteroduplexes formed between DNA strands derived from nonidentical alleles (CROUSE 1998 Down; HARFE and JINKS-ROBERTSON 2000 Down). In S. cerevisiae, base-base mismatches are corrected by a complex containing the MutS homologues, Msh2p and Msh6p, and the MutL homologues, Mlh1p and Pms1p (SIA et al. 1997A Down; KOLODNER and MARSISCHKY 1999 Down). In mitotic cells, DNA loops between 1 and 16 bases are corrected by a complex in which Msh3p is substituted for Msh6p (SIA et al. 1997B Down). Although these two MMR complexes have the major roles in the repair of DNA mismatches, other complexes that include the MutL homologues Mlh2p and Mlh3p are also involved in the repair of very small DNA loops (FLORES-ROZAS and KOLODNER 1998 Down; HARFE and JINKS-ROBERTSON 2000 Down). In addition, the frequency of large (~100 bp) deletions was increased in strains with msh3 or mlh2 mutations (HARFE et al. 2000 Down); such deletions could reflect failure to repair large DNA loops formed by DNA polymerase slippage.

In addition to their roles in the repair of DNA mismatches, the MMR enzymes are involved in a number of other cellular processes. First, these enzymes reduce the frequency of recombination between diverged DNA sequences (SELVA et al. 1995 Down; DATTA et al. 1996 Down; HUNTER et al. 1996 Down; NICHOLSON et al. 2000 Down). Second, Msh2p and Msh3p are required for the removal of nonhomologous "tails" of DNA during single-strand annealing recombination events (SAPARBAEV et al. 1996 Down; SUGAWARA et al. 1997 Down). Third, some of the MMR proteins (Msh4p, Msh5p, Mlh1p, and Mlh3p) promote meiotic crossing over in yeast (ROSS-MACDONALD and ROEDER 1994 Down; HOLLINGSWORTH et al. 1995 Down; WANG et al. 1999 Down).

The NER enzymes are required for the efficient repair of a variety of types of DNA damage (reviewed by PRAKASH et al. 1993 Down). Following recognition of a damaged substrate (usually a photoproduct) by Rad14p, the DNA surrounding the lesion is unwound by a helicase to form a small "bubble." The damaged strand is removed by single-strand incisions made both 5' (Rad1/10p) and 3' (Rad2p) to the lesion. Repair synthesis of the excised region completes the reaction.

In S. cerevisiae, Rad1p and Rad10p are also required in single-strand annealing (FISHMAN-LOBELL and HABER 1992 Down) and the meiotic repair of small DNA loops (KIRKPATRICK 1999 Down). Mitotic recombination between inverted repeats containing multiple small heterozygous insertions is inhibited by the Rad1p and Rad10p (NICHOLSON et al. 2000 Down). In Schizosaccharomyces pombe, homologues of the S. cerevisiae Rad1p, Rad10p, and Rad14p function in short-patch meiotic repair of DNA mismatches (FLECK et al. 1999 Down). The mei9 gene product, homologous to Rad1p, is required for meiotic mismatch repair and crossover resolution in Drosophila (CARPENTER 1979 Down, CARPENTER 1982 Down; SEKELSKY et al. 1995 Down). In the studies described below, we show that the MMR proteins, Msh2p and Msh3p, and the NER proteins, Rad1p and Rad10p, are involved in the meiotic repair of large DNA loops.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains:
All haploid yeast strains are derivatives of AS13 or AS4 (STAPLETON and PETES 1991 Down). The constructions and genotypes of haploid and diploid strains are described in Table 1 and Table 2, respectively. All alterations were introduced by one-step (ROTHSTEIN 1983 Down) or two-step (SHERMAN et al. 1982 Down) transplacements. One-step transplacements using PCR-generated DNA fragments were done as described in WACH et al. 1994 Down. Primers used to generate PCR cassettes are shown in Table 3. Deletions made with the kanMX4 or hygB cassettes (WACH et al. 1994 Down; GOLDSTEIN and MCCUSKER 1999 Down) removed most or all of the coding sequence. All constructions were verified by PCR, Southern analysis, or DNA sequencing. To generate diploids homozygous for mutations in MSH2, MSH3, MSH6, PMS1, and MLH1 that have a mutator phenotype, we mated haploids overnight and sporulated the resulting diploids the next day without purification of the diploids. This procedure prevents accumulation of mutations that would reduce spore viability.


 
View this table:
In this window
In a new window

 
Table 1. Haploid yeast strains


 
View this table:
In this window
In a new window

 
Table 2. Diploid yeast strains


 
View this table:
In this window
In a new window

 
Table 3. Primers used in strain constructions

Genetic techniques:
Standard media and genetic methods were used (SHERMAN et al. 1982 Down). Plates for kanMX4 and hygB selection were YPD + 150 mg/liter geneticin and YPD + 300 mg/liter hygromycin B, respectively. We selected ura3 strains on medium containing 1 gm/liter 5-fluoroorate (BOEKE et al. 1984 Down). As in our previous studies (FAN et al. 1995 Down), diploid strains were sporulated at 18° on plates containing 1% potassium acetate, 0.1% yeast extract, 0.05% dextrose, 2% agar, and supplemented with 6 µg/ml of adenine. Sporulated cells were dissected onto YPD and, following full colony growth at 30°, spore colonies were replica plated to appropriate omission and drug-containing media to score the segregating markers. Spore colonies were then examined for sectored growth patterns by microscopy.

Physical analysis of double-strand breaks:
We performed Southern analysis by standard methods (MANIATIS et al. 1982 Down), using a PCR-generated probe to HIS4. Primers used to generate the probe were f: 5' CCACTTGGAGACCATGTCTTG and r: 5' CAATGGAACATAGAGCTTGAGTG, resulting in a fragment containing HIS4 sequences from +690 to +1768. For most of the DSB measurements, strains with the rad50S mutation were grown in liquid sporulation media at room temperature as described previously (NAG and PETES 1993 Down). In some experiments, we also isolated and analyzed DNA derived from cells sporulated at 18° on plates. These different sporulation conditions had no effect on the relative levels of DSBs (wild-type vs. mutant chromosome) as assayed physically or genetically (data not shown). Levels of DSBs were quantitated using the PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and Image-Quant software.

Statistical analysis:
Comparisons were made using the Fisher exact test with two-tailed P values or by chi-square analysis (for comparisons involving more than two experimental parameters). Results were considered statistically significant when P < 0.05. Instat 1.12 (GraphPad Software) was used for statistical analysis.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Experimental rationale:
In our genetic background, heterozygous markers near the 5' end of HIS4 have an extraordinarily high rate of non-Mendelian segregation, ~50% of unselected tetrads (NAG et al. 1989 Down). This high frequency of aberrant segregation reflects a high level of meiosis-specific DSBs located about 200 bp upstream of the HIS4 initiating codon (NAG and PETES 1993 Down; FAN et al. 1995 Down). Heteroduplexes initiated in the HIS4 upstream region are efficiently extended through the HIS4 coding region, a distance of ~2.4 kb (DETLOFF et al. 1992 Down; PORTER et al. 1993 Down). Heterozygous mutations within the coding sequences lead to mismatches in the heteroduplex; repair of these mismatches results in gene conversion or restoration events, whereas failure to repair the mismatches results in PMS events (Fig 1).

In previous studies, we found that small (26 bp) heterozygous nonpalindromic insertions at position +469 in the HIS4 coding sequence had high levels of aberrant segregation (26% gene conversion and 4% PMS tetrads; NAG et al. 1989 Down; KIRKPATRICK and PETES 1997 Down). Mutations in the RAD1 or MSH2 gene increased the frequency of PMS events and decreased the frequency of gene conversion events, indicating that Rad1p and Msh2p were involved in the repair of 26-base DNA loops (KIRKPATRICK and PETES 1997 Down). In this study, we extend our analysis of the gene products required for the efficient repair of the 26-base loop. We also examined the meiotic segregation patterns of larger heterozygous insertions (1.1, 1.5, and 5.6 kb) at the same position in HIS4.

Meiotic repair of a 26-base loop:
Aberrant segregation patterns of strains heterozygous for a 26-bp insertion in HIS4 are shown in Table 4. To determine whether various mutations have a significant effect on repair of the 26-base loop, we compared the relative numbers of tetrads with PMS and conversion in the wild-type and mutant strains by Fisher's exact test. By this criterion, in addition to the rad1 and msh2 mutations reported previously (KIRKPATRICK and PETES 1997 Down), strains homozygous for mutations in rad10 (DTK286) and msh3 (DTK488) had a significant repair deficiency (P values of 0.005 and <0.0001, respectively). The rad1 msh2 and rad1 msh3 double mutant strains (DTK230 and DTK500, respectively) had PMS frequencies similar to those observed in the single mutant rad1, msh2, and msh3 strains, indicating that these gene products are likely to function in a single repair pathway. The requirement for both Rad1p and Rad10p, which function as a heterodimeric structure-specific endonuclease, suggests that this endonuclease activity is required for efficient loop repair; several other NER enzymes, such as Rad2p and Rad14p, however, are not required for loop repair (KIRKPATRICK and PETES 1997 Down).


 
View this table:
In this window
In a new window

 
Table 4. Meiotic segregation patterns of strains heterozygous for his4-lopd (26-bp insertion)

Neither mlh1 (DTK320) nor pms1 (DTK309) mutations had a significant effect on repair of the 26-base loop. Similarly, mutations in the MutS homologues Msh6p (DTK494) and Msh5p (DTK498) had no significant effect on loop repair. The msh4 mutation, however, had a small, but significant effect (P value of 0.005). Since epistasis analysis indicates that Msh4p and Msh5p function in a single pathway in crossover resolution (ROSS-MACDONALD and ROEDER 1994 Down; HOLLINGSWORTH et al. 1995 Down), the differential effects of these two proteins on loop repair is unexpected. Mutations in EXO1 (DTK308) had a similar subtle defect in repair of the 26-base loop (KIRKPATRICK et al. 2000 Down). It is possible that Msh4p and Exo1p are involved in a minor pathway of loop repair. Since none of the mutations examined in our study eliminate gene conversion, it is likely that there are pathways of loop repair that are independent of the Rad1p/Rad10p/Msh2p/Msh3p pathway.

The RAD27 gene encodes the S. cerevisiae homologue of the mammalian FEN-1 exo/endonuclease (JOHNSON et al. 1995 Down; REAGAN et al. 1995 Down). Rad27p is involved in the removal of single-stranded DNA "flaps" and the processing of Okazaki fragments during replication (HARRINGTON and LIEBER 1994A Down, HARRINGTON and LIEBER 1994B Down; MURANTE et al. 1994 Down). Deletion of RAD27 (DTK246) had no effect on repair of the 26-base loop (Table 4). Finally, we examined the role of the non-homologous end-joining repair pathway in loop repair. A strain homozygous for a deletion of HDF1/YKU70 (DTK341), a homologue of a component of the mammalian Ku DNA end-binding complex (FELDMANN and WINNACKER 1993 Down; TROELSTRA and JASPERS 1994 Down), had no effect on loop repair (Table 4).

Analysis of strains heterozygous for a 1.1-kb URA3 insertion:
The his4::U1.1a allele was constructed by introduction of a 1.1-kb fragment containing the URA3 gene into the HIS4 coding sequence at position +469, the same position as the 26-bp insertion described above. Results from tetrad analysis of strains heterozygous for this insertion are shown in Table 5.


 
View this table:
In this window
In a new window

 
Table 5. Meiotic segregation patterns of strains heterozygous for his4-U1.1 (1.1-kb insertion)

In the wild-type background (HMY100), we observed a high level of gene conversion events (22%) and no PMS events. One interpretation of this result is that heteroduplexes cannot accomodate the 1.1-kb insertion and, consequently, gene conversion occurs through a different pathway (for example, gap repair). Alternatively, heteroduplexes containing the heterozygous insertion are formed, and the resulting loop is repaired with complete efficiency. The second possibility is supported by the observation that the rad1 strain (HMY49) heterozygous for the 1.1-kb URA3 insertion had substantial rates of PMS tetrads (Table 5). Because the URA3 insertion confers the ability to grow on medium lacking uracil, PMS events were visualized as sectored colonies with His-Ura+ and His+Ura- halves (Fig 2A). The rad10 mutation had an effect on loop repair similar to that of the rad1 mutation (comparison of strains HMY49 and HMY151). The other mutations that resulted in PMS events for the 1.1-kb URA3 insertion were msh2 (HMY107) and msh3 (HMY113). The msh2 and msh3 mutations had significantly (P < 0.02) smaller effects than the rad1 and rad10 mutations. Since the efficiency of loop repair for the URA3 insertion is about the same in the rad1 msh3 double mutant (HMY184) and the rad1 single mutant (HMY49), Rad1p and Msh3p appear to act in a single pathway of loop repair. Mutations in msh4, msh5, msh6, mlh1, pms1, mlh2, mlh3, rad2, rad14, exo1, and rad27 had no effect on the repair of the 1.1-kb loop (Table 5).



View larger version (39K):
In this window
In a new window
Download PPT slide
 
Figure 2. Colony sectoring patterns in strains heterozygous for a single insertion or heterozygous for two different insertions. (a) In a strain heterozygous for his4::U1.1a and homozygous for rad1 or rad10, tetrads with PMS events were common. The right side of the figure shows spore colonies derived from HMY49; tetrads were dissected onto a rich growth medium and the resulting spore colonies were replica plated to media lacking histidine or uracil. The left side of the figure depicts the DNA molecules that generate the spore phenotypes (same depictions as in Fig 1). (b) Spore colonies derived from a tetrad of a rad1 strain (HMY215) that was heterozygous for two different insertions (his4::U1.1a and his4::k1.5) located at the same position within HIS4. Spore colonies were first grown on rich medium and then replica-plated to media lacking histidine or uracil, or containing geneticin. The URA3 and kanMX4 insertions are indicated as solid and crosshatched rectangles, respectively.

Although the rad27 strain (HMY150) exhibited no defect in repair of the 1.1-kb loop, we observed a significant decrease in the level of aberrant segregants in this background (P < 0.0001). This result is specific for the his4::U1.1a allele, since we did not observe a similar effect in a rad27 strain heterozygous for the 26-bp insertion (Table 4) or on other heterozygous point mutations in HMY150 (data not shown). It is possible that the flap endonuclease plays a role in heteroduplex formation between alleles with large insertion/deletion heterologies.

In most models for meiotic recombination (Fig 1), DNA replication is involved in formation of heteroduplexes and in repair of DNA mismatches. S. cerevisiae has a number of nonessential DNA polymerases including ß (encoded by POL4), {eta} (encoded by RAD30), and {zeta} (catalytic subunit encoded by REV3; WOODGATE 1999 Down). We examined meiotic segregation of the his4::U1.1b allele (identical to his4::U1.1a except for a single T to A base pair change in the insertion, 74 bp downstream of the URA3 stop codon) in strains homozygous for null mutations in these three DNA polymerase genes (Table 5). Although the rad30 and rev3 mutations had no significant effect, the pol4 mutation significantly (P = 0.001) reduced the frequency of aberrant segregation of his4::U1.1b. We also analyzed the effects of the same three DNA polymerase mutations on the frequency of aberrant segregation of a point mutation located in the HIS4 initiating codon. No significant effect was observed for any of the three mutations (data not shown) and the pol4 mutation did not significantly affect the frequency of aberrant segregation or the repair of the 26-base loop (Table 4). In addition, DSB formation at the HIS4 hotspot (monitored in a rad50S strain) was unaffected by the pol4 mutation (data not shown). Although these results suggest that DNA polymerase ß may have a role in heteroduplex formation across large heterologies, we found that the pol4 mutation did not significantly reduce the aberrant segregation frequency of a different larger insertion (as described below). Our results are in contrast to those of LEEM et al. 1994 Down who found elevated levels of both DSBs and meiotic recombination in pol4 strains.

Genetic analysis of strains heterozygous for a 1.5-kb kanMX insertion or a 5.6-kb URA3 insertion in HIS4:
To generalize the results obtained with the 1.1-kb URA3 insertion, we also examined strains heterozygous for other insertions in HIS4. The his4::k1.5 allele was generated by inserting the 1.5-kb kanMX4 gene (WACH et al. 1994 Down) at position +469 of the HIS4 coding sequence. Strains with this insertion are His-, but resistant to geneticin. A wild-type strain heterozygous for this insertion (HMY190) had 12% conversion tetrads, but no PMS tetrads (Table 6). In a derivative homozygous for the rad1 mutation (HMY219), we observed 12% conversion events and 17% PMS events. This result confirms our conclusion that heteroduplexes can be formed that include large heterologies and that the repair of the resulting DNA loop is, at least partly, Rad1p dependent.


 
View this table:
In this window
In a new window

 
Table 6. Meiotic segregation patterns of strains with larger insertions and bubbles

We also constructed strains heterozygous for a 5.6-kb insertion of URA3 at position +469 of the HIS4 coding sequence (his4::U5.6). A wild-type strain heterozygous for this insertion (HMY192) had 13% gene conversion and no PMS tetrads (Table 6). In strains with mutations in either rad1 (HMY203) or msh3 (HMY199), however, we observed a small number of PMS tetrads (five tetrads in the two strains). Thus, we conclude that heterologies as large as 5.6 kb can be included within heteroduplexes, although the efficiency of heteroduplex formation with these very large loops is reduced. The pol4 mutation did not significantly reduce the aberrant segregation frequency of his4::U5.6 (comparison of HMY192 and HMY258 in Table 6).

DSB formation in strains with heterozygous large insertions:
In wild-type strains heterozygous for his4::U1.1a, his4::U1.1b, his4::k1.5, and his4::U5.6, we found that 2:6 gene conversion events were more common than 6:2 conversions. One interpretation of such a bias is that the chromosome containing the insertion has fewer DSBs at the upstream HIS4 hotspot than does the chromosome lacking the insertion (Fig 1). Consequently, we measured DSB formation in rad50S derivatives of strains heterozygous for his4::U1.1b (JG30) and his4-k1.5 (HMY-210); rad50S strains accumulate unprocessed DSBs, simplifying their quantitation (CAO et al. 1990 Down).

In addition to the DSB associated with the upstream HIS4 hotspot (FAN et al. 1995 Down), the JG30 strain had a novel minor DSB band that mapped to the 5' end of the URA3 insert (Fig 3A). The frequency of the insert-associated DSB was about one-third of that associated with the wild-type hotspot. The hotspot-associated DSB on the chromosome with HIS4 was ~1.3-fold more intense than the upstream DSB on the his4::U1.1b-containing chromosome (average of three experiments). The observed conversion bias in HMY98 was 2-fold (Table 5). Thus, the difference in DSB formation on the two homologues accounts for much of the conversion bias observed in HMY98, assuming that DSB formation within the insertion does not contribute to gene conversion (an assumption discussed below).




View larger version (62K):
In this window
In a new window
Download PPT slide
 
Figure 3. Double-strand break formation in strains heterozygous for large insertions. Meiotic samples were collected from rad50S strains after either 0 and 24 hr of growth in liquid sporulation medium or after 0 and 72 hr on sporulation plates (both methods give equivalent results). DNA was digested with BglI and XbaI and probed with a 32P-labeled HIS4 fragment (indicated by hatched bar). Parental fragments are labeled at the top of each blot, and DSB-generated bands are indicated with arrows. All positions are given relative to the initiating codon of HIS4. (a) Analysis of JG30 (heterozygous for his4::U1.1b). DSBs were detected at the upstream HIS4 hotspot on both the wild-type (solid square) and mutant (solid circle) chromosomes. A third break was also detected (solid triangle) that maps to the 5' end of the URA3 insert. (b) Analysis of HMY210 (heterozygous for his4::k1.5). DSBs are labeled as described above with the addition of an asterisk to mark a second DSB within the insert. (c) Analysis of strains that are heterozygous for large insertions (HMY183, his4::U1.1a; HMY237, his4::k1.5) and homozygous for his4-51 (mutations in the HIS4 upstream region that eliminate Rap1p binding and the activity of the upstream hotspot). DSBs were still observed in both the 1.1-kb URA3 insert and the 1.5-kb kanMX4 insert.

A very strong DSB was also found within the kanMX4 insertion (HMY210; Fig 3B). The activity of the upstream HIS4 hotspot on the mutant chromosome was reduced 3.6-fold when compared to the upstream hotspot on the wild-type chromosome (average of three experiments). This bias in DSB formation accounts for part, although not all, of the 11-fold excess of the 2:6 class seen in the RAD50 companion strain HMY190 (Table 6). We also found DSBs associated with the insertion of the his4::U5.6 allele in the rad50S strain HMY211 (data not shown).

It is likely that the bias in the activities of the upstream hotspots reflects a competitive interaction between the DSBs within the insertions and the upstream DSB. We and others previously found that if two DSB sites are found close together on the same chromosome, the activity of each individual hotspot is reduced when compared to their "solo" activities (WU and LICHTEN 1995 Down; XU and KLECKNER 1995 Down; FAN et al. 1997 Down). Consistent with this hypothesis, we found that the strong DSB in the kanMX4 insertion had a larger effect than did the weak DSB in the 1.1-kb URA3 insertion. In addition, if the insert-associated DSBs do not contribute to gene conversion events at the HIS4 locus, the effect of the DSB competition would be to generate gene conversion disparity.

Since homology is required to initiate heteroduplex formation, we expected that DSBs within the insertions were unlikely to contribute to gene conversion events at HIS4 that included the insertions. To test this hypothesis genetically, we constructed strains heterozygous for his4::U1.1a (HMY157) or his4::k1.5 (HMY234) in which the HIS4 upstream hotspot had been inactivated by mutations of a Rap1p binding site (the his4-51 allele; DEVLIN et al. 1991 Down; WHITE et al. 1991 Down). The results from this analysis are in Table 7.


 
View this table:
In this window
In a new window

 
Table 7. Meiotic segregation patterns of strains homozygous for the his4-51 allele and isogenic controls

Deletion of the wild-type hotspot reduced aberrant segregation of his4::U1.1a from 22% (HMY100) to 3% (HMY157). The same deletion reduced aberrant segregation of his4::k1.5 from 13% (HMY190) to 4% (HMY234). In addition, those conversion events that occurred in HMY157 and HMY234 were not biased in favor of the 6:2 class. Such a bias would be expected if DSB formation within the insertion stimulated interhomologue recombination (Fig 1). The deletion of the wild-type hotspot also reduced crossovers between HIS4 and LEU2 in HMY157 and HMY234 compared to HMY100 and HMY190, shortening the average map distance from ~32 to 20 cM. In previous studies in which the effect of the hotspot deletion was monitored in the absence of a large insertion at HIS4, a similar reduction in crossovers was observed (WHITE et al. 1991 Down). We also observed a reduction in aberrant segregation and HIS4-LEU2 crossovers in strain HMY239, a strain heterozygous for his4::k1.5 and homozygous for his4-51 and rad1 (Table 7). This reduction was less than that observed for HMY234, presumably reflecting the recovery of PMS events that would have been repaired as restoration events (Fig 1) in the RAD1 strain.

To be sure that strains without the upstream HIS4 hotspot had insertion-associated DSBs, we examined DSB formation in rad50S derivatives of HMY157 and HMY234 (HMY183 and HMY237, respectively). Since DSBs were observed (Fig 3C), we conclude that DSBs that occur within heterozygous insertions do not effectively stimulate gene conversion between homologous chromosomes. It is likely that such DSBs are repaired by genetically silent sister-strand recombination.

Since the disparity of gene conversion in strains heterozygous for insertion-generated mutations is reduced in rad1 strains, we also analyzed DSB formation in rad50S derivatives of the rad1 strains, HMY49 (HMY229) and HMY219 (HMY230), heterozygous for the his4::U1.1a and his4::k1.5 insertions, respectively. The patterns of DSBs in these rad1 strains were identical to those seen in the RAD1 strains (data not shown). Therefore, we conclude that Rad1p does not influence patterns of DSB formation.

Ectopic recombination between the his4::U insertions and the ura3 locus on chromosome V:
Although it is likely (as discussed above) that most DSBs within the insertions are repaired by sister-strand interactions, we also observed tetrads that had ectopic gene conversion events between the his4::U1.1a or his4::U5.6 alleles on chromosome III and the mutant ura3 gene on chromosome V. Two types of spore colonies are indicative of ectopic recombination events: class 1, in which part or all of the colony is His- Ura-, and class 2, in which part or all of the colony is His+ Ura+. There were a total of 12 class 1 spore colonies in strains that were heterozygous for his4::U1.1a and the frequency of tetrads with such colonies was 1.4% or less in all strains; there was only a single class 2 tetrad in these strains. Strains heterozygous for the his4::U5.6 allele had a higher frequency of ectopic events with an average frequency of 3.8% class 1 tetrads and 1.5% class 2 tetrads.

In all class 1 spore colonies examined (12 of 12), the his4 gene retained the URA3 insertion. The simplest explanation of this event is that mutant information derived from the chromosome V ura3 gene was donated to the wild-type gene located in HIS4 on chromosome III. In confirmation of this explanation, in 12 of 12 His- Ura- spore colonies examined, we showed that the mutant ura3 insertion in his4 had the same nonsense mutation (G to T change at position 721) as the mutant genes on chromosome V. In class 2 spore colonies, the HIS4 gene lacked an insertion. The simplest explanation for such colonies is that ectopic conversion between one of the his4::U alleles and one of the mutant chromosome V ura3 genes resulted in a wild-type URA3 gene on one copy of chromosome V. Cosegregation of this allele with the HIS4 allele lacking an insertion would produce a His+ Ura+ spore colony or sector. In summary, there was a fairly high frequency of meiotic ectopic recombination events in strains with his4::U alleles, as expected from previous studies (JINKS-ROBERTSON and PETES 1985 Down; LICHTEN et al. 1987 Down). Since these ectopic events do not directly contribute to aberrant segregation at the HIS4 locus, they were not included in the data shown in Table 5 and Table 6.

Formation and repair of bubble structures:
Diploid strains were constructed in which each homologue contained an insertion at the same position in HIS4, but the insertions had different sequences (his4::U1.1a and his4::k1.5). Heteroduplexes that include these insertions would be expected to form a large "open" bubble (Fig 2B). Spore colonies diagnostic for such a heteroduplex would be expected to be His-, but have GenR Ura- and GenS Ura+ sectors (Fig 2B).

In the wild-type background (HMY189), we observed only 6% aberrant tetrads, and all were gene conversion events (Table 6). Deletion of RAD1 (HMY215) resulted in a dramatic increase in aberrant segregants (26%) with the recovery of many PMS tetrads (73% of the aberrant tetrads). The msh3 deletion (HMY222) also elevated aberrant segregation frequencies, but in contrast to the results obtained with HMY215, very few PMS events were recovered (25% aberrant with 5% PMS/Ab; Table 6). Possible explanations for this difference will be discussed further below.

It has been reported previously that strains with mutations in MLH1 and PMS1 have elevated frequencies of PMS events involving the mating type locus (WANG et al. 1999 Down). PMS events involving this locus would be expected to reflect formation of a bubble of ~700 bp. In our genetic background, the mlh1 mutation had no effect on bubble repair (HMY198, Table 6). It is possible that the difference in our results and those of the previous study reflect size or sequence differences in the insertions. Alternatively, the colonies sectored at the mating type locus might reflect an Mlh1p-Pms1p-dependent increase in mating type switch as a consequence of mitotic gene conversion (CHEN and JINKS-ROBERTSON 1999 Down).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The main conclusions from this study are: (1) heteroduplexes formed during meiotic recombination can include large (5.6 kb) insertions; (2) heteroduplexes can be formed between alleles that include two different large insertions; (3) the efficient repair of DNA loops formed during meiotic recombination requires Rad1p, Rad10p, Msh2p, and Msh3p; (4) gene conversion events that involve large insertions usually duplicate, rather than delete, the insertions; and (5) DSBs within insertions do not stimulate recombination between homologues.

Accommodation of heterologies within heteroduplexes:
The finding that meiotic heteroduplexes can include regions of heterology as large as 5.6 kb is somewhat surprising. There are three related mechanisms that could result in heteroduplex formation through a large heterology during meiotic recombination. First, there could be extensive degradation of the broken DNA ends, followed by invasion of the resulting single-stranded DNA into the other homologue (Fig 1). The inclusion of the heterology in the heteroduplex requires either a single strand to migrate through the inserted sequence in a homoduplex, or the ability of the single strand to invade the homoduplex simultaneously on both sides of the insertion. It should be noted, however, that the ability of Escherichia coli strand exchange proteins to bypass 1-kb heterologies in vitro is limited, even in the presence of the RuvAB complex (IYPE et al. 1994 Down; MOREL et al. 1994 Down; ADAMS and WEST 1996 Down). In the second model, the resection resulting in heteroduplex formation is limited to the DNA upstream of the insertion; the resulting Holliday junction is translated through the heterology by branch migration. The genetic evidence indicating that branch migration in vivo in yeast is limited or nonexistent (FOGEL et al. 1981 Down; PETES et al. 1991 Down) argues against this model. In addition, formation of a heteroduplex that includes a bubble structure (Fig 2B) is unlikely to occur by branch migration. In our favored model, heteroduplex formation is driven by DNA replication rather than by branch migration (Fig 4). This model is similar to synthesis-dependent strand annealing models of recombination (PAQUES and HABER 1999 Down), except that there is no requirement for migration of a D-loop.



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 4. Polymerase-driven heteroduplex formation involving large insertions. (1) The DSB is formed at the upstream hotspot on the mutant chromosome and is resected through part, but not all of the insertion. (2) The "left" arm invades the intact duplex and creates a D-loop. (3) Polymerase (indicated by an arrow) drives expansion of the D-loop through the insertion. Note that continued degradation of the "right" arm of the recipient chromosome is required to expose complementary regions of the DNA. (4) Continued synthesis will result in the formation of a mispaired loop in the recombination intermediate. Further processing of this intermediate (Fig 1) will result in a 5:3 or 6:2 tetrad. (1*) The DSB is formed on the wild-type chromosome and is resected. Note that less resection of the DSB is required in the absence of the large insertion. (2*) The left arm invades the intact duplex and creates a D-loop. (3*) Polymerase drives expansion of the D-loop and duplicates the large insertion. (4*) Continued synthesis will result in the formation of a mispaired loop in the recombination intermediate. Further processing of this intermediate (Fig 1) can result in a 3:5 or 2:6 tetrad.

In many previous yeast studies (reviewed in PETES et al. 1991 Down), efficient meiotic conversions of large heterozygous insertions have been observed. Our results demonstrate that at least some of these conversion events are likely to reflect Rad1p/Rad10p/Msh2p/Msh3p-dependent repair of large DNA loops within heteroduplexes. We cannot rule out the alternative possibility that conversion in the presence of these proteins occurs through gap repair rather than the repair of a DNA loop in a heteroduplex. The observation of large (2 kb) DNA loops in heteroduplexes generated during mitotic recombination in RAD1 strains (CLIKEMAN et al. 2001 Down), however, argues against this interpretation.

Proteins required for DNA loop repair:
We examined the effects of many different mutations on the efficiency of repair of the 26-base and 1.1-kb DNA loops (Table 4 and Table 5). Repair of both types of loops involved the Rad1p, Rad10p, Msh2p, and Msh3p. These same four proteins are required for the removal of nonhomologous ends during certain types of mitotic recombination events (PAQUES and HABER 1999 Down). We found that the requirement for the four proteins was approximately the same in the repair of the 26-base loop, but the requirement for Msh2p and Msh3p for the repair of the 1.1-kb loop was reduced. Similarly, all four proteins are required to approximately the same extent for single-strand annealing events when the interacting repeats are short (~200 bp), but the requirement for Msh2p and Msh3p is substantially reduced when the repeats are long (1 kb; SUGAWARA et al. 1997 Down). One interpretation of our results is that the Msh2p and Msh3p stabilize the interactions of Rad1p and Rad10p with the substrate, and this stabilization is more important with the smaller region of single-stranded DNA represented by the 26-base loop.

The observed effect of mutating RAD1 or RAD10 in strains heterozygous for his4-lopd or his4::U1.1a was an increase in the frequency of both 5:3 and 3:5 PMS tetrads and a reduction in the frequency of 2:6, but not 6:2, gene conversion tetrads (Table 4 and Table 5; KIRKPATRICK and PETES 1997 Down). The reductions in the frequencies of 2:6 tetrads relative to wild type were statistically significant for the rad1 strains TP1013 and HMY49 (P values of 0.02 and 0.01, respectively) and the rad10 strains DTK286 and HMY151 (P values of 0.02 and 0.003, respectively).

As illustrated in Fig 1, mispaired loops can be repaired either by loop removal or duplication of the loop. Repair of 5:3-type heteroduplexes by removal of the loop will result in a 6:2 tetrad. Duplication of the loop will result in restoration of 4:4 segregation. Alternatively, repair of a 3:5-type heteroduplex by removal of the loop will result in restoration of 4:4 segregation, while duplication of the loop will result in a 2:6 gene conversion. A strain deficient in the ability to repair mispaired loops by duplication would generate fewer 2:6 conversions (with a concomitant increase in the production of 3:5 PMS tetrads), without an effect on the 6:2 conversion class. One would still observe 5:3 PMS tetrads, however, due to the inability to complete restoration repair from this intermediate. Thus, the reduction of the 2:6 conversion class in rad1 and rad10 strains suggests that the Rad1p/Rad10p endonuclease is involved in loop repair events that require cleavage of the strand opposite the loop (KIRKPATRICK and PETES 1997 Down).

As shown in Fig 5A, Rad1p/Rad10p is a junction-specific endonuclease that recognizes single- to double-strand transitions (BARDWELL et al. 1994 Down). The human homologues of Rad1p/10p (XPF/ERCC1) incise duplex DNA 2–8 nucleotides 5' of a junction with single-stranded DNA (MATSUNAGA et al. 1996 Down; DE LAAT et al. 1998A Down, DE LAAT et al. 1998B Down). In one study, the polar binding of RPA to the single-stranded substrate affected the incision activity of XPF/ERCC1 (DE LAAT et al. 1998B Down). As shown in Fig 5B, RPA bound to 3'-protruding single-stranded arms inhibits incision by XPF/ERCC1, whereas binding of RPA to 5'-protruding single-stranded arms greatly stimulates incision. On the basis of these observations, we suggest that binding of RPA on the large DNA loops preferentially directs Rad1p/Rad10p cleavage to the strand opposite the DNA loop. The repair events subsequent to this cleavage would result in duplication of the insertion (Fig 5C).



View larger version (15K):
In this window
In a new window
Download PPT slide
 
Figure 5. The enzymatic activity of the Rad1p/10p endonuclease. (a) The Rad1p/Rad10 (XPF/ERCC1) endonuclease makes single-strand nicks at single-stranded to double-stranded transitions in DNA. The incision is always made in the duplex DNA, 5' to the single-stranded region (PARK et al. 1995 Down; MATSUNAGA et al. 1996 Down; DE LAAT et al. 1998A Down). This activity is consistent with the known roles for Rad1p/Rad10p in nucleotide excision repair (shown on the left) and single-strand annealing (shown on the right). (b) The binding of RPA to single-stranded tails influences XPF/ERCC1 cleavage. When the 3'-binding side of RPA faces the cleavage site, XPF/ERCC1 is stimulated, but when the 5'-binding side of RPA faces the cleavage site, cleavage is inhibited (DE LAAT et al. 1998B Down). (c) Our genetic results suggest that RPA (and, perhaps, Msh2p/Msh3p) might direct Rad1p/10p cleavage in loop repair. We show a large single-stranded loop bound with RPA. The two potential incision sites 5' to the single- to double-strand junction are indicated by arrows. We suggest that RPA stimulates cleavage across from the loop while inhibiting cleavage on the same strand as the loop. This incision would then allow subsequent polymerase activity to duplicate the insertion.

Several additional points concerning this model are relevant. First, there must be a second, as yet unidentified, repair system that results in deletion, rather than duplication, of the insertion. Second, since in vitro, XPF/ERCC1 (in the presence of RPA) cleaves 30-base loop substrates on both strands (MATSUNAGA et al. 1996 Down; T. MATSUNAGA and A. SANCAR, personal communication), it is possible that Msh2p/Msh3p contribute to the specificity of strand cleavage. Third, CLIKEMAN et al. 2001 Down found that DNA loop repair in mitotic yeast cells required both Msh2p and Pms1p. This result suggests that meiotic and mitotic repair of loops may have different genetic requirements. Alternatively, since the substrates examined by Clikeman et al. contained both point mutations and insertions, it is possible that their results reflect an interaction between two different repair systems. Fourth, the model is consistent with observation that the efficiency of targeted integration of transforming DNA is greatly reduced by mutations in ERCC1, the mammalian equivalent of RAD10 (L. NIEDERNHOFER and R. KANAAR, personal communication). If integration of transforming DNA involves a heteroduplex intermediate (such as that shown in Fig 5C), the Rad1p/Rad10p endonuclease would be required for the cleavage event necessary to integrate the insertion.

We previously showed that loops composed of palindromic sequences frequently escape meiotic repair (NAG et al. 1989 Down; NAG and PETES 1991 Down; MOORE et al. 1999 Down). Since the Rad1p/Rad10p endonuclease requires a single- to double-strand transition for cleavage, it is likely that these hairpin-forming loops do not present an appropriate substrate for repair. This conclusion is consistent with the observations that the efficiency of incision in stem-loop substrates (Fig 5C) increases with the size of the loop and that no incisions are observed for loops eight bases or smaller (DE LAAT et al. 1998A Down). In preliminary studies, we find no effect of rad1 on the repair of a heterozygous palindromic insertion (H. M. KEARNEY and T. D. PETES, unpublished data).

The roles of Rad1p and Msh3p in the repair of bubble substrates are different from their roles in the repair of DNA loops. Although mutations in either RAD1 or MSH3 result in a fourfold elevation in the frequency of gene conversion (comparison of HMY215 and HMY222 with HMY189, Table 6), the rad1, but not the msh3, mutation leads to substantially elevated PMS frequencies. One interpretation of this result is that Rad1p and Msh3p reduce the formation of the bubble substrate. Since crossovers between HIS4 and LEU2 are not substantially affected by these mutations (Table 6), this reduction probably does not involve DSB formation, but a subsequent step. In addition to its role in preventing formation of the bubble substrate, Rad1p, but not Msh3p, is significantly involved in its repair. Although we favor this interpretation, we cannot exclude other possibilities. For example, the Rad1p and Msh3p may be involved in directing repair events to restorations rather than gene conversions.

Disparity of gene conversion in wild-type strains:
Gene conversion events involving heterozygous point mutations usually show no disparity (equal frequencies of 6:2 and 2:6) or subtle disparities (FOGEL et al. 1981 Down; NAGYLAKI and PETES 1982 Down). In contrast, conversion events involving either large insertions or deletions often (although not always) show disparity in favor of the conversion events that duplicate the insertion or result in loss of the deletion (FINK and STYLES 1974 Down; FOGEL et al. 1981 Down; MCKNIGHT et al. 1981 Down; PUKKILA et al. 1986 Down; VINCENT and PETES 1989 Down). In our study, we also observed that conversion events tend to duplicate, rather than delete, the insertion. We suggest that this disparity reflects two factors. First, if the insertion contains a site susceptible to DSB formation, then competition for adjacent DSB formation (WU and LICHTEN 1995 Down; XU and KLECKNER 1995 Down; FAN et al. 1997 Down) reduces DSB formation at the normal HIS4 upstream site (Fig 3B). Since only DSB formation at the normal upstream region results in gene conversion involving the homologues (as discussed below), this effect results in disparity.

We suggest that a second factor in generating disparity is the relative efficiency of heteroduplex formation across the insertion. As shown in Fig 4, recombination events initiated on the chromosome with large (1.1–5.6 kb) insertions require extensive degradation (>1.1–5.6 kb) of one of the strands of the recipient chromosome in order to allow DNA loop formation. Events initiated on the chromosome with the wild-type allele require less degradation, although more extensive DNA synthesis. If strand degradation is limited, then one would expect a bias in favor of 2:6 conversions. This expectation assumes that heteroduplex formation events that are initiated, but not completed, can nonetheless give rise to viable spore products. In summary, the degree of conversion bias observed for heterozygous insertions is likely to reflect the strength of DSB formation within the insertion, the size of the insertion, and the position of the insertion relative to the initiating DSB.

HIS4-LEU2 crossovers in wild-type and mutant strains:
A number of the mutations examined in our study significantly affected crossovers in the HIS4-LEU2 interval (Table 4 Table 5 Table 6 Table 7). Crossover distances were determined by measuring the number of PD:NPD:T tetrads (PERKINS 1949 Down). The relative numbers of these tetrads is a complicated function of the frequency of initiating recombination intermediates, the resolution of these intermediates as crossovers or noncrossovers, and the ratio of various classes of double crossovers. In previous studies, it has been shown that mutations in MLH1, MSH4, MSH5, and EXO1 reduce crossovers (ROSS-MACDONALD and ROEDER 1994 Down; HOLLINGSWORTH et al. 1995 Down; HUNTER and BORTS 1997 Down; KHAZANEHDARI and BORTS 2000 Down; KIRKPATRICK et al. 2000 Down). These same mutations significantly affected crossovers in strains heterozygous for his4-lopd (Table 4). In addition, the msh3 and rad2 mutations altered the distribution of the PD, NPD, and T tetrads. The effect of msh3 was not completely straightforward. The msh3 strains had a reduction in the relative number of NPD tetrads (presumably representing four-strand double crossovers), but an increase in the relative number of T tetrads (presumably representing single crossovers and three-strand double crossovers; data not shown). The rad2 mutation reduced the relative numbers of both NPD and T tetrads. Since the level of aberrant segregation at HIS4 was also reduced in the rad2 strain (Table 4), the reduction in crossovers might reflect an effect of rad2 on the initiation of recombination.

In strains heterozygous for his4::U1.1a, we also observed significant reductions in crossovers in msh4 and exo1 mutant strains (Table 5). In addition, the rad27 mutation significantly reduced both crossovers and aberrant segregation. As suggested above, the endonuclease encoded by RAD27 may be involved in heteroduplex formation involving large heterozygous insertions or deletions.

DSBs formed within heterozygous insertions stimulate ectopic recombination, but not recombination between homologues:
We found that DSBs were efficiently formed within the his4::U1.1 and his4::k1.5 insertions. These breaks, however, did not contribute to recombination between homologues, although the breaks in the URA3 insertions stimulated ectopic recombination with the ura3 genes on chromosome V. The DNA ends formed by DSBs within the insertion contain nonhomologous DNA sequences that presumably block interactions with the homologous chromosome. If the nonhomologous sequences were efficiently removed from both strands, as expected if conversion could result from DNA gap repair, it is likely that these DSBs would stimulate interaction with the homologues. Thus, our results argue that gap repair in yeast occurs rarely. It is likely that DSBs formed within the insertion, if not used for ectopic recombination events, are repaired by sister-strand interactions. One argument for this type of repair is that we find no loss in spore viability in strains heterozygous for the his4::k1.5 insertion, despite the DSBs that occur in the kanMX4 insertion (which shares no homology with the yeast genome).

Conclusions:
Heteroduplexes can be formed during meiotic recombination in S. cerevisiae through very large heterologies. The resulting DNA loops are repaired by a process requiring Rad1p, Rad10p, Msh2p, and Msh3p. This mechanism duplicates, rather than removes, large loops. DSBs that occur within heterozygous insertions do not efficiently initiate interhomologue exchange.


*  FOOTNOTES

1 Current address: Department of Genetics, Cell Biology, and Development, University of Minnesota, 250 Biological Sciences Bldg., 1445 Gortner Ave., St. Paul, MN 55108. Back
2 Current address: Department of Biochemistry and Biophysics, University of California, 513 Parnassus Ave., San Francisco, CA 94143-0448. Back


*  ACKNOWLEDGMENTS

We thank M. Dominska, N. Perabo, and E. Vitriol for assistance with the genetic analysis; L. Niedernhofer, R. Kanaar, T. Matsunaga, and A. Sancar for communicating unpublished information; and J. Merker, J. Stone, J. Hoeijmakers, and J. Sekelsky for helpful comments. The research was supported by National Institutes of Health (NIH) grant GM24110. H.M.K. was supported by NIH Training Grant (5 T32 GM07092-27), D.T.K. was a Special Fellow of the Leukemia and Lymphoma Society, and J.L.G. was supported by the American Cancer Society (Grant 5-39833).

Manuscript received March 30, 2001; Accepted for publication May 24, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAMS, D. E. and S. C. WEST, 1996  Bypass of DNA heterologies during RuvAB-mediated three- and four-strand branch migration. J. Mol. Biol. 263:582-596[Medline].

ALANI, E., R. PADMORE, and N. KLECKNER, 1990  Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61:419-436[Medline].

BARDWELL, A. J., L. BARDWELL, A. E. TOMKINSON, and E. C. FRIEDBERG, 1994  Specific cleavage of model recombination and repair intermediates by the yeast Rad1-Rad10 DNA endonuclease. Science 265:2082-2085[Abstract/Free Full Text].

BOEKE, J. D., F. LACROUTE, and G. FINK, 1984  A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast. Mol. Gen. Genet. 197:345-346[Medline].

CAO, L., E. ALANI, and N. KLECKNER, 1990  A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae.. Cell 61:1089-1101[Medline].

CARPENTER, A. T., 1979  Recombination nodules and synaptonemal complex in recombination-defective females of Drosophila melanogaster.. Chromosoma 75:259-292[Medline].

CARPENTER, A. T., 1982  Mismatch repair, gene conversion, and crossing-over in two recombination-defective mutants of Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 79:5961-5965[Abstract/Free Full Text].

CHEN, W. and S. JINKS-ROBERTSON, 1999  The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151:1299-1313[Abstract/Free Full Text].

CLIKEMAN, J. A., S. L. WHEELER, and J. A. NICKOLOFF, 2001  Efficient incorporation of large (>2 kb) heterologies into heteroduplex DNA: PMS1/MSH2-dependent and -independent large loop mismatch repair in yeast. Genetics 157:1481-1491[Abstract/Free Full Text].

CROUSE, G. F., 1998 Mismatch repair systems in S. cerevisiae, pp. 411–448 in DNA Damage and Repair: DNA repair in prokaryotes and lower eukaryotes, Vol. 1, edited by J. A. NICKOLOFF and M. F. HOEKSTRA. Humana, Totowa, NJ.

DATTA, A., A. ADJIRI, L. NEW, G. F. CROUSE, and S. JINKS ROBERTSON, 1996  Mitotic crossovers between diverged sequences are regulated by mismatch repair proteins in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:1085-1093[Abstract].

DE LAAT, W. L., E. APPELDOORN, N. G. J. JASPERS, and J. H. J. HOEIJMAKERS, 1998a  DNA structural elements required for ERCC1-XPF endonuclease activity. J. Biol. Chem. 273:7835-7842[Abstract/Free Full Text].

DE LAAT, W. L., E. APPELDOORN, K. SUGASAWA, E. WETERINGS, and N. G. JASPERS et al., 1998b  DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair. Genes Dev. 12:2598-2609[Abstract/Free Full Text].

DETLOFF, P., M. A. WHITE, and T. D. PETES, 1992  Analysis of a gene conversion gradient at the HIS4 locus in Saccharomyces cerevisiae.. Genetics 132:113-123[Abstract].

DEVLIN, C., K. TICE-BALDWIN, D. SHORE, and K. T. ARNDT, 1991  RAP1 is required for BAS1/BAS2- and GCN4-dependent transcription of the yeast HIS4 gene. Mol. Cell. Biol. 11:3642-3651[Abstract/Free Full Text].

FAN, Q., F. XU, and T. D. PETES, 1995  Meiosis-specific double-strand DNA breaks at the HIS4 recombination hot spot in the yeast Saccharomyces cerevisiae: control in cis and trans.. Mol. Cell. Biol. 15:1679-1688[Abstract].

FAN, Q. Q., F. XU, M. A. WHITE, and T. D. P