Genetics, Vol. 158, 959-972, July 2001, Copyright © 2001

Saccharomyces cerevisiae rad51 Mutants Are Defective in DNA Damage-Associated Sister Chromatid Exchanges but Exhibit Increased Rates of Homology-Directed Translocations

Michael Fasulloa,b, Peter Giallanzaa, Zheng Donga, Cinzia Ceraa, and Thomas Bennettb
a Center for Immunology and Microbial Disease, Albany Medical College, Albany, New York 12208
b Department of Radiotherapy, Loyola University Chicago, Maywood, Illinois 60153

Corresponding author: Michael Fasullo, Center for Immunology and Microbial Disease, A-151, Albany Medical College, 47 New Scotland Ave., Albany, NY 12208., fasullm{at}mail.amc.edu (E-mail)

Communicating editor: M. LICHTEN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Saccharomyces cerevisiae Rad51 is structurally similar to Escherichia coli RecA. We investigated the role of S. cerevisiae RAD51 in DNA damage-associated unequal sister chromatid exchanges (SCEs), translocations, and inversions. The frequency of these rearrangements was measured by monitoring mitotic recombination between two his3 fragments, his3-{Delta}5' and his3-{Delta}3'::HOcs, when positioned on different chromosomes or in tandem and oriented in direct or inverted orientation. Recombination was measured after cells were exposed to chemical agents and radiation and after HO endonuclease digestion at his3-{Delta}3'::HOcs. Wild-type and rad51 mutant strains showed no difference in the rate of spontaneous SCEs; however, the rate of spontaneous inversions was decreased threefold in the rad51 mutant. The rad51 null mutant was defective in DNA damage-associated SCE when cells were exposed to either radiation or chemical DNA-damaging agents or when HO endonuclease-induced double-strand breaks (DSBs) were directly targeted at his3-{Delta}3'::HOcs. The defect in DNA damage-associated SCEs in rad51 mutants correlated with an eightfold higher spontaneous level of directed translocations in diploid strains and with a higher level of radiation-associated translocations. We suggest that S. cerevisiae RAD51 facilitates genomic stability by reducing nonreciprocal translocations generated by RAD51-independent break-induced replication (BIR) mechanisms.


THE Saccharomyces cerevisiae RAD51 gene shares sequence similarity to both higher eukaryotic genes and the Escherichia coli recA gene. The amino acid sequences of RecA and Rad51 share 30% identity in the highly conserved region that includes the Walker A and B-type nucleotide binding motifs and is responsible for oligomer formation and recombination (for review, see SHINOHARA and OGAWA 1999 Down). In vitro biochemical activities of both yeast (SUNG 1994 Down; SUNG and ROBERSON 1995 Down) and bacterial proteins (for review, see KOWALCZYKOWSKI et al. 1994 Down) include DNA strand exchange and the formation of protein filaments. Yeast rad51 mutants, hypersensitive to ionizing radiation, are defective in both mitotic gene conversion and meiotic recombination and yield a high percentage of inviable spores when diploid rad51 mutants undergo meiosis (for review, see PETES et al. 1991 Down). Thus, shared biochemical properties of yeast Rad51 and E. coli RecA suggest the conservation of recombinational repair mechanisms in evolution.

Because E. coli recA plays a pivotal role in recombinational repair of DNA damage (RUPP et al. 1971 Down), we asked whether yeast RAD51 functions in spontaneous and DNA damage-associated sister chromatid exchange (SCE). Both the DNA damage inducibility and the timing of RAD51 expression have suggested a role for eukaryotic recA homologues in SCE. Expression of yeast and higher eukaryotic homologues of RAD51 is induced at G1-S (ABOUSSEKHRA et al. 1992 Down; BASILE et al. 1992 Down) and S and G2-M phases of the cell cycle (CHEN et al. 1997 Down), respectively. Similar to recA, the expression of yeast RAD51 is inducible by a variety of DNA-damaging agents, including X rays (BASILE et al. 1992 Down) and the alkylating agent methyl methanesulfonate (SHINOHARA et al. 1992 Down). Rad51 mutations confer X-ray sensitivity in both G2 haploids and diploids (GAME 1983 Down) and abolish radiation-induced heteroallelic recombination between homologs (MORRISON and HASTINGS 1979 Down). Since recombinational repair of DNA lesions by SCE is preferred over homologs (KADYK and HARTWELL 1992 Down), the radiation sensitivity of rad51 diploid mutants may be conferred by a defect in DNA damage-associated SCE.

The participation of RAD51 in G2 recombinational repair is implied by the genetics of particular yeast UV repair mutants. Although rad51 mutants are less UV sensitive than E. coli recA mutants, yeast haploid mutants defective in both RAD1-mediated UV excision repair and RAD51-mediated recombinational repair exhibit a synergistic increase in UV sensitivity compared to the single mutants (GAME and COX 1973 Down). Rad27 mutants, which are defective in the Fen1 (flap) endonuclease and thus accumulate unprocessed 5' single strand overhangs during DNA replication (for review, see LIEBER 1997 Down), require RAD51 for viability (TISHKOFF et al. 1997 Down; SYMINGTON 1998 Down). These observations suggest that RAD51 participates in recombination between sister chromatids.

Although the radiosensitive phenotypes of rad51 are well documented (GAME 1983 Down), there is no genetic assay that demonstrates that RAD51 participates in spontaneous recombination between sister chromatids in yeast. While recA mutants exhibit significant reductions in nearly all types of spontaneous recombination (for review, see CLARK and SANDLER 1994 Down), rad51 mutations confer a differential effect on particular spontaneous mitotic recombination events. For example, rad51 mutations confer a profound reduction in heteroallelic recombination between homologs (BAI and SYMINGTON 1996 Down), a minor reduction in intrachromosomal recombination between inverted repeats (RATTRAY and SYMINGTON 1995 Down), and an increase in mitotic intrachromosomal recombination between direct repeats (MCDONALD and ROTHSTEIN 1994 Down). Also, yeast DNA polymerase mutants exhibit a RAD51-independent hyperrecombination phenotype that is manifested by more SCEs at the rDNA locus (ZOU and ROTHSTEIN 1997 Down). Thus, although rad51 mutants exhibit deficiencies in both mitotic gene conversion and crossover events, rad51 mutants also exhibit some hyperrecombination events.

The seemingly contradictory rad51 recombination phenotypes are consistent with the hypothesis that mitotic recombination results from multiple genetic pathways (RATTRAY and SYMINGTON 1995 Down). Recombination between inverted repeats can occur by a RAD51-independent, RAD59-dependent pathway (BAI and SYMINGTON 1996 Down; BARTSCH et al. 2000 Down). Homolog recombination resulting from break-induced replication (BIR) has been suggested to account for the high frequency of repair of an HO-induced double-strand break (DSB) at the MAT locus in a rad51 diploid (MALKOVA et al. 1996 Down). The BIR recombination model suggests that the homologous chromosome is used as a template for the initiation and elongation of DNA synthesis, resulting in the restoration of the broken chromosome by homozygosis of distal markers to the break point. BIR may also participate in sister chromatid recombination and contribute to maintaining telomere length in strains defective for telomerase (LE et al. 1999 Down). Although less efficient than RAD51-dependent gap repair pathways, these alternative RAD51-independent pathways may compete for the recombinational repair of DSBs (HABER 1999 Down).

Here we analyzed the effects of rad51 disruptions on DNA damage-associated unequal SCE, inversions, and directed translocations in the yeast S. cerevisiae. In contrast to RAD51 strains, higher frequencies of unequal SCE were not obtained after rad51 mutants were exposed to DNA-damaging agents or when DNA DSBs were directly induced by HO endonuclease. Because higher frequencies of translocations generated by nonhomologous recombination have been previously observed in rad51 single and rfa1 rad51 double mutants (CHEN et al. 1998 Down), we also determined whether the defect in DNA damage-associated SCE correlated with an increase in homology-directed translocation events. We suggest that the rad51 hyperrecombination phenotype may result from BIR when G2 recombinational repair mechanisms are defective.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Standard media for the culture of yeast, SC SC-TRP, SC-HIS, SD, YP, and YPD, and sporulation media are described by SHERMAN et al. 1986 Down. YPL medium contains YP with 2% lactate (pH 5.5) and YPGal medium contains YP medium with 2% ultra-pure galactose (Sigma, St. Louis). Yeast transformations were performed according to CHEN et al. 1992 Down.

Yeast strains:
Strains are listed in Table 1. One-step gene disruptions (ROTHSTEIN 1983 Down) of RAD51 and RAD1 were made using the plasmid p{Delta}RAD51 (SHINOHARA et al. 1992 Down) and pDH23 (HIGGINS et al. 1983 Down), respectively. Strains to monitor inversions and SCEs are isogenic to YA102 (MCY727) or S288C except for the mating-type allele. The construction of plasmids to monitor SCEs and inversions has been previously described (FASULLO et al. 1998 Down, FASULLO et al. 1999 Down). Strains to monitor translocations were derived from YNN287 that had been twice backcrossed to S288C strains as previously described (FASULLO et al. 1994 Down).


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains

Determining rates of spontaneous recombination and frequencies of DNA damage-associated recombinants:
The rates (events per cell division) of spontaneous, mitotic events that generate either SCE, inversions, or translocations were determined by the method of the median (LEA and COULSON 1949 Down), as executed by ESPOSITO et al. 1982 Down, using 11 independent colonies for each rate calculation. At least three independent rate calculations were done for each strain, and the significance of the differences was determined by the Mann-Whitney U-test (ZAR 1996 Down).

Protocols used to measure the recombinogenicity of methyl methanesulfonate (MMS), 4-nitroquinoline oxide (4NQO), and UV and {gamma}-rays have been described (FASULLO and DAVE 1994 Down; FASULLO et al. 1994 Down). At least three independent experiments were done for each DNA-damaging agent. We reported the spontaneous recombination frequencies [number of His+ recombinants per colony forming unit (CFU)], recombination frequencies obtained after exposure to DNA-damaging agents (stimulated frequency), and net frequencies for each DNA-damaging agent. The average net frequency of His+ recombinants was determined by first subtracting the spontaneous frequency from the stimulated frequency for each experiment and then taking the average, and it is a calculation different from subtracting the average of all the spontaneous frequencies from the average of all the stimulated frequencies. The significance of the differences between rad51 mutants and RAD51 strains was determined using the two-tailed paired sample t-test (ZAR 1996 Down).

For measuring X-ray stimulation of SCE, cells were incubated on ice during irradiation at a dose rate of 120 rad/min. The X-ray radiation source was purchased from Faxitron (Wheeling, IL). After exposure to either UV or X rays, cells were preincubated for 30 min in YPD, washed twice with sterile H2O, and then plated on selective medium (SC-HIS). Statistical significance of the X-ray stimulation of SCE was determined by the nonparametric sign test (ZAR 1996 Down).

Induction of HO endonuclease:
pGHOT-GAL3 (FASULLO et al. 1998 Down), containing the HO gene under GAL control, was introduced into both RAD51 and rad51 strains by selecting for Trp+ transformants. After growth in SC-TRP medium, cells were diluted 1:10 in YPLactate and incubated for a minimum of 12 hr. At a density of 107 cells/ml, glucose or galactose was added to a final concentration of 2%, to either repress or induce the expression of HO endonuclease, respectively. After 2 hr, cells were plated directly on YPD medium for viability and on SC-HIS to measure recombination. Colonies appearing on YPD medium were replica plated on SC-TRP to measure the number of Trp+ colonies containing the pGHOT-GAL3 plasmid.

Verification that His+ recombinants result from unequal SCE or intrachromatid recombination:
Mitotic unequal SCE between his3-{Delta}5' and his3-{Delta}3' results in His+ recombinants that contain HIS3 flanked by his3-{Delta}5' and his3-{Delta}3' (Fig 1; FASULLO and DAVIS 1987 Down). Southern blot hybridization (SOUTHERN 1975 Down) was used to detect a 4.4-kb EcoRI restriction fragment that contains this configuration of HIS3 and the his3 fragments. The presence of the HOcs within this 4.4-kb EcoRI restriction was determined by Southern blot hybridization, using a 117-bp MATa fragment as a probe, and by polymerase chain reaction (PCR; AUSUBEL et al. 1995 Down), using primer 5' GTTGCGGAAAGCTGAAACTA 3' that anneals to the HOcs and primer 5' GGATCCGCTGCACGGTCCTG 3' that anneals upstream of the HIS3 promoter present on his3-{Delta}3'::HOcs.



View larger version (22K):
In this window
In a new window
Download PPT slide
 
Figure 1. Recombination assays used in this study. Ovals represent centromeres and lines represent chromosomes. For simplicity, the left arms of chromosomes are not included. The position and orientation of the his3 recombinational substrates, which are present in strains used to measure (A) reciprocal translocations, (B) unequal SCE, and (C) inversions, are shown. An X designates potential sites of crossovers, and the resulting chromosomal rearrangement is presented. An arrow and feathers denote HIS3. As indicated on the bottom of the figure, the 5' deletion lacks the feathers and the 3' deletion lacks the arrow. The two regions of sequence identity shared by the his3 fragments are indicated by decorated boxes; broadly spaced diagonal lines indicate a region of ~300 bp, and tightly spaced diagonal lines indicate a region of 167 bp. The 117-bp HO cut site (HOcs), as indicated by an arrow, is located between these sequences within the his3-{Delta}3'::HOcs fragment. The EcoRI sites in B and C are designated as an E and positioned centromere proximal to the his3-{Delta}3' fragment and centromere distal to the his3-{Delta}5' fragment.

Mitotic intrachromatid recombination between inverted his3 fragments, his3-{Delta}5' and his3-{Delta}3', results in His+ recombinants that contain HIS3 and his3-{Delta}(5', 3'), a his3 fragment lacking both 5' and 3' sequences (Fig 1). Southern blot hybridization (SOUTHERN 1975 Down) was used to detect a 2.5-kb EcoRI restriction fragment that contains this configuration of HIS3 and the novel his3 fragment.

Chromosomal DNA gels:
Undigested yeast chromosomal DNA was resolved on contour-clamped homogeneous electric field (CHEF) gels containing 1% agarose (CHU et al. 1986 Down). The gels were run at 220 V (6 V/cm) for 26 hr at a 90-sec pulse time (FASULLO et al. 1998 Down), and the temperature of the 0.5x TBE (Tris-borate EDTA) buffer was maintained between 10° and 15°. Chromosomal DNA was transferred to nylon after exposure to 60 mJ/m2 of UV radiation for Southern blot analysis (SOUTHERN 1975 Down). The 1.7-kb BamHI HIS3 fragment was used as a probe.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Recombination assays:
To measure frequencies of SCEs, inversions, and translocations, His+ recombinants were selected that result from mitotic recombination between two truncated his3 fragments (FASULLO and DAVIS 1987 Down; Fig 1). Strains to measure frequencies of translocations contain the his3 fragments positioned on chromosomes II and IV (FASULLO and DAVIS 1987 Down), while strains to measure SCEs and inversions contain the truncated fragments of his3 in tandem at the trp1 locus in either direct or inverted orientation, respectively (FASULLO et al. 1999 Down). In all strains, there are no repeated sequences that flank the recombination substrates. The trp1::his3-{Delta}3'::HOcs fragment was used to directly target HO endonuclease-induced DSBs (FASULLO et al. 1998 Down). Diploid strains that monitor translocations contain one set of chromosome II and IV homologs that do not contain recombinational substrates. Diploid strains that measure SCE are hemizygous for the recombination substrates.

The rate of spontaneous, unequal SCE is unchanged but DNA damage-associated SCE is reduced in rad51 null mutants:
Spontaneous and DNA damage-associated SCE were compared in RAD51 (YB163) and rad51:: URA3 (YB177) haploid strains. Although there was no difference (P > 0.05) in rates of spontaneous SCE in RAD51 [(2.3 ± 1.6) x 10-6] and in rad51 strains [(2.3 ± 0.9) x 10-6], stimulation of SCE after exposure to DNA-damaging agents was significantly reduced (Table 2). When RAD51 haploid cells (YB163) were plated on SC-HIS medium and defined aliquots of 4NQO were then diffused from the center of the plate, a halo of induced His+ recombinants appeared (Fig 2), and the inner radius of the halo is indicative of the toxicity of 4NQO. The ring of recombinants is indicative of recombination and will occur when there are more viable recombinants per total number of inoculated cells, although not always when there are simply more recombinants per viable cells. However, when the rad51 cells (YB177) were plated on SC-HIS and then exposed to either MMS (data not shown) or 4NQO (Fig 2), we observed spontaneous recombinants but no halo of induced His+ recombinants, even when lower concentrations (1 mM) of 4NQO were spotted on plates. To measure the differences in DNA damage-associated SCE between the rad51 mutant and RAD51 strains, we performed experiments in liquid medium. When asynchronous log phase cell cultures were exposed to MMS and 4NQO, the frequencies of His+ recombinants per viable cell were increased fourfold and sevenfold, respectively, above the spontaneous frequencies in wild-type cells, but less than twofold above the spontaneous frequency in the rad51 null mutant (Table 2). Thus, rad51 haploid mutants are defective in the MMS and 4NQO stimulation of SCE but are not defective in spontaneous SCE.



View larger version (112K):
In this window
In a new window
Download PPT slide
 
Figure 2. Plate assay demonstrating DNA damage inducibility of SCE in RAD51 (YB163) and rad1 (YB200) strains but not in rad51 (YB177) strains. Each SC-HIS plate contains a lawn (107) of cells, and the DNA- damaging agent was placed in the center. (A) RAD51 strain + 0.2 µl 4NQO (1 mM). (B) rad51 strain + 0.2 µl 4NQO (1 mM). (C) rad1 strain + 0.2 µl 4NQO (1 mM). (D) RAD51 strain + 0.2 µl 4NQO (14 mM). (E) rad51 strain + 0.2 µl 4NQO (14 mM). (F) rad1 strain + 0.2 µl 4NQO (14 mM).


 
View this table:
In this window
In a new window

 
Table 2. Stimulation of SCE by DNA-damaging agents in RAD51 and the rad51::URA3 mutant

The genetic control of recombinational repair is different in diploids and haploids, and mitotic diploid-specific genes have been identified that are required for recombinational repair (KLEIN 1997 Down). To confirm that the rad51 deficiency in DNA damage-associated SCE was not haploid specific, we constructed a rad51 homozygous diploid (YB202; Table 1) and DNA damage-associated SCE was measured. We observed no halo of 4NQO-induced recombinants on SC-HIS plates (data not shown) and less than a twofold increase in recombination frequencies (4.8 x 10-5 average, N = 3) after rad51 diploid cells were exposed to 10 µM 4NQO compared to the spontaneous frequency (2.9 x 10-5 average, N = 3). When a RAD51 homozygous diploid (YB201) containing the his3 recombination substrates was plated on SC-HIS and 4NQO was diffused from the center of the plate, we observed a halo of 4NQO- induced His+ recombinants (data not shown). Thus, the rad51-conferred deficiency in DNA damage-associated SCE also occurs in diploid strains.

Since rad51-conferred sensitivity to DNA-damaging agents may explain the deficiency of DNA damage-associated SCE, we also measured DNA damage-associated stimulation in a rad1 (YB200) haploid mutant, which is more sensitive to 4NQO than the rad51 mutant (YB177). The enhanced recombinogenicity and toxicity of 4NQO in the rad1 mutant were evident after the rad1 cells (YB200) were plated on SC-HIS medium and aliquots of 4NQO were diffused from the center of the plate; the halo of stimulated His+ recombinants is thicker and has a greater radius compared to similar plates containing RAD51 cells (Fig 2). After cells were exposed to 4NQO in liquid, there was a sixfold increase in the frequencies of SCE per viable cell in the rad1 mutant but no increase was observed for the rad51 mutant (Table 3). Exposure of the rad1 mutant to 10 µM 4NQO in liquid reduced viability to <1% of the unexposed cells, and stimulated recombination in the rad1 mutant could not be detected. These results indicate that DNA damage-associated SCE can be detected when mutant cells are more sensitive to the DNA-damaging agent than wild type and suggests that sensitivity to the DNA-damaging agent per se does not explain the different recombination phenotypes of the rad51 and RAD51 strains.


 
View this table:
In this window
In a new window

 
Table 3. Stimulation of SCE by 1 µM 4NQO in RAD51, rad1::URA3 and rad51::URA3 strains

MMS and 4NQO are sometimes referred to as X-ray mimetic and UV mimetic DNA-damaging agents, respectively (for review, see FRIEDBERG et al. 1995 Down). To determine whether radiation-associated SCE was also deficient in rad51 mutants, we exposed asynchronous log phase cultures of RAD51 and rad51 haploid cells to UV and X rays. Significant increases (P < 0.01) in SCE frequencies were observed after RAD51 cells were exposed to 4, 6, and 8 krad (80 Gy) of X rays (Fig 3); a maximum fourfold increase in SCE frequencies was observed after 8 krad exposure. At these levels of X-ray exposure, the increases in the net frequencies of X-ray-associated SCE are consistent with those reported by BRESSAN et al. 1999 Down. After exposure to UV, we observed a maximum threefold increase in SCE frequencies in the RAD51 strain (Fig 3). No significant increase (P > 0.1) in SCE frequencies was observed after the rad51 haploid was exposed to X rays or to 90 and 120 J/m2 UV; there was a modest twofold increase (P < 0.05) in the SCE frequencies after rad51 cells were exposed to 150 J/m2 UV. There were significant differences (P < 0.05) between the SCE frequencies obtained from RAD51 and rad51 haploid strains when cells were exposed to 90, 120, or 150 J/m2 of UV or when cells were exposed to 4, 6, or 8 krad of X rays. We also observed no significant increase in SCE frequencies after the rad51 diploid (YB202) was exposed to either 60 J/m2 or 90 J/m2 of UV (data not shown). Thus, the rad51 null mutant is defective in radiation-associated SCE.



View larger version (33K):
In this window
In a new window
Download PPT slide
 
Figure 3. DNA damage-associated SCE after RAD51 (YB163) and rad51 (YB177) strains were exposed to X rays and UV. Data on left were obtained when strains were exposed to UV. Data on right were obtained when strains were exposed to X rays. (A) Fraction survival after cells were exposed to UV. (B) Fraction survival after cells were exposed to X rays. (C) Frequency of His+ recombinants plotted against the UV dose. (D) Frequency of His+ recombinants plotted against X-ray dose. (E) Net recombination frequencies of UV-stimulated His+ recombinants. (F) Net recombination frequencies of X-ray-stimulated His+ recombinants. Net recombination frequency is the stimulated frequency of recombination - spontaneous frequency of recombination. Solid diamond is RAD51 (YB163) and open circle is rad51 (YB177).

Rad51 mutants are defective in HO-induced SCE but not HO-induced intrachromatid deletions:
One difficulty with comparing the radiation-associated stimulation of SCE in RAD51 and rad51 mutant strains is that the level of radiation exposure necessary to generate significant stimulation of SCE in RAD51 strains results in significant lethality in rad51 mutant strains. A SCE recombination assay was therefore developed so that a site-directed DSB could stimulate unequal SCE but not confer a high level of lethality in the rad51 strains (Fig 4). DSBs were targeted directly to the recombinational substrate by inserting the HO cut site (HOcs) into the his3-{Delta}3' fragment (FASULLO et al. 1998 Down) and expressing HO from a galactose-regulated promoter contained on the plasmid pGHOT-GAL3. The DSB could be repaired by intrachromatid recombination, by nonhomologous end-joining (NHEJ), or by SCE (Fig 4). Both RAD51 and rad51 strains contain the MATa-inc or MAT{alpha}-inc allele so that there is no HO endonuclease digestion at the MAT locus. Since the phase of the cell cycle was not synchronized, we expected that there would be significant cleavage of the chromosome in G1 cells, and thus many of the recombination events would occur by intrachromatid recombination.



View larger version (20K):
In this window
In a new window
Download PPT slide
 
Figure 4. Recombinational repair of the HO-induced DSB at his3-{Delta}3'::HOcs can occur by either SCE or intrachromatid recombination. Each line represents a single strand of DNA, and the arrow indicates the 3' end. Symbols for his3 fragments are explained in Fig 1. A and B represent two sister chromatids. (Left) SSA results in a single his3 fragment, his3-{Delta}(5', 3'), lacking both the 3' and 5' ends of HIS3. The resulting recombinant is His-. (Right) Gap repair results in the formation of the double Holliday structure. Resolution of this intermediate may generate either a His+ or a His- recombinant.

Relative to uninduced cells, the expression of HO endonuclease slightly reduced viability in both RAD51 and rad51 mutant cells to comparable levels (Table 4). Cleavage of chromosome IV was monitored by Southern blots (data not shown). Whereas there was an ~11-fold increase in the SCE frequency in RAD51 cells after HO induction, there was no detectable increase in the SCE frequency after HO induction in the rad51 cells (Table 4). Also, no detectable increase in the SCE frequency was observed when cells were cultured in YPL and switched to glucose medium. Unequal SCE was confirmed by Southern blot analysis (Fig 4). To confirm that the His+ recombinants resulted from cleavage at the HOcs, we determined the proportion of the His+ recombinants that contain the HOcs at the recombination substrates. PCR analysis revealed that among Rad+ His+ recombinants that appeared after HO induction, 15 of 20 no longer contained the HOcs at his3-{Delta}3', as predicted if HO digestion occurred at his3-{Delta}3'::HOcs and initiated the recombination events. Southern blot analysis also confirmed that His+ recombinants lack the HOcs (data not shown). From the rad51 strain YB177, 10 of 10 His+ recombinants that appeared after HO induction still contained an HOcs at his3-{Delta}3'. Thus, in the RAD51 strain (YB163) higher SCE frequencies after HO induction correlate with the absence of the HOcs in the His+ recombinants, while His+ recombinants that appeared in the rad51 mutant YB177 after HO endonuclease induction were likely generated by spontaneous recombination.


 
View this table:
In this window
In a new window

 
Table 4. Stimulation of SCE by HO-induced DSBs in RAD51 (YB163) and rad51::URA3 (YB177) strains

Equivalent lethality of HO-induced DSBs in RAD51 and rad51 strains suggests that alternative pathways for repair of the DSB at the HOcs, such as intrachromosomal recombinational repair (SUGAWARA et al. 1995 Down) or NHEJ (religation), are preferred pathways for DSB repair in our strain construction. Although there is a low probability that His+ recombinants can result from intrachromatid recombination (FASULLO et al. 1998 Down), intrachromatid recombination between his3 fragments could generate His- recombinants either by gap filling or by single-strand annealing (SSA) repair mechanisms (Fig 4). Whereas both recombination mechanisms would result in the elimination of the HOcs, SSA would generate a single his3 fragment, which could not recombine to generate HIS3. We therefore determined whether unselected Trp+ His- CFU arising after HO induction can generate His+ recombinants. Of a total of 163 unselected Trp+ His- colonies that appeared after HO induction, 75% (28/40) from RAD51 and 76% (93/123) from rad51 strains did not generate His+ recombinants. We speculate that some of the remaining ~25% of the unselected Trp+ His- colonies result from cells in which the DSB was repaired by religation; a similar percentage of religation events are obtained after HO cleavage at MAT{alpha} in cells lacking HML and HMR (LEE et al. 1999 Down). Among the Trp+ His- colonies that did not generate His+ recombinants, Southern blot and PCR analysis confirmed that 10/10 Trp+ His- colonies from both RAD51 and rad51 strains contained only a single ~1-kb his3 fragment that lacked the HOcs (Fig 5). Thus, digestion by HO endonuclease occurred in both RAD51 and rad51 strains and efficiently stimulated SSA, but stimulated SCE only in the RAD51 strain. These results are consistent with previous investigations that showed that SSA is RAD51 independent (IVANOV et al. 1996 Down) and account for the high level of viability obtained after HO induction in strains containing the tandem his3 fragments.



View larger version (83K):
In this window
In a new window
Download PPT slide
 
Figure 5. Southern blot analysis of His+ and His- recombinants from RAD51 (YB163) and rad51 (YB177), which arise after HO induction. EcoRI-digested DNA was resolved on agarose, transferred to nylon membrane, and probed with 32P-HIS3. The 4.4-kb EcoRI fragment is indicative of HIS3 flanked by his3-{Delta}3' and his3-{Delta}5', the 2.5-kb EcoRI fragment is indicative of the parental configuration of his3-{Delta}3' and his3-{Delta}5', and the 1.0-kb EcoRI fragment is indicative of the his3-{Delta}(5', 3') fragment. Lanes: A, His- parental RAD51 (YB163); B, His+ recombinant from RAD51 resulting from unequal SCE; C, His- recombinant from RAD51 resulting from SSA; D, His- parental rad51 (YB177); E, His+ recombinant from rad51 resulting from unequal SCE; F, His- recombinant from rad51 resulting from SSA.

DNA damage-associated translocations in rad51 mutants:
We had previously observed that rad9 mutants are defective in DSB-induced SCE but exhibit increased frequencies of spontaneous and DNA damage-associated translocations (FASULLO et al. 1998 Down). If rad51 mutants are also deficient in DNA damage-associated SCE, do rad51 mutants also exhibit higher frequencies of DNA damage-associated translocation events? A rad51 disruption was made in a haploid strain (YB109) containing his3 fragments on nonhomologs to monitor translocation events (Fig 1). We found no significant difference in the rate of spontaneous translocations in the rad51 (YB168) strain (1.2 x 10-8), compared to the wild-type strain (2 x 10-8). We also observed no increase in the frequencies of radiation-associated translocations after haploid cells were exposed to 60 J/m2 and 90 J/m2 of UV (data not shown). Since both the frequencies of surviving spontaneous and DNA damage-associated translocations are greater in diploids than haploids (FASULLO et al. 1994 Down, FASULLO et al. 1998 Down), we measured rates of spontaneous translocations and frequencies of DNA damage-associated translocations in rad51 diploids. There was about an eightfold increase (P < 0.05, N = 3) in the rate of spontaneous translocations in the diploid rad51 mutant [(3.3 ± 0.9) x 10-7 ] compared to the diploid RAD51 strain YB110 [(4.4 ± 2.3) x 10-8] .

We then measured the frequencies of DNA damage-associated translocations in the diploid rad51 mutant YB170 (Table 5). We observed that the frequencies of UV and ionizing radiation-associated translocations were higher in the rad51 diploid mutant, in comparison to the RAD51 diploid YB110. There was an ~10-fold or greater increase in the radiation-associated frequencies of translocations at lower levels of radiation exposure. After exposure to 14 µM 4NQO, there was a <2-fold increase in the net frequencies of DNA damage-associated translocations in the rad51 diploid (1.4 x 10-5 average, N = 2) compared to the RAD51 diploid (9 x 10-6 average, N = 2). Thus, the increase in the frequencies of DNA damage-associated translocations in rad51 mutants depends on the identity of the DNA-damaging agent.


 
View this table:
In this window
In a new window

 
Table 5. Stimulation of translocations by UV, X rays, and {gamma}-rays in RAD51 (YB110) and in rad51::URA3 (YB170) diploid

Both reciprocal and nonreciprocal translocations are generated in rad51 mutants:
In diploid strains, viable His+ recombinants can contain either reciprocal translocations (CEN2::IV and CEN4::II) or only one translocation (CEN2::IV) that contains HIS3 (FASULLO et al. 1998 Down). Both reciprocal and nonreciprocal translocations have been previously observed in spontaneous and DNA damage-associated His+ recombinants in rad9 mutants, which exhibit higher frequencies of DNA damage-associated translocations (FASULLO et al. 1998 Down). We therefore determined the electrophoretic karyotypes of spontaneous and radiation-associated His+ recombinants by CHEF and Southern blot analysis using HIS3 as a probe. Among 11 independent spontaneous recombinants, 3 contained reciprocal translocations and 8 contained a nonreciprocal translocation (data not shown). Among eight radiation-associated recombinants, one contained a reciprocal translocation, six contained nonreciprocal translocations, and one contained a novel rearrangement (Fig 6). In five of the seven radiation-associated His+ recombinants that contained nonreciprocal translocations, wild-type chromosomes IV and/or II retained his3 sequences. We therefore conclude that both reciprocal and nonreciprocal translocations can occur in rad51 mutants. Considering that reciprocal translocations predominate in Rad+ diploid strains (FASULLO et al. 1998 Down), the generation of nonreciprocal translocations contributes to the enhanced ectopic recombination observed in rad51 mutants.




View larger version (165K):
In this window
In a new window
Download PPT slide
 
Figure 6. Electrophoretic karyotype of spontaneous His+ recombinants resulting from ectopic recombination between GAL1::his3-{Delta}5' and trp1::his3-{Delta}3' in the rad51 diploid YB170. Polaroid picture of ethidium-bromide-stained gel (A). Southern blot of the same gel that is probed with a 32P-labeled 1.7-kb BamHI fragment containing HIS3 (B). Arrows point to the well, wild-type chromosomes II and IV, and the translocations CEN2::IV and CEN4::II. Hybridization to chromosome XV results from the DNA homology between the his3-{Delta}200 locus and the sequences that flank HIS3 within the 1.7-kb BamHI fragment. Lanes: A, His- YB170 (parental configuration); B, His+ nonreciprocal translocation; C, His+ nonreciprocal translocation; D, His+ reciprocal translocation; E, His+ nonreciprocal translocation; F, His+ nonreciprocal translocation; G, His+ nonreciprocal translocation; H, His+ nonreciprocal translocation; I, His+ unidentified chromosomal rearrangement; J, His- YB170 (parental configuration).

DNA damage-associated inversions in rad51 mutants:
Since the low numbers of reciprocal translocations in rad51 diploid mutants suggested that reciprocal exchanges are not stimulated in rad51 mutants, we measured spontaneous and DNA damage-associated recombination between inverted fragments of his3 (Fig 1). Mitotic recombination between inverted fragments requires that both reciprocal products are recovered for the recombinant to be viable; a simple intrachromatid reciprocal exchange could generate the inversion, but sister chromatid gene conversion is a possibility (CHEN and JINKS ROBERTSON 1998 Down). Rad51 disruptions were made in strains containing inverted his3 fragments. Rates of spontaneous inversions were significantly (P < 0.05) decreased two- to threefold from (4.4 ± 2.3) x 10-6 in the RAD51 strain (YB165) to (1.7 ± 1.1) x 10-6 observed in the rad51 (YB196) strain. We observed no halo of induced MMS- and NQO-stimulated recombinants, as visually determined by a simple plate test (data not shown).

We then determined whether recombination between inverted his3 fragments could be stimulated after HO induction (Table 6). Although induction of HO endonuclease elevated recombination frequencies in RAD51 and rad51 strains, the HO-induced recombination frequencies were about sevenfold higher in the wild type compared to the rad51 mutant. We speculate that the loss of viability after HO induction results from the inability of the cells to repair the HO-induced DSB by SSA when the his3 fragments are in the inverted orientation. Thus, spontaneous and DNA damage-associated recombination between inverted fragments of his3 were also reduced in the rad51 null mutant, indicating that RAD51 participates in reciprocal exchange between his3 fragments.


 
View this table:
In this window
In a new window

 
Table 6. Stimulation of intrachromatid recombination by HO-induced DSBs in RAD51 (YB197) and rad51::URA3 (YB196) strains


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast rad51 mutants exhibit pleiotropic phenotypes including radiation sensitivity and spore inviability attributed to defects in DNA gap repair. Although the participation of RAD51 in G2 recombinational repair and mitotic gene conversion is well documented, the mitotic hyperrecombination phenotypes of rad51 mutants are not well understood. We measured the frequencies of spontaneous and DNA damage-associated chromosomal rearrangements, which were generated by homologous recombination between his3 fragments in both RAD51 and rad51 strains. We observed that yeast rad51 mutants exhibit (1) higher frequencies of spontaneous and DNA damage-associated chromosomal translocations, (2) reduced levels of DNA damage-associated SCE, and (3) lower frequencies of spontaneous and DNA damage-associated inversions. Whereas the rad51-enhanced frequencies of DNA damage-associated translocations depended on diploidy and the type of DNA-damaging agent, DNA damage-associated SCE was RAD51 dependent regardless of the DNA-damaging agent or the strain ploidy. We suggest that the rad51 hyperrecombination phenotype results from higher levels of BIR when G2 recombination and gap repair mechanisms are defective in rad51 mutants.

Enhanced frequencies of nonreciprocal translocations are consistent with a BIR model for rad51-independent recombination:
BIR is initiated by DSBs when the replication apparatus cannot bypass DNA single-strand breaks resulting in the collapse of the replication fork (MICHEL 2000 Down) or when a DSB is not repaired by more efficient gap repair mechanisms (MALKOVA et al. 1996 Down). DNA synthesis is initiated when the 3' end of the broken chromatid invades an intact template, such as a sister chromatid or homolog. However, if the 3' end of the broken chromatid contains sequence homology to a repeated sequence and invades a repeated sequence located at an ectopic site, BIR may generate chromosomal rearrangements, such as a nonreciprocal translocation (BOSCO and HABER 1998 Down).

BIR-mediated recombination between his3 sequences on chromosomes II and IV would result in the formation of nonreciprocal translocations and the conservation of wild-type chromosomes II and/or IV (Fig 6) and explain the lower proportion of reciprocal translocations observed among the total homology-directed translocations in rad51 diploids. A DSB at GAL1::his3-{Delta}5' could stimulate strand invasion at trp1::his3-{Delta}3' and initiate replication of the long arm of chromosome IV. Since haploids containing a nonreciprocal translocation and lacking genetic information on chromosomes II or IV would be inviable, BIR may explain the occurrence of higher frequencies of spontaneous and DNA damage-associated translocations in rad51 diploids but not in rad51 haploids.

We suggest that the failure to repair DSBs by gap repair in rad51 mutants may lead to the persistence of chromosomal breaks that could initiate recombination between nonhomologs, generating more nonreciprocal translocations (Fig 7). Since rad51 mutants are defective in DNA damage-associated homolog recombination (MORRISON and HASTINGS 1979 Down), we cannot prove that the rad51 defect in DNA damage-associated SCE is the direct cause of the higher levels of translocations. The persistence of some types of DNA adducts after several rounds of cell division, such as those generated by 4NQO (DAZA et al. 1992 Down), implies that some DNA lesions are more easily bypassed by DNA polymerases and may poorly initiate BIR. Thus, some DNA-damaging agents may stimulate similar frequencies of translocations in RAD51 and rad51 diploids because of efficient DNA damage tolerance mechanisms for particular DNA adducts.



View larger version (20K):
In this window
In a new window
Download PPT slide
 
Figure 7. A proposed model of how defective gap repair in rad51 mutants could enhance BIR, resulting in the generation of a nonreciprocal translocation involving chromosomes II and IV (Fig 6). Each line represents a single strand of DNA, and the arrow indicates the 3' end. Chromosomes II and IV are designated by roman numerals. (Left) The DSB occurs at a site on the sister chromatid after polymerase progression and initiates SCE by gap repair (SZOSTAK et al. 1983 Down). (Right) The DSB occurs as a consequence of polymerase progression past a single-strand nick. Replication is then reinitiated after the 3' end of the broken chromatid invades the intact sister chromatid. Nonreciprocal translocations can be generated by BIR if the 3' end of the broken chromatid invades an intact nonhomologous chromosome. The dashed arrow indicates the possibility that a DSB, which cannot be repaired by gap repair in a rad51 mutant, can initiate BIR and generate a nonreciprocal translocation.

The decrease in the frequency of radiation-associated translocations in rad51 diploids after exposure to 15.6 krad of {gamma}-rays (Table 5) is consistent with observations that induction of DSBs at MAT in rad51 diploids results in a significant percentage of inviable cells; this lethality may result from the formation of recombination intermediates that interfere with normal DNA replication (MALKOVA et al. 1996 Down). We speculate that, similar to HO-induced DSBs, some radiation-induced DSBs would initiate BIR and generate lethal recombination intermediates in S phase; thus, a greater number of such intermediates may occur after exposure to 15.6 krad of {gamma}-rays and decrease the frequency of nonreciprocal translocations. BIR-mediated ectopic recombination may be restricted to late S or G2 phases of the cell cycle when recombination intermediates do not interfere with chromosomal replication.

Reduced frequencies of spontaneous and DNA damage-associated inversions generated by recombination between inverted his3 fragments support the idea that rad51 mutants are defective in reciprocal exchange (RATTRAY and SYMINGTON 1995 Down; BARTSCH et al. 2000 Down). RAD51-independent BIR mechanisms would be unlikely to generate chromosomal inversions because BIR, if initiated by the invasion of a 3' end of a broken chromatid on an inverted sequence, could generate a dicentric chromosome. Thus, the RAD51 dependence of reciprocal exchange between inverted sequences supports the notion that higher frequencies of spontaneous and DNA damage-associated translocations in rad51 mutants do not result from a RAD51-independent reciprocal exchange pathway.

Spontaneous unequal SCE is RAD51 independent but DNA damage-induced SCE is defective in rad51 mutants:
The RAD51 independence of spontaneous unequal SCE and the RAD51 dependence of DNA damage-associated unequal SCE indicate that there are two recombination pathways involved in generating unequal SCE in yeast. Minor RAD51-independent, RAD59-dependent gap repair and BIR pathways (BARTSCH et al. 2000 Down) may be responsible for RAD51-independent SCE. Since rad51 mutants did not exhibit higher levels of unequal SCE resulting from HO-induced DSBs, we would suggest that DSB-initiated gap repair mechanisms that generate spontaneous SCE events are also RAD51 dependent. Thus, we speculate that the majority of spontaneous unequal SCE occurs by BIR.

Our results indicate that diverse DNA-damaging agents, such as UV, MMS, 4NQO, and X rays, stimulate SCE by RAD51-dependent recombination mechanisms. DSBs may be indirectly formed in an attempt to repair either MMS-, 4NQO-, or UV-induced DNA lesions (KADYK and HARTWELL 1993 Down; FRIEDBERG et al. 1995 Down) and may stimulate recombination by RAD51-dependent gap repair. When UV-induced pyrimidine dimers cannot be excised, as in rad1 mutants, DNA replication is necessary to create the recombinogenic lesion; this is referred to as replication-dependent recombination (KADYK and HARTWELL 1993 Down). The enhanced 4NQO stimulation of unequal SCE observed in the rad1 mutant is also likely to occur by replication-dependent recombination. Considering that rad1 rad51 double mutants exhibit a synergistic sensitivity to UV compared to the single mutants (GAME and COX 1973 Down), we would suggest that replication-dependent SCE is also RAD51 dependent.

We have yet to identify DNA-damaging agents that directly stimulate RAD51-independent BIR. Although X rays can generate single-strand breaks (FRIEDBERG et al. 1995 Down) that could stimulate BIR, observations that the highest levels of X-ray-induced SCEs occur in G2 after replication is completed (KADYK and HARTWELL 1992 Down) suggest that BIR is not the predominant mechanism by which X rays stimulate SCE.

Comparison of the genetic instability phenotype of rad51 and rad9 mutants:
Both rad51 and rad9 mutants exhibit no change in the spontaneous rate of SCE, a decrease in radiation-associated SCE, and an increase in radiation-associated nonreciprocal translocation events (FASULLO et al. 1998 Down). We suggest that the rad9-enhanced frequencies of translocations result from the failure to arrest the cell cycle at the G2 checkpoint; the segregation of damaged chromatids thus stimulates more translocations in the next cell cycle (FASULLO et al. 1998 Down). In comparison to rad9 mutants, rad51 mutants still exhibit RAD9-mediated G2 arrest but are deficient in DNA damage-associated SCE when cells are exposed to either MMS or UV, which are known to stimulate replication-dependent SCE (KADYK and HARTWELL 1993 Down; ENGELWARD et al. 1998 Down). Thus, we speculate that DNA damage-associated translocations may result from more chromosomal breaks generated in S phase in rad51 mutants. Further experiments are in progress to determine whether rad9 rad51 double mutants would exhibit synergistic increases in the frequencies of translocations compared to the single mutants.

Comparisons with other assays to measure ectopic recombination:
We measured frequencies of specific chromosomal rearrangements by selecting for mitotic recombination between truncated his3 fragments and thus avoided screening a large background of mitotic gene conversion events. However, other methods for measuring frequencies of homology-directed chromosomal rearrangements have relied on measuring mitotic gene conversion events associated with exchange of flanking markers. For example, LIEFSHITZ et al. 1995 Down have shown that ectopic recombination between yeast Ty1 elements is RAD51 dependent. Our observation that rad51 mutants were defective in reciprocal exchange between his3 fragments is consistent with previous conclusions based on measurements of gene conversion and associated crossover events between an ade2 allele and an ade2 fragment in rad51 mutants (RATTRAY and SYMINGTON 1995 Down). It will be important to determine whether the rad51-enhanced frequencies of homology-directed translocations depend on the length of the repeated sequences or would be observed when gene conversion and associated crossovers were measured between repeated sequences on nonhomologs.

Comparison to other recA/RAD51 homologues:
We speculate that other eukaryotic recA/RAD51 homologues may function in DNA damage-associated SCE and control genetic stability. The cell-cycle regulation of these genes may facilitate sister chromatids as substrates for recombinational repair. Recently, it has been shown that RAD51-dependent homologous recombination is involved in SCE in vertebrate cells (MORRISON et al. 1999 Down; SONADA et al. 1999). In addition, mutants defective in XRCC1 and XRCC2, mammalian homologues of yeast RAD51, exhibit higher frequencies of chromosomal aberrations (CUI et al. 1999 Down). Thus, products of mammalian tumor suppressor genes that associate with human Rad51, such as BRCA1 (SCULLY et al. 1997 Down), may facilitate SCE and reduce DNA damage-associated mutation or ectopic recombination.

Summary:
We have defined two new phenotypes for rad51 mutants: (1) defective DNA damage-associated SCE and (2) a higher spontaneous rate of homology-directed translocations. Thus, this is the first study to correlate a defect in DNA damage-associated SCE with an increase in homology-directed chromosomal translocations in rad51 mutants. It will be important to determine whether mutations in other recA/RAD51 homologues confer similar phenotypes.


*  ACKNOWLEDGMENTS

We thank Debra Bressan for X-ray irradiation protocols and acknowledge John Bissonette and Rohan Samarakoon for insightful observations when this project was initiated. We thank Dilip Nag and Robert Bauchwitz for critical comments, Doug Bishop for the rad51 disruption plasmid, and Brenda Boggs for technical assistance. This work was supported by U.S. Public Health Service grant CA-70105 from the National Institutes of Health.

Manuscript received March 20, 2000; Accepted for publication April 2, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABOUSSEKHRA, A., R. CHANET, A. ADJIRI, and F. FABRE, 1992  Semidominant suppressors of Srs2 helicase mutation of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to procaryotic RecA proteins. Mol. Cell. Biol. 12:3224-3234[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. (Editors), 1995 Current Protocols in Molecular Biology, Vol. 2, pp. 15.0.1–15.1.9. John Wiley & Sons, New York.

BAI, Y. and L. S. SYMINGTON, 1996  A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae. Genes Dev. 10:2025-2037[Abstract/Free Full Text].

BARTSCH, S., L. KANG, and L. S. SYMINGTON, 2000  RAD51 is required for the repair of plasmid double-stranded DNA gaps from either plasmid or chromosomal templates. Mol. Cell. Biol. 20:1194-1205[Abstract/Free Full Text].

BASILE, G., M. AKER, and R. K. MORTIMER, 1992  Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51. Mol. Cell. Biol. 12:3235-3246[Abstract/Free Full Text].

BOSCO, G. and J. E. HABER, 1998  Chromosome break-induced DNA replication leads to nonreciprocal translocations and telomere capture. Genetics 150:1037-1047[Abstract/Free Full Text].

BRESSAN, D., B. BAXTER, and J. H. PETRINI, 1999  The Mre11-Rad50-Xrs3 protein complex facilitates homologous recombination-based double-strand break repair in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:7681-7687[Abstract/Free Full Text].

CHEN, C., K. UMEZU, and R. D. KOLODNER, 1998  Chromosomal rearrangements occur in S. cerevisiae rfa1 mutator mutants due to mutagenic lesions processed by double-strand-break repair. Mol. Cell 2:9-22[Medline].

CHEN, D., B. YANG, and T. KUO, 1992  One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].

CHEN, F., A. NASTASI, S. ZHIYUAN, M. BRENNEMAN, and H. CRISSMAN et al., 1997  Cell cycle-dependent protein expression of mammalian homologs of yeast DNA double-strand break repair genes Rad51 and Rad52.. Mutat. Res. 384:205-211[Medline].

CHEN, W. and S. JINKS ROBERTSON, 1998  Mismatch repair protein regulates heteroduplex formation during mitotic recombination in yeast. Mol. Cell. Biol. 18:6525-6537[Abstract/Free Full Text].

CHU, G. D., D. VOLLRATH, and R. W. DAVIS, 1986  Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science 234:1582-1585[Abstract/Free Full Text].

CLARK, A. J. and S. J. SANDLER, 1994  Homologous genetic recombination: the pieces begin to fall into place. Crit. Rev. Microbiol. 20:125-142[Medline].

CUI, X., M. BRENNEMAN, J. MEYNE, M. OSHIMURA, and E. GOODWIN et al., 1999  The XRCC2 and XRCC3 repair genes are required for chromosome stability in mammalian cells. Mutat. Res. 434:75-88[Medline].

DAZA, P., P. ESCALZA, S. MATEOS, and F. CORTES, 1992  Mitomycin C, 4-nitroquinoline-1-oxide and ethyl methanesulfonate induce long-lived lesions in DNA which result in SCEs during successive cell cycles in human lymphocytes. Mutat. Res. 270:177-183[Medline].

ENGELWARD, B. P., J. M. ALLAN, A. J. DRESLIN, J. D. KELLY, and M. M. WU et al., 1998  A chemical and genetic approach together define the biological consequences of 3-methyl adenine lesions in the mammalian genome. J. Biol. Chem. 273:5412-5418[Abstract/Free Full Text].

ESPOSITO, M. S., D. T. MALEAS, K. A. BJORNSTAD, and C. V. BRUSCHI, 1982  Simultaneous detection of changes in chromosome number, gene conversion and intergenic recombination during mitosis of Saccharomyces cerevisiae: spontaneous and ultraviolet light induced events. Curr. Genet. 6:5-11.

FASULLO, M. and P. DAVE, 1994  Mating-type regulates the DNA damage-associated stimulation of reciprocal translocation events in Saccharomyces cerevisiae. Mol. Gen. Genet. 243:63-70[Medline].

FASULLO, M. T. and R. W. DAVIS, 1987  Recombinational substrates designed to study recombination between unique and repetitive sequences in vivo. Proc. Natl. Acad. Sci. USA 84:6215-6219[Abstract/Free Full Text].

FASULLO, M., P. DAVE, and R. ROTHSTEIN, 1994  DNA-damaging agents stimulate the formation of directed reciprocal translocations in Saccharomyces cerevisiae. Mutat. Res. 314:121-133[Medline].

FASULLO, M., T. BENNETT, P. AHCHING, and J. KOUDELIK, 1998  The Saccharomyces cerevisiae RAD9 checkpoint reduces the DNA damage-associated stimulation of directed translocations. Mol. Cell. Biol. 18:1190-1200[Abstract/Free Full Text].

FASULLO, M., T. BENNETT, and P. DAVE, 1999  Expression of Saccharomyces cerevisiae MATa and MAT{alpha} enhances the HO endonuclease-stimulation of chromosomal rearrangements directed by his3 recombinational substrates. Mutat. Res. 433:33-44[Medline].

FRIEDBERG, E. C., G. C. WALKER and W. SIEDE, 1995 DNA repair and mutagenesis. ASM Press, Washington DC.

GAME, J. C., 1983 Radiation-sensitive mutants and repair in yeast, pp. 109–137 in Yeast Genetics: Fundamental and Applied Aspects, edited by J. F. T. SPENCER, D. M. SPENCER and A. R. W. SMITH. Springer-Verlag, New York.

GAME, J. and B. S. COX, 1973  Synergistic interactions between rad mutations in yeast. Mutat. Res. 16:35-44.

HABER, J. E., 1999  DNA recombination: the replication connection. Trends Biochem. Sci. 24:271-275[Medline].

HIGGINS, D. R., S. PRAKASH, P. REYNOLDS, and L. PRAKASH, 1983  Molecular cloning and characterization of the RAD1 gene of Saccharomyces cerevisiae.. Gene 26:119-126[Medline].

IVANOV, E., N. SUGAWARA, J. FISHMAN-LOBELL, and J. HABER, 1996  Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae. Genetics 142:693-704[Abstract].

KADYK, L. C. and L. H. HARTWELL, 1992  Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae. Genetics 132:387-402[Abstract].

KADYK, L. C. and L. H. HARTWELL, 1993  Replication dependent sister chromatid recombination in rad1 mutants of Saccharomyces cerevisiae. Genetics 133:469-487[Abstract].

KLEIN, H. L., 1997  RDH54, a RAD54 homologue in Saccharomyces cerevisiae, is required for mitotic diploid-specific recombination and repair and for meiosis. Genetics 147:1533-1544[Abstract].

KOWALCZYKOWSKI, S. C., D. DIXON, A. K. EGGLESTON, S. D. LAUDER, and W. M. REHRAUER, 1994  Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 58:401-465[Abstract/Free Full Text].

LE, S., J. K. MOORE, J. E. HABER, and C. W. GREIDER, 1999  RAD50 and RAD51 define two pathways that collaborate to maintain telomeres in the absence of telomerase. Genetics 152:143-152[Abstract/Free Full Text].

LEA, D. E. and C. A. COULSON, 1949  The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-284.

LEE, E. L., F. PAQUES, J. SYLVAN, and J. E. HABER, 1999  Role of yeast SIR genes and mating type in directing DNA double-strand breaks to homologous and non-homologous repair paths. Curr. Biol. 19:767-770.

LIEBER, M. R., 1997  The FEN-1 family of structure-specific nucleases in eukaryotic replication, recombination and repair. Bioessays 19:233-240[Medline].

LIEFSHITZ, B., A. PARKET, R. MAYA, and M. KUPIEC, 1995  The role of DNA repair genes in recombination between repeated sequences in yeast. Genetics 140:1199-1211[Abstract].

MALKOVA, A., E. IVANOV, and J. E. HABER, 1996  Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136[Abstract/Free Full Text].

MCDONALD, J. P. and R. ROTHSTEIN, 1994  Unrepaired heteroduplex DNA in Saccharomyces cerevisiae is decreased in RAD1 RAD52-independent recombination. Genetics 137:393-405[Abstract].

MICHEL, B., 2000  Replication fork arrest and DNA recombination. Trends Biochem. Sci. 25:173-178[Medline].

MORRISON, D. P. and P. J. HASTINGS, 1979  Characterization of the mutator mutation mut5–1. Mol. Gen. Genet. 175:57-65[Medline].

MORRISON, C., A. SHINOHARA, E. SONODA, Y. YAMAGUCHI-IWAI, and M. TAKATA et al., 1999  The essential functions of human Rad51 are independent of ATP hydrolysis. Mol. Cell. Biol. 19:6891-6897[Abstract/Free Full Text].

PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp 407–523 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

RATTRAY, A. and L. SYMINGTON, 1995  Multiple pathways for homologous recombination in Saccharomyces cerevisiae. Genetics 139:45-56[Abstract].

ROTHSTEIN, R. J., 1983  One step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].

RUPP, W. D., C. E. I. WILDE, D. L. RENO, and P. HOWARD-FLANDERS, 1971  Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli.. J. Mol. Biol. 61:25-44[Medline].

SCULLY, R., J. CHEN, A. PLUG, Y. XIAO, and D. WEAVER et al., 1997  Association of BRCA1 and Rad51 in mitotic and meiotic cells. Cell 88:265-275[Medline].

SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Appendix A, pp. 163–168 in Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHINOHARA, A. and T. OGAWA, 1999  Rad51/RecA protein families and associated proteins in eukaryotes. Mutat. Res. 435:13-21[Medline].

SHINOHARA, A., H. OGAWA, and T. OGAWA, 1992  Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69:457-470[Medline].

SONODA, E., M. S. SASAKI, C. MORRISON, Y. YAMAGUCHI-IWAIO, and M. TAKATA et al., 1999  Sister chromatid exchanges are mediated by homologous recombination in vertebrate cells. Mol. Cell. Biol. 19:5166-5169[Abstract/Free Full Text].

SOUTHERN, E. M., 1975  Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517[Medline].

SUGAWARA, N., E. L. IVANOV, J. FISHMAN-LOBELL, B. RAY, and X. WU et al., 1995  DNA structure-dependent requirements for yeast RAD gene in gene conversion. Nature 373:84-86[Medline].

SUNG, P., 1994  Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast Rad51 protein. Science 265:1241-1243[Abstract/Free Full Text].

SUNG, P. and D. L. ROBERSON, 1995  DNA strand exchange mediated by a Rad51-ssDNA nucleoprotein filament with polarity opposite to that of RecA. Cell 82:453-461[Medline].

SYMINGTON, L. S., 1998  Homologous recombination is required for the viability of rad27 mutants. Nucleic Acids Res. 26:5589-5595[Abstract/Free Full Text].

SZOSTAK, J. W., T. L. ORR-WEAVER, R. ROTHSTEIN, and F. W. STAHL, 1983  The double-strand break model for recombination. Cell 33:25-35[Medline].

TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997  A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263[Medline].

ZAR, J. H., 1996 Biostatistical Analysis. Prentice Hall, Englewood Cliffs, NJ.

ZOU, H. and R. ROTHSTEIN, 1997  Holliday junctions accumulate in replication mutants via a RecA homolog-independent mechanism. Cell 90:87-96[Medline].




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
J. F. Ruiz, B. Gomez-Gonzalez, and A. Aguilera
Chromosomal Translocations Caused by Either Pol32-Dependent or Pol32-Independent Triparental Break-Induced Replication
Mol. Cell. Biol., October 15, 2009; 29(20): 5441 - 5454.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Agmon, S. Pur, B. Liefshitz, and M. Kupiec
Analysis of repair mechanism choice during homologous recombination
Nucleic Acids Res., August 1, 2009; 37(15): 5081 - 5092.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
F. Cortes-Ledesma, C. Tous, and A. Aguilera
Different genetic requirements for repair of replication-born double-strand breaks by sister-chromatid recombination and break-induced replication
Nucleic Acids Res., October 8, 2007; 35(19): 6560 - 6570.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Llorente and L. S. Symington
The Mre11 Nuclease Is Not Required for 5' to 3' Resection at Multiple HO-Induced Double-Strand Breaks
Mol. Cell. Biol., November 1, 2004; 24(21): 9682 - 9694.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. U. Keller-Seitz, U. Certa, C. Sengstag, F. E. Wurgler, M. Sun, and M. Fasullo
Transcriptional Response of Yeast to Aflatoxin B1: Recombinational Repair Involving RAD51 and RAD1
Mol. Biol. Cell, September 1, 2004; 15(9): 4321 - 4336.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. Dong and M. Fasullo
Multiple recombination pathways for sister chromatid exchange in Saccharomyces cerevisiae: role of RAD1 and the RAD52 epistasis group genes
Nucleic Acids Res., May 15, 2003; 31(10): 2576 - 2585.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Fabre, A. Chan, W.-D. Heyer, and S. Gangloff
Alternate pathways involving Sgs1/Top3, Mus81/ Mms4, and Srs2 prevent formation of toxic recombination intermediates from single-stranded gaps created by DNA replication
PNAS, December 24, 2002; 99(26): 16887 - 16892.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. S. Choy and S. J. Kron
NuA4 Subunit Yng2 Function in Intra-S-Phase DNA Damage Response
Mol. Cell. Biol., December 1, 2002; 22(23): 8215 - 8225.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Stark, P. Hu, A. J. Pierce, M. E. Moynahan, N. Ellis, and M. Jasin
ATP Hydrolysis by Mammalian RAD51 Has a Key Role during Homology-directed DNA Repair
J. Biol. Chem., May 31, 2002; 277(23): 20185 - 20194.
[Abstract] [Full Text] [PDF]