High-Frequency Generation of Conditional Mutations Affecting Drosophila melanogaster Development and Life Span

Corresponding author: John Tower, Department of Biological Sciences, SHS172, University of Southern California, University Park, 835 W. 37th St., Los Angeles, CA 90089-1340., jtower{at}USC.edu (E-mail)

Communicating editor: J. A. BIRCHLER

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Genome sequencing reveals that a large percentage of Drosophila genes have homologs in humans, including many human disease genes. The goal of this research was to develop methods to efficiently test Drosophila genes for functions in vivo. An important challenge is the fact that many genes function at more than one point during development and during the life cycle. Conditional expression systems such as promoters regulated by tetracycline (or its derivative doxycycline) are often ideal for testing gene functions. However, generation of transgenic animals for each gene of interest is impractical. Placing the doxycycline-inducible ("tet-on") promoter directed out of the end of the P transposable element produced a mobile, doxycycline-inducible promoter element, named PdL. PdL was mobilized to 228 locations in the genome and was found to generate conditional (doxycycline-dependent), dominant mutations at high frequency. The temporal control of gene overexpression allowed generation of mutant phenotypes specific to different stages of the life cycle, including metamorphosis and aging. Mutations characterized included inserts in the -mannosidase II (dGMII), ash1, and pumilio genes. Novel phenotypes were identified for each gene, including specific developmental defects and increased or decreased life span. The PdL system should facilitate testing of a large fraction of Drosophila genes for overexpression and misexpression phenotypes at specific developmental and life cycle stages.

SEQUENCING of the Drosophila genome reveals 13,600 genes (ADAMS et al. 2000 ). At least half of these are homologous to human genes, including more than half of known human disease genes (RUBIN et al. 2000 ). The powerful molecular and genetic tools available for Drosophila have made this organism a highly successful model for determining the functions of conserved genes. However, such research is often labor intensive and new functional genomic research methods are required to study the large number of interesting genes identified by the genome sequence. A critical obstacle to this research is the fact that many genes function in multiple processes, at multiple stages of the life cycle, and may be required for viability. Simple loss-of-function mutations or gene "knockouts" often do not allow the organism or cells to proceed to the stage of interest. Conditional mutations, such as ones expressed only at permissive temperatures, overcome this obstacle by providing temporal control of gene function. Temperature-sensitive mutations have been essential for the analysis of diverse biological processes including yeast and mammalian cell cycle and Drosophila and Caenorhabditis elegans development. However, temperature-sensitive mutations are not ideal because they are rare and the temperature shift often has confounding effects on other genes and processes. For example, temperature-sensitive mutations are particularly problematic for study of Drosophila aging, as life span is profoundly affected by temperature (BAKER et al. 1989 ).

Conditional gene expression systems provide a type of conditional, dominant misexpression "mutation." Gene expression can be activated with temporal control in transgenic animals using systems based on recombination and systems triggered by hormones or other chemicals. For example, tetracycline [or doxycycline (DOX)]-regulated promoters have been used to facilitate numerous studies of gene function in mammals and, more recently, in Drosophila (GOSSEN and BUJARD 1992 ; GOSSEN et al. 1995 ; BELLO et al. 1998 ; BIESCHKE et al. 1998 ). Conditional systems are particularly well suited to the study of aging (BIESCHKE et al. 1998 ; SUN and TOWER 1999 ; TOWER 2000 ; J. SUN, D. FOLK, T. J. BRADLEY and J. TOWER, unpublished data). They allow the investigator to avoid toxic or other effects of gene expression during development and determine gene effects in the aging adult, such as increased or decreased life span. In addition, like other quantitative traits, life span is sensitive to genetic background. Conditional systems provide powerful controls for genetic background, as control and overexpressing animals are genetically identical. A drawback of this approach is that generation of transgenic animals for each gene of interest is labor intensive and is not practical for large scale functional genomics.

The Drosophila P transposable element can be readily mobilized to generate hundreds or thousands of Drosophila lines with unique insertions (COOLEY et al. 1988 ). The P element has been engineered to facilitate many types of genetic manipulation, including insertional mutagenesis, enhancer-trapping, and generation of gene misexpression mutations (O'KANE and GEHRING 1987 ; BELLEN 1989; SPRADLING et al. 1995 ; RORTH 1996 ; HAY et al. 1997 ; RORTH et al. 1998 ; TOBA et al. 1999 ; LUCASOVICH et al. 2001 ). In the experiments presented here the usefulness of P-element mutagenesis has been extended by engineering a P element (PdL) that creates conditional (DOX-dependent) mutations at high frequency. The system combines the benefits of the tet-on conditional gene expression system with the utility of P-element mutagenesis.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Drosophila strains:
All D. melanogaster strains are as described (LINDSLEY and ZIMM 1992 ; http://flybase.bio.indiana.edu/).

Drosophila culture and life-span assays:
Drosophila were cultured on standard agar/molasses/cornmeal/yeast media (ASHBURNER 1989 ). To obtain adult flies of defined age, the indicated PdL lines and Oregon-R control strain were crossed to rtTA stock and cultured at 25° in urine specimen bottles. Prior to eclosion of the majority of pupae, bottles were cleared of adults and newly eclosed flies were allowed to emerge over the next 48 hr. The majority of the males will have mated during this time. The males only were then removed and were designated 1 day old and were maintained at 25° at 40 per vial in culture vials with food. At 4 days of age the males were split into control and experimental groups of 200 males each, with experimentals (+DOX) placed on culture media supplemented with 250 µg/ml DOX. Dead flies were counted at each passage, and the number of vials was progressively reduced to maintain 40 flies per vial. To calculate mean life spans for the experimental (+DOX) and control (-DOX) cohorts, each fly's life span was tabulated, their life spans were averaged, and the SEM was calculated. Statistical significance of differences in mean life span was calculated for each experiment using unpaired two-sided t-tests.

Construction and transformation of PdL:
A 560-bp EcoRI to PstI fragment, containing seven tetO repeats and the hsp70 core promoter from -40 to +86, was excised from plasmid p7T40 (BIESCHKE et al. 1998 ) and cloned into the polylinker of pCaSpeR-4 transformation vector (THUMMEL and PIROTTA 1992 ). Multiple independent germ-line transformants of the PdL construct were generated using standard methods (RUBIN and SPRADLING 1982 ), using the y-ac-w¹¹¹⁸ recipient strain (PATTON et al. 1992 ).

Southern analysis of PdL copy number:
DNA was isolated from PdL lines and restriction digested with XbaI, HindIII, and PstI. DNA was transferred to Southern blot and hybridized with a radiolabeled 172-bp fragment from the 3' P end of PdL. This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (atgatgaaataacataaggtggtcccg) and P3MCSREV (atgagttaattcaaaccccacggacat).

Inverse PCR amplification of PdL flanking sequences:
Protocols were as previously described (TOWER et al. 1993 ; TOWER and KURAPATI 1994 ). Briefly, DNA equivalent to one fly was restriction digested with either XbaI, HindIII, or PstI. The DNA was extracted with phenol/chloroform, precipitated with ethanol, resuspended, and treated with T4 ligase overnight at 16°. PCR amplification was performed using primers Pry1 (ccttagcatgtccgtggggtttgaat) and IR (cgggaccaccttatgttatttcatcatg). PCR protocol was as follows: step 1, 95° for 5 min; step 2, 95° for 30 sec; step 3, 51° for 1 min; step 4, 72° for 1 min; step 5, repeat steps 2–4, 40 times; step 6, 72° for 10 min. The PCR product was subcloned into the pCR2.1-TOPO cloning vector (Invitrogen, San Diego). Dideoxy sequencing was carried out using the Sequenase version 2.0 DNA sequencing kit (United States Biochemical, Cleveland) and the T7 and M13 reverse sequencing primers.

DNA sequence analyses:
PdL flanking DNA sequences were used to query GenBank databases using BLASTN program with default settings as provided at the National Center for Biotechnology Information (NCBI) web site (http://www.ncbi.nlm.nih.gov/).

Northern analyses:
Messenger RNA was isolated from adult Drosophila using the RNAqueous kit (Ambion, Austin, TX), fractionated on 1.0% agarose gels and transferred to Gene Screen membranes (DuPont/NEN, Boston, MA). The DNA probe for exon 4 of the dGMII gene was generated by PCR amplification from Drosophila genomic DNA using primers GMIIFWD (ctcgtatgcatcgaatctcttgc) and GMIIREV (tttggccgagctcttggttaagc). The dGMII intergenic region probe was generated using primers GL178478-5 (ggataaagcagaaactgaagccaag) and GL178890-3 (gcagttgcgtcattatcactaagcc). The CG16765 open reading frame (ORF) probe was generated using primers GL179311-5 (cagaatgcaatcttatcagctccag) and GL179719-3 (tggcgaccacgatgatctgaatct). The probe for exon 1 of the ash-1 gene was generated using primers ASH1FWD (gcgcaagaagctggcaag) and ASH1REV (tgtatcgactcttgcagctggcat). The probe for pum exon 9 + 10 was a 700-bp EcoRI to SacI fragment of Drosophila cDNA clone SD03602 (Genome Systems). The probe for pum intron 8 was generated using line 3B2 genomic DNA template and primers IR (cgggaccaccttatgttatttcatcatg) and pum120121 (gtgaaacatttagctttcgacggatgt). The loading control was ribosomal protein gene Rp49 (O'CONNELL and ROSBASH 1984 ). DNA probes were ³²P-labeled using the Prime-It II DNA labeling kit (Stratagene, La Jolla, CA). Hybridization signals were visualized by autoradiography. Transcript size was determined by comparison with 1-kb RNA ladder (GIBCO-BRL, Gaithersburg, MD) according to the manufacturer's instructions.

Electron microscopy:
Scanning electron microscopy was carried out at the University of Southern California Center for Electron Microscopy and Microanalysis, using a Cambridge 360 SEM. Samples were prepared using standard methods, except that critical point drying was replaced by a 15-min treatment with hexamethyldisilazane (ADAMS et al. 1987 ).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Construction, transformation, and transposition of the novel P-element mutagen PdL:
The tet-on tetracycline inducible system (GOSSEN et al. 1995 ) was recently adapted to transgenic Drosophila (BIESCHKE et al. 1998 ). The cytoplasmic actin (actin5c) promoter was used to drive constitutive, tissue-general expression of the reverse tetracycline trans activator (rtTA) in a transgenic construct called rtTA. A tetracycline(DOX)-inducible promoter was constructed by placing seven repeats of the rtTA binding site ("tetO") upstream of a core promoter. The core promoter consisted of hsp70 gene sequences from -40 to +86, including the TATAA box, the transcriptional initiation site, and 86 bp of 5'-untranslated region (UTR) sequences. The hsp70 core promoter lacks all heat-shock response elements and is therefore no longer responsive to stress or age (SIMON et al. 1985 ; WHEELER et al. 1999 ). The synthetic promoter was cloned into the pCaSpeR-4 transformation vector (THUMMEL and PIROTTA 1992 ), with the promoter directed out through the 3'P end sequences to generate PdL (Fig 1). PdL was transformed into Drosophila using standard methods to create 13 independent transgenic lines.

View larger version (16K): In this window In a new window Download PPT slide   Figure 1. P-element construct Ponce de Leon (PdL). The 5' and 3' P end sequences required for transposition are indicated by stippled boxes. Restriction sites and primers used in inverse PCR cloning of flanking sequences are indicated. The orientation of the DOX-inducible synthetic promoter is indicated by a bent arrow. The figure is not to scale.

Three of the PdL transformant lines were tested for frequency of transposition by appropriate crosses to 2-3 transposase source (ROBERTSON et al. 1988 ). Line PdL(X)A yielded the highest frequency (27%) and was used to generate 215 new insertions on the second and third chromosomes, using standard methods (COOLEY et al. 1988 ; TOWER and KURAPATI 1994 ).

Identification of conditional, dominant mutations affecting metamorphosis:
The 215 new insertions of PdL were analyzed along with the 13 original transformant lines. Each of the total 228 PdL insert lines were crossed to flies containing the rtTA transactivator construct, using culture media ±DOX. DOX was not present inside the eggshell because the mothers were not prefed DOX. In this way gene misexpression will be specific to the larval and pupal stages. Progeny containing both PdL and rtTA were scored for viability and visible phenotypes. Out of 228 PdL lines, nine lethal and five visible mutations were identified (Table 1). As expected, the mutations were both conditional (DOX dependent) and dominant. Visible phenotypes included curled wings, blistered wings, and rough eyes (Fig 2). For each of the five visible mutations, zero flies exhibited the mutant phenotype in the absence of DOX. Therefore there is no detectable leakiness of this system with regard to mutant phenotypes. For both the visible and lethal mutations in the presence of DOX, penetrance of the phenotype was high, and varied from 67 to 100%, with most at 100% (Table 1).

View larger version (90K): In this window In a new window Download PPT slide   Figure 2. Phenotypes of conditional, dominant mutations affecting development. Selected control and DOX-cultured flies were examined by scanning electron microscopy. (A) Control flies containing PdL insert 3B2 in the pumilio gene and the rtTA transactivator, genotype w;PdL(3)3B2/rtTA(3)E2. (B) Experimental flies containing PdL insert 3B2 in the pumilio gene and the rtTA transactivator, genotype w;PdL(3)3B2/rtTA(3)E2. The flies were cultured throughout larval and pupal development in the presence of 250 µg/ml DOX, in parallel with the control flies in A. (C) Experimental flies containing PdL inserts and the rtTA transactivator, genotype w;PdL(3)35B1/rtTA(3)E2, cultured throughout larval and pupal development in the presence of 250 µg/ml DOX. Control flies cultured without DOX were wild type and were identical to those in A (data not shown). (D) Compound eye of control flies containing PdL insert 19B3 in the dGMII gene and the rtTA transactivator, genotype w;PdL(3)19B3/rtTA(3)E2. (E) Compound eye of experimental flies containing PdL insert 19B3 in the dGMII gene and the rtTA transactivator, genotype w;PdL(3)19B3/rtTA(3)E2. The flies were cultured throughout larval and pupal development in the presence of 250 µg/ml DOX, in parallel with the control flies in D.

Each of the PdL insertions was made homozygous in the absence of rtTA to assay for recessive phenotypes. Both visible (curled wing) and lethal phenotypes were observed (Table 1).

Identification of conditional, dominant mutations affecting life span:
Thirteen PdL lines were tested for conditional, dominant effects specific to the aging period of the life cycle. These were the 13 lines where DOX feeding and gene overexpression during development was found to cause lethal or visible phenotypes. Each of the 13 lines (as well as Oregon-R wild-type controls) was crossed to rtTA in the absence of DOX, to generate 400 age-synchronized male flies containing both constructs. At 4 days of age the males were split into control and experimental groups, with experimentals placed on culture media supplemented with 250 µg/ml DOX. The flies were transferred to fresh vials every 2 days and the number dead was recorded. Mean life span was calculated, and the percentage difference between control and experimental groups is presented (Table 1). For several lines exhibiting a change in life span with DOX, the experiment was repeated and the results of both experiments are presented. Half of the lines exhibited a conditional, dominant phenotype of reduced life span, with decreases ranging from -4.7 to -32%. The high frequency of negative effects on life span observed is likely due to the fact that this set of lines was not random, but rather one where expression during development had been found to be disruptive or lethal. In contrast, line PdL(3)19B3 exhibited a reproducible increase in life span of 10%, while the control of Oregon-R wild type crossed to rtTA gave no significant change in life span.

Molecular characterization of PdL mutations:
Southern analysis was used to determine the copy number of new PdL inserts in each line (data not shown; summarized in Table 1). Three lines containing single inserts were chosen for molecular analysis. For each of these lines excision of the PdL insert by crossing to 2-3 transposase source reverted the mutation. Chromosomal regions flanking the 3' end of the insert were amplified by inverse PCR and sequenced. Comparison of the flanking sequences with the Drosophila genome database allowed mapping of the site of PdL insertion and the identification of the mutated gene. Line PdL(3)19B3 (rough eye/increased life span) contained an insert in the 5'-UTR of the -mannosidase II (dGMII) gene, 67 bp 5' of the ATG translation start codon (Fig 3A). -Mannosidase II is a Golgi apparatus enzyme involved in protein glycosylation (RABOUILLE et al. 1999 ). RNA was isolated from flies containing the PdL(3)19B3 insert and rtTA, cultured ±DOX. Northern analysis revealed a 4-kb transcript that hybridized to a probe derived from the dGMII exon 4 and that was induced 15-fold by DOX (Fig 3D). As expected, the DOX-induced transcript is slightly larger than the endogenous dGMII transcript. This is because PdL is inserted near +1 of dGMII, and PdL contributes an extra 86 bp of 5'-UTR sequences.

View larger version (70K): In this window In a new window Download PPT slide   Figure 3. Molecular characterization of selected mutations. (A–C) Intron and exon boundaries of the mutated genes are indicated, with numbering according to DNA sequences obtained from NCBI web page (http://www.ncbi.nlm.nih.gov/). Locations for transcriptional initiation and ATG translation start codons are indicated by arrows. PdL inserts are indicated by triangles and each is oriented 5' to 3', as indicated by internal arrows. DNA fragments used as probes in Northern analyses are indicated above each diagram. (A) dGMII [sequence accession no. AJ132715; genomic scaffold sequence AE003682 (ADAMS et al. 2000 )]. (B) ash1 (sequence accession no. U49439). (C) pumilio (sequence accession no. L07943; intron sequence and numbering are from Drosophila genomic scaffold sequence AC no. AE003681; SD10525 cDNA sequence is from AC no. AI543655). (D–F) Northern analysis of selected lines. Oregon-R wild-type strain and the indicated PdL mutant strains were crossed to rtTA. Total RNA was isolated from progeny cultured ±DOX, transferred to Northern blots, and hybridized with the gene-specific probes indicated (A–C). Ribosomal protein 49 gene Rp49 was used as control for loading. Two amounts of RNA were loaded for each sample (1x and 2x, as indicated), and signals were quantitated by phosphoimager. (D) dGMII mutant strains and controls. (E) ash1 mutant strain and controls. (F) pumilio mutant strains and controls.

It was of interest to determine if overexpression was limited to the dGMII gene or whether some DOX-induced transcription might read through to adjacent downstream gene(s). The Northern blot was hybridized to a probe specific for CG16765, which is the next downstream ORF predicted by the Drosophila genome sequence (Fig 3A). The probe hybridized only to a very faint band of approximately the size predicted for the CG16765 transcript (2.2 kb) that was not detectably altered by DOX (Fig 3D and additional data not shown). A probe specific for the intergenic region gave no detectable hybridization (data not shown). While this does not rule out the possibility that a small amount of transcription might read through the dGMII gene, any such transcription that might be occurring does not appear to result in detectable stable RNA.

Line PdL(3)11A3 (lethal/decreased life span) contained an insert in the absent, small or homeotic discs 1 (ash1) gene, 206 bp 5' of the normal ash1 transcription initiation site (Fig 3B). ash1 is a member of the trithorax group of genes and encodes an RNA polymerase II transcription factor that positively regulates expression of homeotic genes during development (LAJEUNESSE and SHEARN 1995 ; TRIPOULAS et al. 1996 ). RNA was isolated from flies containing the PdL(3)11A3 insert and rtTA, cultured ±DOX. Northern analysis revealed an 8.1-kb transcript that hybridized to a probe derived from the ash1 exon 1 and that was induced fourfold by DOX (Fig 3E). For both the dGMII and ash1 mutations, the size of the DOX-induced transcripts suggests that they are correctly terminated and processed.

Line PdL(3)3B2 (curled wing/unchanged life span) contained an insert near the middle of the 120-kb intron 8 of the pumilio gene (Fig 3C). This intron is one of the largest known in Drosophila and contains an 500-bp "hot spot" for P-element insertion (PARISI and LIN 1999 ). Pumilio is an RNA binding protein involved in regulation of translation and is required both maternally and zygotically for multiple stages of development (FORBES and LEHMANN 1998 ; WHARTON et al. 1998 ). Two other PdL mutant lines exhibited a similar curled wing phenotype and were found to have insertions at the same location within pumilio (Fig 3C). Northern analysis of these lines revealed a complex pattern of endogenous and DOX-induced pumilio transcripts common to each of the three lines (Fig 3F). A probe derived from pumilio exons 9 + 10 hybridized to the native 6.9-kb pumilio RNA and a 0.4-kb RNA. A probe derived from pumilio intron 8 revealed that part of the signal at 6.9 kb results from a second RNA originating just downstream of the P-element hotspot. This transcript begins in the intron, was rare or absent in adult males, and was induced 3- to 10-fold by DOX. Two smaller RNAs were also strongly induced by DOX. Searches of the Drosophila cDNA database with sequences from this region of pumilio intron 8 identified several cDNAs derived from wild-type Drosophila tissue culture cells (diagrammed in Fig 3C). These cDNAs also initiate just downstream of the hot spot, contain an ATG start codon in an alternative exon spliced in frame to pumilio exon 9, and encode a potential alternative pumilio protein. Taken together, the data suggest that in the three mutant lines examined, PdL has inserted at the 5' end of a previously unidentified pumilio internal promoter and activated expression of alternative pumilio gene product(s).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

PdL was found to generate conditional, dominant mutations at high frequency. Approximately 7% of mutated chromosomes yielded visible or lethal phenotypes when PdL was activated by DOX feeding during larval and pupal development. It is likely that the frequency at which PdL inserts cause gene overexpression is significantly higher than the frequency at which mutations were identified in these experiments. Genes affecting embryogenesis would not have been detected because DOX is not present inside the eggshell. If desired, such genes could potentially be detected by prefeeding the mothers DOX. In addition, not all overexpressed genes are expected to produce lethal or obvious visible phenotypes, and therefore overexpression of such genes would not have been detected.

In most of the mutant lines, the mutated chromosome had multiple PdL insertions, and there are likely two reasons for this result. First, the starting insert line selected for mobilization had a relatively high transposition frequency, which reduces the effort required to identify new insertions but favors multiple inserts. Second, chromosomes with multiple inserts will be more likely to have a new mutation. The chromosomes examined were ones selected for mutant phenotype, and this selection may have enriched for multiple insert chromosomes.

The temporal control of gene overexpression and mutant phenotype provided by PdL extends the usefulness of P-element mutagenesis. The conditional nature of the PdL mutations allowed identification of stage-specific gene misexpression phenotypes that it had not previously been possible to study. For example, the PdL insertions in pumilio produced a novel curled wing phenotype and suggested the existence of a novel pumilio internal promoter. Misexpression of ash1 specifically in the adult revealed a previously unknown negative effect on life span. Finally, the PdL insertion in dGMII yielded some of the first mutant phenotypes described for this gene. Feeding of DOX during larval and pupal development disrupted eye development, while feeding of DOX only during adulthood resulted in an 10% increase in life span. -Mannosidase II is involved in protein glycosylation and the likely mechanism for either phenotype in Drosophila is currently unclear. In mouse, mutation of the homologous gene encoding -mannosidase II causes a systemic autoimmune disease that becomes more severe with increasing age, and that resembles human lupus erythematosus (CHUI et al. 2001 ). Very recently another group has used a P-element "gene-trap" method to generate a lethal insertion in the Drosophila dGMII gene (LUCASOVICH et al. 2001 ).

In previous studies, P elements with outwardly directed promoters generated (nonconditional) mutations at frequencies ranging from 2 to 64%, depending on the particular promoters used to drive expression (RORTH 1996 ; RORTH et al. 1998 ; TOBA et al. 1999 ). In those studies the elegant GAL4/UAS system (BRAND and PERRIMON 1993 ) was used to provide tissue-specific gene misexpression and tissue-specific phenotypes resulting from a promoter directed out of the end of an engineered P element, called "EP." Activation of EP line gene misexpression in larval imaginal tissues was often associated with wing and eye phenotypes similar to those observed here for PdL. The large pumilio intron 8 is a hot spot for P-element insertion (PARISI and LIN 1999 ); however, no mutant phenotypes were observed for multiple EP insertions at this site (RORTH et al. 1998 ; P. RORTH, personal communication). Because of its unique temporal regulation, PdL mutagenesis is expected to identify gene functions not detected with other methods.

The conditional mutations caused by PdL are dominant gain-of-function mutations, as opposed to the more common loss-of-function mutations resulting from gene disruptions. The gain-of-function phenotypes could result from expression of the gene in the wrong place or in the wrong amount, and both situations have been observed with EP mutagenesis (RORTH et al. 1998 ). An important consideration is that inappropriate expression of a protein by PdL might disrupt development or life span due to a nonspecific effect, such as by preventing cell differentiation or causing a novel, nonspecific toxicity. One way to confirm that the gene is involved in a particular process or pathway of interest is to also examine the loss-of-function phenotype for the gene. This is facilitated by the fact that the PdL insertion may be located such that it disrupts the gene and thereby generates a loss-of-function phenotype when made homozygous. This appears to be the situation with lines PdL(3)3G and PdL(3)3B2 where both the overexpression and recessive phenotypes were a curled wing, and in nine PdL lines where the recessive phenotype was lethality. If a PdL insertion is located such that it does not disrupt the gene, such disruptions can often be generated by imprecise excision or local transposition of the element (SALZ et al. 1987 ; TOWER et al. 1993 ; SPRADLING et al. 1995 ). The dominant and conditional nature of PdL mutations should therefore allow for the relatively rapid and efficient identification of genes of potential interest, which can then be confirmed to be involved in the relevant process or pathway by more traditional analyses. This general strategy has been shown to be highly productive in studies of Drosophila development using EP misexpression mutagenesis (RORTH et al. 1998 , RORTH et al. 2000 ; HUANG and RUBIN 2000 ; MATA et al. 2000 ).

The conditional nature of the mutations generated by PdL makes them particularly well suited to studies of aging and life span. The temporal control of gene overexpression allows the investigator to avoid any toxic or confounding effects during development and study gene functions specifically in the adult. In addition, like other quantitative traits, life span is greatly affected by genetic background, and PdL provides powerful controls for this variable. Control and mutant (overexpressing) flies have identical genetic backgrounds, and therefore any differences observed must be due to DOX and the subsequent gene overexpression or misexpression. Several lines were identified where activation of PdL in the adult caused reductions in life span, with decreases up to -32%. This high frequency of negative effects was not surprising, given that these were lines where activation of PdL during development was disruptive or lethal. Increased life span is expected to be a more rare phenotype of gene misexpression. A small but reproducible increase in life span of 10% was associated with the PdL insertion in the dGMII gene; however, it is not possible to predict how common this phenotype is likely to be based on this one example. It is known that induced overexpression of at least two additional genes, Cu/ZnSOD and MnSOD, can extend adult Drosophila life span based on experiments using different gene expression systems (PARKES et al. 1998 ; SUN and TOWER 1999 ; J. SUN, D. FOLK, T. J. BRADLEY and J. TOWER, unpublished data). It seems likely that additional genes will exist that can extend life span when overexpressed in the adult. The potential for PdL mutagenesis to test large numbers of genes should provide an efficient way to identify additional genes that regulate aging and life span.

	ACKNOWLEDGMENTS

We thank Zhijin Wu for generating the PdL transformation construct. This work was supported by a research grant from the Department of Health and Human Services to J.T. (AG11644 and AG11833) and a postdoctoral training grant award to G.L. (AG00093).

Manuscript received November 20, 2000; Accepted for publication April 25, 2001.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ADAMS, J. L., C. J. BATTJES and D. A. BUTHALA, 1987 Proceedings of the 45th Annual Meeting of the Electron Microscopy Society of America, p. 956.

ADAMS, M. D., S. E. CELNIKER, R. A. HOLT, C. A. EVANS, and J. D. GOCAYNE et al., 2000  The genome sequence of Drosophila melanogaster. Science 287:2185-2195[Abstract/Free Full Text].

ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Plainview, NY.

BAKER, G. T., M. JACOBSEN and G. MOKRYNSKI, 1989 Aging in Drosophila, pp. 511–578 in Handbook of Cell Biology of Aging, edited by V. CRISTOFALO. CRC Press, Boca Raton, FL.

BELLEN, H. J., C. J. O'KANE, C. WILSON, U. GROSSNIKLAUS, and R. K. PEARSON et al., 1989  P-element-mediated enhancer detection: a versatile method to study development in Drosophila.. Genes Dev. 3:1288-1300[Abstract/Free Full Text].

BELLO, B., D. RESENDEZ-PEREZ, and W. J. GEHRING, 1998  Spatial and temporal targeting of gene expression in Drosophila by means of a tetracycline-dependent transactivator system. Development 125:2193-2202[Abstract].

BIESCHKE, E. T., J. C. WHEELER, and J. TOWER, 1998  Doxycycline-induced transgene expression during Drosophila development and aging. Mol. Gen. Genet. 258:571-579[Medline].

BRAND, A. H. and N. PERRIMON, 1993  Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118:401-415[Abstract].

CHUI, D., G. SELLAKUMAR, R. S. GREEN, M. SUTTON-SMITH, and T. MCQUISTAN et al., 2001  Genetic remodeling of protein glycosylation in vivo induces autoimmune disease. Proc. Natl. Acad. Sci. USA 98:1142-1147[Abstract/Free Full Text].

COOLEY, L., R. KELLY, and A. SPRADLING, 1988  Insertional mutagenesis of the Drosophila genome with single P elements. Science 239:1121-1128[Abstract/Free Full Text].

FORBES, A. and R. LEHMANN, 1998  nanos and pumilio have critical roles in the development and function of Drosophila germline stem cells. Development 125:679-690[Abstract].

GOSSEN, M. and H. BUJARD, 1992  Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89:5547-5551[Abstract/Free Full Text].

GOSSEN, M., S. FREUNDLIEB, G. BENDER, G. MULLER, and W. HILLEN et al., 1995  Transcriptional activation by tetracyclines in mammalian cells. Science 268:1776-1769.

HAY, B. A., R. MAILE, and G. M. RUBIN, 1997  P element insertion-dependent gene activation in the Drosophila eye. Proc. Natl. Acad. Sci. USA 94:5195-5200[Abstract/Free Full Text].

HUANG, A. M. and G. M. RUBIN, 2000  A misexpression screen identifies genes that can modulate RAS1 pathway signalling in Drosophila melanogaster.. Genetics 156:1219-1230[Abstract/Free Full Text].

LAJEUNESSE, D. and A. SHEARN, 1995  Trans-regulation of thoracic homeotic selector genes of the Antennapedia and bithorax complexes by the trithorax group genes: absent, small, and homeotic discs 1 and 2.. Mech. Dev. 53:123-139[Medline].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.

LUCASOVICH, T., Z. ASZTALOS, W. AWANO, K. BABA, and S. KONDO et al., 2001  Dual-tagging gene trap of novel genes in Drosophila melanogaster.. Genetics 157:727-742[Abstract/Free Full Text].

MATA, J., S. CURADO, A. EPHRUSSI, and P. RORTH, 2000  Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating String/CDC25 proteolysis. Cell 101:511-522[Medline].

O'CONNELL, P. and M. ROSBASH, 1984  Sequence, structure, and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12:5495-5513[Abstract/Free Full Text].

O'KANE, C. J. and W. J. GEHRING, 1987  Detection in situ of genomic regulatory elements in Drosophila.. Proc. Natl. Acad. Sci. USA 84:9123-9127[Abstract/Free Full Text].

PARISI, M. and H. LIN, 1999  The Drosophila pumilio gene encodes two functional protein isoforms that play multiple roles in germline development, gonadogenesis, oogenesis and embryogenesis. Genetics 153:235-250[Abstract/Free Full Text].

PARKES, T. L., A. J. ELIA, D. DICKSON, A. J. HILLIKER, and J. P. PHILLIPS et al., 1998  Extension of Drosophila lifespan by overexpression of human SOD1 in motorneurons. Nat. Genet. 19:171-174[Medline].

PATTON, J. S., X. V. GOMES, and P. K. GEYER, 1992  Position-independent germline transformation in Drosophila using a cuticle pigmentation gene as a selectable marker. Nucleic Acids Res. 20:5859-5860[Free Full Text].

RABOUILLE, C., D. A. KUNTZ, A. LOCKYER, R. WATSON, and T. SIGNORELLI et al., 1999  The Drosophila GMII gene encodes a Golgi -mannosidase II. J. Cell Sci. 112:3319-3330[Abstract].

ROBERTSON, H. M., C. R. PRESTON, R. W. PHILLIPS, D. JOHNSON-SCHLITZ, and W. K. BENZ et al., 1988  A stable genomic source of P element transposase in Drosophila. Genetics 118:461-470[Abstract/Free Full Text].

RORTH, P., 1996  A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc. Natl. Acad. Sci. 93:12418-12422[Abstract/Free Full Text].

RORTH, P., K. SZABO, A. BAILEY, T. LAVERTY, and J. REHM et al., 1998  Systematic gain-of-function genetics in Drosophila.. Development 125:1049-1057[Abstract].

RORTH, P., K. SZABO, and G. TEXIDO, 2000  The level of C/EBP protein is critical for cell migration during Drosophila oogenesis and is controlled by regulated degradation. Mol. Cell 6:23-30[Medline].

RUBIN, G. M. and A. C. SPRADLING, 1982  Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353[Abstract/Free Full Text].

RUBIN, G. M., M. D. YANDELL, J. R. WORTMAN, G. L. GABOR MIKLOS, and C. R. NELSON et al., 2000  Comparative genomics of the eukaryotes. Science 287:2204-2215[Abstract/Free Full Text].

SALZ, H. K., T. W. CLINE, and P. SCHEDL, 1987  Functional changes associated with structural alterations induced by mobilization of a P element inserted in the Sex-lethal gene of Drosophila. Genetics 117:221-231[Abstract/Free Full Text].

SIMON, J. A., C. A. SUTTON, R. B. LOBELL, R. L. GLASER, and J. T. LIS, 1985  Determinants of heat shock-induced chromosome puffing. Cell 40:805-817[Medline].

SPRADLING, A. C., D. M. STERN, I. KISS, J. ROOTE, and T. LAVERTY et al., 1995  Gene disruptions using P transposable elements: an integral component of the Drosophila genome project. Proc. Natl. Acad. Sci. USA 92:10824-10830[Abstract/Free Full Text].

SUN, J. and J. TOWER, 1999  FLP recombinase-mediated induction of Cu/Zn-superoxide dismutase transgene expression can extend the life span of adult Drosophila melanogaster flies. Mol. Cell. Biol. 19:216-228[Abstract/Free Full Text].

THUMMEL, C. S. and V. PIROTTA, 1992  New pCaSpeR P element vectors. Dros. Inf. Serv. 71:150.

TOBA, G., T. OHSAKO, N. MIYATA, T. OHTSUKA, and K.-H. SEONG et al., 1999  The gene search system: a method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151:725-737[Abstract/Free Full Text].

TOWER, J., 2000  Transgenic methods for increasing Drosophila life span. Mech. Ageing Dev. 118:1-14[Medline].

TOWER, J. and R. KURAPATI, 1994  Preferential transposition of a Drosophila P element to the corresponding region of the homologous chromosome. Mol. Gen. Genet. 244:484-490[Medline].

TOWER, J., G. H. KARPEN, N. CRAIG, and A. C. SPRADLING, 1993  Preferential transposition of Drosophila P elements to nearby chromosomal sites. Genetics 113:347-359.

TRIPOULAS, N. D., D. LAJEUNESSE, J. GILDEA, and A. SHEARN, 1996  The Drosophila ash1 gene product, which is localized at specific sites on chromosomes, contains a SET domain and a PHD finger. Genetics 143:913-928[Abstract].

WHARTON, R. P., J. SONODA, T. LEE, M. PATTERSON, and Y. MURATA, 1998  The pumilio RNA-binding domain is also a translational regulator. Mol. Cell 1:863-872[Medline].

WHEELER, J. C., V. KING, and J. TOWER, 1999  Sequence requirements for upregulated expression of Drosophila hsp70 transgenes during aging. Neurobiol. Aging 20:545-553[Medline].

This article has been cited by other articles:

				A. Khokhar, N. Chen, J.-P. Yuan, Y. Li, G. N. Landis, G. Beaulieu, H. Kaur, and J. Tower Conditional Switches for Extracellular Matrix Patterning in Drosophila melanogaster Genetics, March 1, 2008; 178(3): 1283 - 1293. [Abstract] [Full Text] [PDF]

				K. Aoki, M. Perlman, J.-M. Lim, R. Cantu, L. Wells, and M. Tiemeyer Dynamic Developmental Elaboration of N-Linked Glycan Complexity in the Drosophila melanogaster Embryo J. Biol. Chem., March 23, 2007; 282(12): 9127 - 9142. [Abstract] [Full Text] [PDF]

				K. Paschinger, M. Hackl, M. Gutternigg, D. Kretschmer-Lubich, U. Stemmer, V. Jantsch, G. Lochnit, and I. B. H. Wilson A Deletion in the Golgi {alpha}-Mannosidase II Gene of Caenorhabditis elegans Results in Unexpected Non-wild-type N-Glycan Structures J. Biol. Chem., September 22, 2006; 281(38): 28265 - 28277. [Abstract] [Full Text] [PDF]

				R. Leonard, D. Rendic, C. Rabouille, I. B. H. Wilson, T. Preat, and F. Altmann The Drosophila fused lobes Gene Encodes an N-Acetylglucosaminidase Involved in N-Glycan Processing J. Biol. Chem., February 24, 2006; 281(8): 4867 - 4875. [Abstract] [Full Text] [PDF]

				D. R. Marenda, C. B. Zraly, Y. Feng, S. Egan, and A. K. Dingwall The Drosophila SNR1 (SNF5/INI1) Subunit Directs Essential Developmental Functions of the Brahma Chromatin Remodeling Complex Mol. Cell. Biol., January 1, 2003; 23(1): 289 - 305. [Abstract] [Full Text]