Interaction of the Repressors Nrg1 and Nrg2 With the Snf1 Protein Kinase in Saccharomyces cerevisiae

Corresponding author: Marian Carlson, Columbia University, 701 W. 168th St., HSC922, New York, NY 10032., mbc1{at}columbia.edu (E-mail)

Communicating editor: F. WINSTON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The Snf1 protein kinase is essential for the transcription of glucose-repressed genes in Saccharomyces cerevisiae. We identified Nrg2 as a protein that interacts with Snf1 in the two-hybrid system. Nrg2 is a C₂H₂ zinc-finger protein that is homologous to Nrg1, a repressor of the glucose- and Snf1-regulated STA1 (glucoamylase) gene. Snf1 also interacts with Nrg1 in the two-hybrid system and co-immunoprecipitates with both Nrg1 and Nrg2 from cell extracts. A LexA fusion to Nrg2 represses transcription from a promoter containing LexA binding sites, indicating that Nrg2 also functions as a repressor. An Nrg1 fusion to green fluorescent protein is localized to the nucleus, and this localization is not regulated by carbon source. Finally, we show that VP16 fusions to Nrg1 and Nrg2 allow low-level expression of SUC2 in glucose-grown cells, and we present evidence that Nrg1 and Nrg2 contribute to glucose repression of the DOG2 gene. These results suggest that Nrg1 and Nrg2 are direct or indirect targets of the Snf1 kinase and function in glucose repression of a subset of Snf1-regulated genes.

THE Snf1 protein kinase is highly conserved from yeast to plants to mammals (for reviews, see GANCEDO 1998 ; HARDIE et al. 1998 ). In Saccharomyces cerevisiae, Snf1 is a key component of the glucose signaling pathway and is essential for the transcription of many glucose-repressed genes in response to glucose limitation (CELENZA and CARLSON 1986 ). This kinase also has roles in metabolic regulation, glycogen accumulation, stress responses, meiosis and sporulation, invasive growth, life span, and aging (THOMPSON-JAEGER et al. 1991 ; HARDY et al. 1994 ; HONIGBERG and LEE 1998 ; ASHRAFI et al. 2000 ; CULLEN and SPRAGUE 2000 ). Its mammalian homolog, AMP-activated protein kinase, regulates metabolism and transcription in response to the cellular energy supply, and the plant homologs are thought to be involved in sugar regulation.

The role of the Snf1 kinase in transcriptional control has been characterized in some detail. The adaptation of yeast cells to growth on nonpreferred carbon sources is accompanied by major changes in transcriptional patterns, and Snf1 appears to act at many control points. Thus far, Snf1 has been shown to regulate the expression and function of both transcriptional repressors and activators in response to glucose availability (for review, see CARLSON 1999 ). Recent evidence also implicates Snf1 in direct regulation of the RNA polymerase II holoenzyme (KUCHIN et al. 2000 ).

One of the major mechanisms by which Snf1 regulates transcription is by regulating the function of the transcriptional repressor Mig1. Mig1 is a zinc-finger protein that binds to sites in the promoters of many glucose-repressed genes and recruits the global corepressor Ssn6(Cyc8)-Tup1 (NEHLIN and RONNE 1990 ; TREITEL and CARLSON 1995 ; TZAMARIAS and STRUHL 1995 ). Several lines of evidence indicate that Snf1 phosphorylates Mig1 in response to glucose limitation and thereby regulates its nuclear localization and inhibits its repressor function (DEVIT et al. 1997 ; OSTLING and RONNE 1998 ; TREITEL et al. 1998 ).

Snf1 also effects transcriptional control by regulating transcriptional activators. Snf1 regulates the phosphorylation and function of the Cys₆ zinc-cluster activators Sip4 and Cat8, which bind to the carbon source-responsive elements (CSRE) of gluconeogenic genes (LESAGE et al. 1996 ; RAHNER et al. 1996 , RAHNER et al. 1999 ; RANDEZ-GIL et al. 1997 ; VINCENT and CARLSON 1998 ; RAHNER et al. 1999 ). Snf1 has been shown to interact physically with Sip4 (LESAGE et al. 1996 ; VINCENT and CARLSON 1998 ).

The two-hybrid system has been useful in detecting interactions of Snf1 with transcriptional activators and repressors. Sip4 was first identified by its two-hybrid interaction with Snf1 (YANG et al. 1992 ). Mig1 also interacts with Snf1 in two-hybrid assays (TREITEL et al. 1998 ), and in this case interaction was much stronger with a catalytically defective mutant Snf1 protein, Snf1K84R (CELENZA and CARLSON 1986 ), which bears a substitution of arginine for the conserved lysine in the ATP-binding site. Several Srb/mediator proteins associated with the RNA polymerase II holoenzyme have also been shown to interact with Snf1 (KUCHIN et al. 2000 ).

In an effort to identify new downstream targets of the Snf1 kinase, we performed a two-hybrid screen with the catalytically defective Snf1K84R. We recovered Nrg2, a zinc-finger protein that is a close homolog of the DNA-binding repressor protein Nrg1. Nrg1 functions in glucose repression of the STA1 gene, which encodes one of the glucoamylase isozymes responsible for starch degradation in S. cerevisiae var. diastaticus (PARK et al. 1999 ). Furthermore, the Snf1 kinase is known to be required for derepression of STA2 (KUCHIN et al. 1993 ), which is identical to STA1 throughout the promoter and coding region. We therefore examined the relationship of Nrg1 and Nrg2 to the Snf1 kinase. Both proteins interact with Snf1 in the two-hybrid system and both co-immunoprecipitate with Snf1 from cell extracts. We present evidence that Nrg2 functions as a repressor and that the nuclear localization of Nrg1, unlike that of Mig1, is not regulated by carbon source. Finally, we examine the roles of Nrg1 and Nrg2 in repression of Snf1-dependent genes.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and genetic methods:
The S. cerevisiae strains used are listed in Table 1. To construct strain MCY4531, we first generated a 2.5-kb DNA fragment using the polymerase chain reaction (PCR) with the template pFA6a-GFP(S65T)-kanMX6 (LONGTINE et al. 1998 ) and two primers, one including the 15 codons preceding the termination codon of NRG1 and the other including 45 base pairs following the stop codon. This fragment was used to transform strain MCY2916, with selection on rich medium containing 200 µg/ml G418 (Life Technologies, Gaithersburg, MD), and its integration at the NRG1 locus was verified by PCR. Strain MCY4536 was created in the same way, except that the targeting sequence was for NRG2. To construct the nrg1::kanMX6, nrg2::kanMX6, and nrg2::His3MX6 mutations, we first amplified kanMX6 or His3MX6 (LONGTINE et al. 1998 ) with oligonucleotides containing 45 nucleotides flanking the open reading frame of NRG1 or NRG2. PCR products were used to transform MCY3912 or MCY3913 with selection for the marker, and disruption was verfied by PCR amplification of genomic DNA.

Standard methods for yeast genetic analysis and transformation were used (ROSE et al. 1990 ). Cells were grown in synthetic complete (SC) medium lacking appropriate supplements to maintain selection for plasmids.

Plasmids:
Plasmids used in this study are listed in Table 2. pRJ215 contains the BamHI fragment from pRJ80 (LUDIN et al. 1998 ) in the BamHI site of pEG202 (GOLEMIS et al. 1997 ). pSK106 was created by cloning the BamHI fragment from pRJ215 into the BamHI site of pGBT-9 (BARTEL et al. 1993 ). The coding regions of NRG1 and NRG2 were amplified by PCR from genomic DNA using Vent polymerase (New England Biolabs, Beverly, MA) with oligonucleotides K47 and K48 (Nrg2) and K49 and K50 (Nrg1), each containing a BamHI site. BamHI-digested PCR product was cloned into the BamHI site of plasmids pACTII (LEGRAIN et al. 1994 ), pVP16 (VOJTEK et al. 1993 ), pWS93 (SONG and CARLSON 1998 ), pSH2-1 (HANES and BRENT 1989 ), and pEG202.

Oligonucleotides:
Oligonucleotides used as primers in PCR were the following: K47, GCGCGGATCCTAATGTCCATAGGTTACAAAGAC; K48, GCGCGGATCCTCAACTGCTAGCCTCCCTCC; K49, GCGCGGATCCTAATGTTTTACCCATATAACTATAG; K50, GCGCGGATCCGTCAATTATTGTCCCTTTTTC (BamHI sites are underlined).

Two-hybrid screen:
A two-hybrid screen (FIELDS and SONG 1989 ) for proteins that interact with a Gal4 DNA-binding domain (GBD) fusion to Snf1K84R was carried out in strain HF7C, which contains a chromosomally located GAL1-HIS3 reporter. The strain was transformed with pSK106, which expresses GBD-Snf1K84R, and with a library (gift of S. Elledge, Baylor College of Medicine) of S. cerevisiae cDNAs fused to the Gal4 activating domain (GAD). Transformants were selected on SC-His + 2% glucose plates for a His⁺ phenotype. Five plasmids conferred a His⁺ phenotype and gave blue color in CTY10-5d and were subjected to sequence analysis. Besides NRG2, the recovered sequences were SNF4, GPM1, POR1, and TDH1. The others were not analyzed further.

Two-hybrid assays with LexA fusion proteins were carried out in strain CTY10-5d or in strain FY250 transformed with the pSH18-34 reporter, containing LexA binding sites 5' to a GAL1-lacZ reporter (ESTOJAK et al. 1995 ; GOLEMIS et al. 1997 ).

Invertase and ß-galactosidase assays:
Invertase activity was assayed in whole cells as previously described (JIANG and CARLSON 1996 ). ß-Galactosidase activity was assayed in permeabilized cells (GUARENTE 1983 ) and expressed in Miller units (MILLER 1972 ). A filter assay in which ß-galactosidase activity confers blue color was also used as previously described (JIANG and CARLSON 1996 ).

Co-immunoprecipitation assays:
Preparation of protein extracts and immunoprecipitation procedures were essentially as described previously (CELENZA et al. 1989 ). The extraction buffer was 50 mM HEPES (pH 7.5), 150 mM NaCl, 0.5% Triton X-100, 1 mM dithiothreitol, 10% glycerol, and contained 2 mM phenylmethylsulfonyl fluoride and complete protease inhibitor cocktail (Roche Molecular Biochemical). Proteins were immunoprecipitated with anti()-hemagglutinin (HA) monoclonal antibody (Roche Molecular Biochemical) or -LexA monoclonal antibody (CLONTECH, Palo Alto, CA) in the same buffer, except that it contained 0.25% Triton X-100 for immunoprecipitation with -HA and 50 mM NaCl and 0.1% Triton X-100 for immunoprecipitation with -LexA.

Immunoblot analysis:
Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by immunoblotting using polyclonal -Snf1 (CELENZA and CARLSON 1986 ), monoclonal -HA (Roche Molecular Biochemical), or polyclonal -LexA (Invitrogen, San Diego). Antibodies were detected by chemiluminescence with ECL or ECL Plus reagents (Amersham, Arlington Heights, IL).

Imaging of green flourescent protein fluorescence:
Cells were grown to midlog phase in synthetic media containing 5% glucose or 2% glycerol plus 2% ethanol, harvested by centrifugation, and resuspended in nonfluorescent media [0.9 g/liter KH₂PO₄, 0.23 g/liter K₂HPO₄, 0.5 g/liter MgSO₄, 3.5 g/liter (NH₄)₂SO₄] containing the appropriate carbon source. Nuclei were stained by addition of 0.8 µg/ml of 4',6-diamidino-2-phenylindole (DAPI) for 5 min. Fluorescence of green fluorescent protein (GFP) fusion proteins was visualized in unfixed cells by using a Nikon Eclipse E800 fluorescent microscope. Images were captured by using a digital camera (Hamamatsu Orca-100, Hamamatsu, Japan) and Openlab software (Improvision) and were converted to Adobe Photoshop 2.5.1 files for processing.

Microarray analysis:
Strain MCY3912 carrying pV46 or pVP16 was grown in SC-Leu + 5% glucose. Total yeast RNA was extracted with hot phenol, and poly(A)⁺ RNA was purified by oligo(dT) chromatography (QIAGEN, Chatsworth, CA). Fluorescently labeled cDNA was prepared, and expression of 5805 yeast open reading frames (ORFs) was analyzed using DNA microarrays as described (DERISI et al. 1997 ). Microarrays were produced by the Columbia University Microarray Project.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Identification of Nrg2 in a two-hybrid screen for interaction with Snf1:
We carried out a two-hybrid screen for proteins that interact with the catalytically defective Snf1 protein kinase, Snf1K84R. GBD-Snf1K84R was used as a bait to screen a library of cDNAs fused to GAD. We recovered six clones that were His⁺ in combination with GBD-Snf1K84R (see MATERIALS AND METHODS). Five clones also caused blue color in combination with both LexA-Snf1K84R and LexA-Snf1 in strain CTY10-5d.

Sequence analysis showed that one of these clones (pKRIP6) encodes an in-frame fusion of GAD at a position five nucleotides preceding codon 1 of the NRG2 gene (YBR066C). NRG2 encodes a protein of 220 amino acids with a predicted molecular mass of 25 kD and two zinc fingers at the C terminus. The zinc fingers are homologous to those of the transcriptional activators Msn2 and Msn4, which bind stress response elements (MARTINEZ-PASTOR et al. 1996 ), and to those of the repressors Mig1 and Mig2. However, the closest homolog to Nrg2 is Nrg1, which is 44% similar overall and 84% identical in the zinc-finger region (Fig 1).

View larger version (39K): In this window In a new window Download PPT slide   Figure 1. Alignment of Nrg1 and Nrg2. Protein sequences are indicated in single letter code, and numbers indicate amino acid residues. Solid boxes indicate identities, shaded boxes indicate similarities, and dashes indicate gaps in the alignment. Alignment was done using the programs MSA (GUPTA et al. 1995 ; KECECIOGLU et al. 1995 ; LIPMAN et al. 1989 ) and Boxshade (K. HOFMANN and M. D. BARON, unpublished results); both are part of the Biology Workbench v3.2 package (http://workbench.sdsc.edu). Cysteines and histidines of the predicted C2H2 zinc fingers are marked with asterisks (BOHM et al. 1997 ).

NRG1 was identified as a multicopy inhibitor of the glucose-repressible STA1 promoter in S. cerevisiae var. diastaticus (PARK et al. 1999 ). In the selection scheme, the STA1 promoter was used to drive expression of TPK2, encoding a catalytic subunit of cyclic AMP-dependent protein kinase, which is toxic to cells at high levels. Multicopy NRG1 restored healthy growth and repressed glucoamylase expression. Nrg1 bound to sites in the STA1 upstream region, and a LexA fusion to Nrg1 repressed transcription of a reporter with LexA sites, dependent on the corepressor Ssn6-Tup1 (PARK et al. 1999 ). Mutation of NRG1 relieved glucose repression of STA1. Release from glucose repression of glucoamylase genes requires the Snf1 protein kinase (KUCHIN et al. 1993 ), and thus these studies suggest a functional connection between Nrg1 and Snf1. We therefore included Nrg1 in subsequent experiments to assess its interaction with Snf1.

The Snf1 kinase comprises a catalytic domain (residues 1–392, designated Snf1KD) and a regulatory domain (residues 392–633, designated Snf1RD), which binds to the kinase domain and inhibits its activity (JIANG and CARLSON 1996 ). We assayed the two-hybrid interaction of GAD-Nrg1 and GAD-Nrg2 with LexA DNA-binding domain (LexA₈₇) fusions to Snf1KD and Snf1RD. Interaction was monitored by assaying ß-galactosidase activity in cells grown under glucose-repressing conditions (5% glucose) and after a 3-hr shift to 0.05% glucose. Both GAD-Nrg1 and GAD-Nrg2 interacted with LexA₈₇-Snf1KD but not with LexA₈₇-Snf1RD (Table 3).

Co-immunoprecipitation of the Snf1 kinase with Nrg1 and Nrg2:
To confirm that Snf1 interacts with Nrg1 and Nrg2, we tested for co-immunoprecipitation of the kinase with triple HA epitope-tagged proteins. Protein extracts were prepared from snf1 cells expressing HA-Nrg1 or HA-Nrg2 and Snf1, Snf1K84R, or no Snf1 protein. Immunoblot analysis showed that levels of both HA-Nrg1 and HA-Nrg2 were severely reduced in cells expressing no Snf1 protein, but levels were normal in cells expressing Snf1K84R and thus defective only for Snf1 catalytic activity (Fig 2A; input panel); these results are consistent with physical interactions in vivo. Proteins were immunoprecipitated with -HA antibodies, and the precipitates were analyzed by SDS-PAGE and immunoblot analysis with -Snf1 antibodies. Snf1 and Snf1K84R co-immunoprecipitated with both HA-Nrg1 and HA-Nrg2, but coprecipitation with HA-Nrg2 was more efficient (Fig 2A; CoIP panel). In control experiments, Snf1 did not coprecipitate with the triple HA tag expressed from the vector.

View larger version (44K): In this window In a new window Download PPT slide   Figure 2. Co-immunoprecipitation of Snf1 with Nrg1 and Nrg2. (A) Strain MCY2916 (snf1) was transformed with a plasmid expressing HA-Nrg1 or HA-Nrg2 or the parent vector pWS93 expressing the triple HA epitope and also with a plasmid expressing Snf1 or Snf1K84R or the vector pSK37 (see Table 2). Cells were grown in selective medium containing 5% glucose. Protein extracts (50 µg) were immunoprecipitated (IP) with -HA antibodies. Input extracts (10 µg) and precipitates were resolved by 12% SDS-PAGE, blotted, and immunodetected with -Snf1. The filter was stripped and reprobed with -HA to detect the HA fusion protein. (B) Strain MCY3647 was transformed with plasmids expressing either LexA, LexA-Snf1, or LexA-Snf1K84R and HA-Nrg1, HA-Nrg2, or HA alone. Cells were grown in selective medium containing 2% glucose. Protein extracts (50 µg) were immunoprecipitated with monoclonal -LexA antibodies. Precipitates and input extracts (10 µg) were resolved by 12% SDS-PAGE, blotted, and immunodetected with -HA. The filter was then stripped and reprobed with polyclonal -LexA.

We also tested for co-immunoprecipitation of HA-Nrg1 and HA-Nrg2 with LexA-Snf1 (Fig 2B). Extracts were prepared from wild-type cells expressing LexA-Snf1 or LexA-Snf1K84R and HA-Nrg1 or HA-Nrg2, and LexA proteins were immunoprecipitated with -LexA antibodies. Immunoblot analysis with -HA antibody showed that HA-Nrg1 and HA-Nrg2 co-immunoprecipitated with both LexA-Snf1 and LexA-Snf1K84R, but not with LexA alone. Again, HA-Nrg1 was less efficiently recovered than HA-Nrg2.

To examine the possibility that Snf1 phosphorylates Nrg1 or Nrg2, we performed kinase assays with both of the above sets of immunoprecipitates. No Snf1-dependent phosphorylation of Nrg1 or Nrg2 was detected (data not shown). In addition, we examined HA-Nrg1 and HA-Nrg2 for phosphorylation in vivo by immunoblot analysis. No Snf1-dependent differences in the mobility of either protein were detected when wild-type and snf1 mutant cells were grown in 5% glucose or shifted to 0.05% glucose or shifted to 2% glycerol plus 2% ethanol (data not shown). Subsequent analysis of LexA fusion proteins also revealed no Snf1-dependent differences in mobility (Fig 3C).

View larger version (30K): In this window In a new window Download PPT slide   Figure 3. Transcriptional repression by LexA87-Nrg1 and LexA87-Nrg2. (A) Reporter plasmids. pLG312 contains the lacZ gene under the control of the CYC1 promoter and UAS (GUARENTE and HOAR 1984 ). JK1621 is derived from pLG312 and contains four lexA operators (op) 5' to the UAS (KELEHER et al. 1992 ). (B) Repression of reporter gene expression by the indicated LexA protein in wild-type strain MCY829. Transformants were grown selectively to midlogarithmic phase in 5% glucose (Glu) or in 2% glycerol plus 2% ethanol (G/E). ß-Galactosidase activity was assayed in permeabilized cells and expressed in Miller units. Values represent the mean of five transformants and have a standard error of <15%. (C) Wild-type (WT) strain MCY829 (lanes a–d) and the snf1-K84R mutant MCY2693 (lanes e–g) were transformed with JK1621 and a plasmid expressing either LexA87-Nrg1 (top) or LexA87-Nrg2 (bottom). Transformants were grown in Glu or G/E, as above, or shifted from Glu to G/E for 3 or 6 hr, as indicated. Protein extracts were prepared by a rapid boiling method (VINCENT and CARLSON 1999 ), resolved by 10% SDS-PAGE, and immunoblotted with polyclonal -LexA. For each LexA protein, all lanes shown are from the same exposure of the same immunoblot. No degradation products were detected. Analysis of a second set of transformants gave the same results.

Repressor function of Nrg1 and Nrg2:
Previous studies showed that LexA₈₇-Nrg1 represses expression of a reporter with LexA binding sites in glucose-grown cells (PARK et al. 1999 ). We therefore tested the ability of LexA₈₇-Nrg2 to function as a repressor in this assay. Wild-type strain MCY829 was transformed with plasmids expressing LexA₈₇-Nrg1, LexA₈₇-Nrg2, or LexA₈₇ alone from the ADH1 promoter, and a CYC1-lacZ reporter with either four or zero LexA binding sites 5' to the upstream activation sites (UAS; Fig 3A). Reporter gene expression was monitored by assaying ß-galactosidase activity. LexA₈₇-Nrg1 and LexA₈₇-Nrg2 both repressed transcription about 15-fold in cells grown in 5% glucose (Fig 3B).

We then examined the regulation of transcriptional repression by carbon source. Repression by both LexA₈₇-Nrg1 and LexA₈₇-Nrg2 was maintained after a shift to low glucose (0.05%) or during steady-state growth in raffinose, sucrose, or galactose (data not shown). In accord with these findings, the STA genes are not derepressed under these growth conditions, but only during growth in glycerol plus ethanol (PRETORIUS et al. 1986 ; KARTASHEVA et al. 1996 ). No repression of the reporter was observed when cells were grown in 2% glycerol plus 2% ethanol (Fig 3B); however, immunoblot analysis showed that levels of both fusion proteins were very low when cells were grown in glycerol plus ethanol (Fig 3C), which could account for the lack of repression. The low protein levels can probably be attributed to reduced expression from the ADH1 promoter because levels of ADH1 mRNA are 6- to 10-fold lower during growth on ethanol than on glucose (DENIS et al. 1983 ). Moreover, the levels of HA-Nrg1, HA-Nrg2, and LexA₈₇-Sip4, when expressed from this vector, were also very low in glycerol/ethanol-grown cells (data not shown). These data exclude effects specific to the LexA₈₇ tag, and Sip4 is unlikely to be specifically degraded under these conditions as it functions in the activation of gluconeogenic genes. PARK et al. 1999 reported that LexA₈₇-Nrg1 does not repress in cells grown in glycerol plus ethanol, but it is likely that the protein was not present because their expression vector was identical to ours.

We attempted to obtain evidence for a role of Snf1 in inhibiting repressor function by examining release from repression in wild-type and snf1 mutant cells after a shift from glucose to glycerol plus ethanol. Unfortunately, in wild-type cells the release occurred too slowly. Cells expressing LexA₈₇-Nrg1 or LexA₈₇-Nrg2 and containing a reporter with LexA sites only doubled their ß-galactosidase activity during a 3-hr shift (repression ratios decreased to 7; data not shown), and protein levels were already lower by 3 hr (Fig 3C). In snf1-K84R mutant cells, LexA₈₇-Nrg1 and LexA₈₇-Nrg2 repressed transcription 15-fold during growth on glucose, and repression was not relieved during the 3-hr shift (repression ratios of 20; data not shown); however, protein levels remained high in the mutant cells (Fig 3C).

Nuclear localization of Nrg1:
One of the mechanisms by which the Snf1 kinase regulates the function of the Mig1 repressor in response to the glucose signal is by regulating its nuclear localization (DEVIT et al. 1997 ; DEVIT and JOHNSTON 1999 ). To address the possibility that the localization of Nrg1 or Nrg2 is similarly regulated, we constructed strains expressing Nrg1 or Nrg2 fused to GFP from the cognate chromosomal promoters. We did not detect significant fluorescence from Nrg2-GFP. Nrg1-GFP was localized in the nucleus when cells were grown in glucose, consistent with its function as a repressor, but also remained in the nucleus when cells were grown in glycerol plus ethanol (Fig 4). Similarly, no export of Nrg1-GFP was observed when cells were shifted from glucose to glycerol for 15 min (data not shown). Immunoblot analysis confirmed that Nrg1-GFP is a stable protein (data not shown). These findings suggest that the ability of Nrg1 to function as a repressor is not regulated by differential subcellular localization.

View larger version (56K): In this window In a new window Download PPT slide   Figure 4. Nuclear localization of Nrg1-GFP. Strain MCY4531 was transformed with plasmid pSK117 to provide Snf1 function, and cells were grown in selective synthetic medium containing 5% glucose or 2% glycerol plus 2% ethanol and stained with DAPI. GFP and DAPI fluorescence were visualized as described in MATERIALS AND METHODS.

Nrg1 and Nrg2 fused to the VP16 activation domain activate low-level SUC2 expression in glucose:
The repressor Mig1 has broad roles in glucose repression of many genes, whereas thus far, Nrg1 is known to affect only the glucoamylase genes. NRG1 and NRG2 have not been identified genetically in searches for regulators of other glucose-repressed genes; however, it is possible that their contributions to repression are modest. To test the possibility that Nrg1 and Nrg2 regulate SUC2, another glucose-repressed gene that is controlled by the Snf1 pathway, we fused the viral VP16 activation domain to both Nrg proteins. Our rationale was that the overexpressed VP16-Nrg fusion protein would compete with the native protein for binding to its sites. Similar fusions of VP16 to the repressor Mig1 activate expression of SUC2 in glucose-grown cells (OSTLING et al. 1996 ).

We first used a SUC2::HIS3 reporter that exhibits glucose-repressible expression of HIS3 (TU and CARLSON 1994 ). Transformants of strain MCY3912 (his3) bearing SUC2::HIS3 and expressing VP16-Nrg1 or VP16-Nrg2 were His⁺ on medium containing 2% glucose, whereas transformants expressing VP16 alone were His^- (Fig 5A). All transformants were His⁺ on medium containing 2% sucrose. We also assayed expression of invertase activity from the chromosomal SUC2 locus in cells grown in 5% glucose. VP16-Nrg1 and VP16-Nrg2 both activated SUC2 expression about 10-fold relative to VP16 alone (Fig 5B). However, invertase activity was still about 30-fold lower than the levels typically detected in derepressed wild-type cells. Although it is possible that overexpression of the fusion proteins leads to aberrant binding, these data suggest that the native Nrg1 and Nrg2 proteins have some role in glucose repression of SUC2, which may involve either direct binding to the SUC2 promoter or an indirect mechanism. Consistent with these results, an independent study has demonstrated that an nrg1 mutation causes defects in glucose repression of transcription of the SUC2, GAL1, and GAL10 genes (ZHOU and WINSTON 2001 ).

View larger version (54K): In this window In a new window Download PPT slide   Figure 5. VP16-Nrg1 and VP16-Nrg2 relieve glucose repression of the SUC2 promoter. (A) Strain MCY3912 (his3) was transformed with the CEN-TRP1 plasmid pYSH bearing the SUC2::HIS3 reporter (TU and CARLSON 1994 ) and plasmids expressing VP16, VP16-Nrg1, or VP16-Nrg2 (see Table 2). Serial sevenfold dilutions of cell suspensions were spotted on SC-Trp-Leu or SC-Trp-Leu-His containing 4% glucose or 2% sucrose, as indicated. The plates were photographed after 4 days at 30°. (B) Expression of the native SUC2 gene was monitored by invertase assays of strain MCY3912 transformed with the same expression plasmids. Values represent the mean for five transformants, with a standard error of <15%.

Mutations in NRG1 and NRG2 affect glucose repression of the DOG2 gene:
To identify other Snf1-dependent genes that are targets of repression, we used DNA microarray analysis to identify genes that are upregulated in glucose-grown cells expressing VP16-Nrg1, as compared to cells expressing VP16 alone (data not shown; see MATERIALS AND METHODS). Among the genes that were upregulated, we identified one gene, DOG2, that is known to be regulated by glucose repression and by Snf1 (RANDEZ-GIL et al. 1995 ; LUTFIYYA et al. 1998 ; TSUJIMOTO et al. 2000 ). DOG2 encodes 2-deoxyglucose-6-phosphate phosphatase and confers resistance to 2-deoxyglucose toxicity. DOG2 is regulated by the repressors Mig1 and Mig2 in response to glucose and also by the stress response factors Msn2 and Msn4.

To explore the regulation of DOG2 by Nrg1 and Nrg2, we constructed nrg1 and nrg2 single and double mutants (see MATERIALS AND METHODS) and introduced a plasmid bearing a DOG2 promoter fusion to lacZ, pBM3501 (LUTFIYYA et al. 1998 ). When transformants were grown in 2% glucose, the mutants showed a two- to threefold elevation in ß-galactosidase activity (2.1–3.3 units) relative to wild type (1.1 units); values are averages for 5–15 transformants. Although the defect in glucose repression is small, Nrg1 and Nrg2 are predicted to have only a modest role. Mig1 and Mig2 are largely responsible for glucose repression of DOG2-lacZ, and the residual repression in a mig1 mig2 double mutant is only twofold (LUTFIYYA et al. 1998 ). The nrg1 and nrg2 mutations did not affect derepression as all strains produced similar activity (15–20 units) after a shift to 0.05% glucose for 3 hr.

Previous studies showed that derepression of DOG2 in response to glucose limitation requires the Snf1 kinase (TSUJIMOTO et al. 2000 ). To examine the relationship of Snf1 to Nrg1 and Nrg2, we assayed derepression of DOG2-lacZ in strains mutant for snf1 in combination with nrg1 or nrg2 or both. Transformants were grown in 2% glucose, shifted to 0.05% glucose for 3 hr, and assayed for ß-galactosidase activity. Both nrg1 and nrg2 partially suppressed the snf1 mutant defect (Fig 6). Again the effect is small, but only partial suppression would be expected because repression by Mig1 is not relieved in a snf1 mutant (DEVIT et al. 1997 ; OSTLING and RONNE 1998 ; TREITEL et al. 1998 ). These findings suggest that one of the roles of Snf1 in regulating the DOG2 promoter is to inhibit repression by Nrg1 and Nrg2.

View larger version (38K): In this window In a new window Download PPT slide   Figure 6. Suppression of the snf1 mutant defect in derepression of DOG2-lacZ by nrg1 and nrg2 mutations. Strains were MCY4529, MCY4516, MCY4527, and MCY4548 transformed with the DOG2-lacZ reporter plasmid pBM3501 (LUTFIYYA et al. 1998 ). Cultures were grown to midlog phase in SC-Ura + 2% glucose and then shifted to SC-Ura + 0.05% glucose for 3 hr. ß-Galactosidase was assayed in permeabilized cells, and values are averages for 10–15 transformants.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

We have identified Nrg2 in a two-hybrid screen for proteins that interact with the Snf1 protein kinase. Nrg2 was of particular interest because its close homolog, Nrg1, functions in glucose repression of the STA1 gene, and release from repression depends on Snf1. We here present evidence that both Nrg1 and Nrg2 interact physically with the Snf1 kinase. Both proteins interact with the catalytic domain of Snf1 in two-hybrid assays and co-immunoprecipitate with Snf1 from cell extracts.

We show that Nrg2, like Nrg1, functions as a transcriptional repressor. LexA₈₇-Nrg2 represses transcription of a reporter containing LexA binding sites in glucose-grown cells, as previously reported for LexA₈₇-Nrg1 (PARK et al. 1999 ). We also examined the regulation of this repression and found that repression was not relieved by a shift from high to low (0.05%) glucose or by steady-state growth in sucrose, raffinose, or galactose. Correspondingly, glucoamylase gene expression is not derepressed by growth in these carbon sources (PRETORIUS et al. 1986 ; KARTASHEVA et al. 1996 ). An attempt to assess repression during growth in glycerol plus ethanol, a condition allowing derepression of glucoamylase genes, was inconclusive because the fusion proteins were not expressed well.

The finding that release from repression of STA genes occurs only when the carbon source is glycerol/ethanol is at first glance puzzling because the Snf1 kinase is also active during growth on sucrose, raffinose, and galactose. A plausible explanation comes from recent evidence that the Snf1 catalytic subunit and one of the ß-subunits of the kinase, Gal83, are enriched in the nucleus when cells are grown on glycerol/ethanol but not when cells are grown on a fermentable carbon source (VINCENT et al. 2001 ). The nuclear localization of Nrg1-GFP is consistent with the idea that nuclear import of Snf1 is required for inhibition of Nrg1 repressor function.

Together, the evidence suggests that Nrg1 and Nrg2 are either direct or indirect targets of Snf1. Previous studies showed that Nrg1 mediates glucose repression of glucoamylase genes (PARK et al. 1999 ) and that Snf1 is required for release from repression (KUCHIN et al. 1993 ). Here we present genetic evidence that Nrg1 and Nrg2 contribute modestly to glucose repression of DOG2 and that one of the roles of the Snf1 kinase in derepression of this gene is to inhibit repression by Nrg1 and Nrg2. We further show that Nrg1 and Nrg2 interact physically with the Snf1 kinase. Although we did not detect Snf1-dependent phosphorylation of Nrg1 or Nrg2, our data do not exclude the possibility that Snf1 phosphorylates these proteins in vivo. Alternatively, other as yet unidentified components may be involved in the regulatory mechanism; for example, Snf1 may phosphorylate another protein that is bound to and affects the function of Nrg1 and Nrg2.

Repression by Nrg1 and Nrg2 may be regulated at multiple steps. However, regulation of Nrg1 function does not appear to involve nuclear export; Nrg1-GFP was localized to the nucleus whether cells were grown in glucose or glycerol plus ethanol. Some control may be exerted at the RNA level. PARK et al. 1999 found that NRG1 RNA levels are 6-fold lower in glycerol/ethanol than in glucose, but it has also been reported that NRG1 RNA is induced 2.7-fold during the diauxic shift (DERISI et al. 1997 ). NRG2 RNA is neither significantly induced nor repressed during the diauxic shift (DERISI et al. 1997 ).

The targets and physiological roles of Nrg1 and Nrg2 are still largely unknown, and it is possible that the repressor function of Nrg1 or Nrg2 is regulated in response to other signals besides carbon source. Expression of the NRG2 gene is clearly regulated by other signals. DNA microarray analysis of genomic expression patterns showed that NRG2 RNA levels are elevated fivefold in response to zinc limitation, and NRG2 has a potential binding site for the zinc-responsive transcription factor Zap1 (LYONS et al. 2000 ). NRG2 RNA is also induced by alkaline pH, and induction is partially dependent on the transcription factor Rim101, which is required for expression of various alkaline response genes (LAMB et al. 2001 ). The physiological significance of these findings remains to be clarified.

	ACKNOWLEDGMENTS

We thank Robert Townley and Olivier Vincent for help with localization studies, Tony Ferrante for assistance with microarray analysis, and Rong Jiang and Mark Johnston for plasmids. The Columbia University Microarray Project is supported by the Columbia Genome and Naomi Berrie Diabetes Centers. This work was supported by grant GM34095 from the National Institutes of Health (NIH) to M.C. V.K.V. also received support from NIH training grant T32GM08224.

Manuscript received January 19, 2001; Accepted for publication February 26, 2001.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ASHRAFI, K., S. S. LIN, J. K. MANCHESTER, and J. I. GORDON, 2000  Sip2p and its partner Snf1p kinase affect aging in S. cerevisiae.. Genes Dev. 14:1872-1885[Abstract/Free Full Text].

BARTEL, P. L., C.-T. CHIEN, R. STERNGLANZ and S. FIELDS, 1993 Using the Two-Hybrid System to Detect Protein-Protein Interactions. Oxford University Press, Oxford.

BOHM, S., D. FRISHMAN, and H. W. MEWES, 1997  Variations of the C₂H₂ zinc finger motif in the yeast genome and classification of yeast zinc finger proteins. Nucleic Acids Res. 25:2464-2469[Abstract/Free Full Text].

CARLSON, M., 1999  Glucose repression in yeast. Curr. Opin. Microbiol. 2:202-207[Medline].

CELENZA, J. L. and M. CARLSON, 1986  A yeast gene that is essential for release from glucose repression encodes a protein kinase. Science 233:1175-1180[Abstract/Free Full Text].

CELENZA, J. L., F. J. ENG, and M. CARLSON, 1989  Molecular analysis of the SNF4 gene of Saccharomyces cerevisiae: evidence for physical association of the SNF4 protein with the SNF1 protein kinase. Mol. Cell. Biol. 9:5045-5054[Abstract/Free Full Text].

CULLEN, P. J. and G. F. SPRAGUE, JR., 2000  Glucose depletion causes haploid invasive growth in yeast. Proc. Natl. Acad. Sci. USA 97:13619-13624[Abstract/Free Full Text].

DENIS, C. L., J. FERGUSON, and E. T. YOUNG, 1983  mRNA levels for the fermentative alcohol dehydrogenase of Saccharomyces cerevisiae decrease upon growth on a nonfermentable carbon source. J. Biol. Chem. 258:1165-1171[Abstract/Free Full Text].

DERISI, J. L., V. R. IYER, and P. O. BROWN, 1997  Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278:680-686[Abstract/Free Full Text].

DEVIT, M. J. and M. JOHNSTON, 1999  The nuclear exportin Msn5 is required for nuclear export of the Mig1 glucose repressor of Saccharomyces cerevisiae.. Curr. Biol. 9:1231-1241[Medline].

DEVIT, M. J., J. A. WADDLE, and M. JOHNSTON, 1997  Regulated nuclear translocation of the Mig1 glucose repressor. Mol. Biol. Cell 8:1603-1618[Abstract].

ESTOJAK, J., R. BRENT, and E. A. GOLEMIS, 1995  Correlation of two-hybrid affinity data with in vitro measurements. Mol. Cell. Biol. 15:5820-5829[Abstract].

FEILOTTER, H., G. HANNON, C. RUDDELL, and D. BEACH, 1994  Construction of an improved host strain for two hybrid screening. Nucleic Acids Res. 22:1502-1503[Free Full Text].

FIELDS, S. and O. SONG, 1989  A novel genetic system to detect protein-protein interactions. Nature 340:245-246[Medline].

GANCEDO, J. M., 1998  Yeast carbon catabolite repression. Microbiol. Mol. Biol. Rev. 62:334-361[Abstract/Free Full Text].

GOLEMIS, E. A., I. SEREBRIISKII, J. GYURIS and R. BRENT, 1997 Interaction trap/two-hybrid system to identify interacting proteins, pp. 1–40 in Current Protocols in Molecular Biology, Vol. 4, Ch. 20.1, edited by F. M. AUSUBEL, R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN, J. A. SMITH and K. STRUHL. John Wiley & Sons, New York.

GUARENTE, L., 1983  Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101:181-191[Medline].

GUARENTE, L. and E. HOAR, 1984  Upstream activation sites of the CYC1 gene of Saccharomyces cerevisiae are active when inverted but not when placed downstream of the "TATA box.". Proc. Natl. Acad. Sci. USA 81:7860-7864[Abstract/Free Full Text].

GUPTA, S. K., J. D. KECECIOGLU, and A. A. SCHAEFFER, 1995  Improving the practical space and time efficiency of the shortest-paths approach to sum-of-pairs multiple sequence alignment. J. Comput. Biol. 2:459-472[Medline].

HANES, S. D. and R. BRENT, 1989  DNA specificity of the bicoid activator protein is determined by homeodomain recognition helix residue 9. Cell 57:1275-1283[Medline].

HARDIE, D. G., D. CARLING, and M. CARLSON, 1998  The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annu. Rev. Biochem. 67:821-855[Medline].

HARDY, T. A., D. HUANG, and P. J. ROACH, 1994  Interactions between cAMP-dependent and SNF1 protein kinases in the control of glycogen accumulation in Saccharomyces cerevisiae.. J. Biol. Chem. 269:27907-27913[Abstract/Free Full Text].

HONIGBERG, S. M. and R. H. LEE, 1998  Snf1 kinase connects nutritional pathways controlling meiosis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:4548-4555[Abstract/Free Full Text].

JIANG, R. and M. CARLSON, 1996  Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Dev. 10:3105-3115[Abstract/Free Full Text].

KARTASHEVA, N. N., S. V. KUCHIN, and S. V. BENEVOLENSKY, 1996  Genetic aspects of carbon catabolite repression of the STA2 glucoamylase gene in Saccharomyces cerevisiae.. Yeast 12:1297-1300[Medline].

KECECIOGLU, J., S. ALTSCHUL, D. LIPMAN and A. A. MINER, 1995 MSA Program.

KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992  Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].

KUCHIN, S., I. TREICH, and M. CARLSON, 2000  A regulatory shortcut between the Snf1 protein kinase and RNA polymerase II holoenzyme. Proc. Natl. Acad. Sci. USA 97:7916-7920[Abstract/Free Full Text].

KUCHIN, S. V., N. N. KARTASHEVA, and S. V. BENEVOLENSKY, 1993  Genes required for derepression of an extracellular glucoamylase gene, STA2, in the yeast Saccharomyces.. Yeast 9:533-541[Medline].

LAMB, T. M., W. XU, A. DIAMOND, and A. P. MITCHELL, 2001  Alkaline response genes of S. cerevisiae and their relationship to the RIM101 pathway. J. Biol. Chem. 276:1850-1856[Abstract/Free Full Text].

LEGRAIN, P., M.-C. DOKHELAR, and C. TRANSY, 1994  Detection of protein-protein interactions using different vectors in the two-hybrid system. Nucleic Acids Res. 22:3241-3242[Free Full Text].

LESAGE, P., X. YANG, and M. CARLSON, 1996  Yeast SNF1 protein kinase interacts with SIP4, a C6 zinc cluster transcriptional activator: a new role for SNF1 in the glucose response. Mol. Cell. Biol. 16:1921-1928[Abstract].

LIPMAN, D., S. ALTSCHUL, and J. KECECIOGLU, 1989  A tool for multiple sequence alignment. Proc. Natl. Acad. Sci. USA 86:4412-4415[Abstract/Free Full Text].

LONGTINE, M. S., A. MCKENZIE, D. J. DEMARINI, N. G. SHAH, and A. WACH et al., 1998  Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.. Yeast 14:953-961[Medline].

LUDIN, K., R. JIANG, and M. CARLSON, 1998  Glucose-regulated interaction of a regulatory subunit of protein phosphatase 1 with the Snf1 protein kinase in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:6245-6250[Abstract/Free Full Text].

LUTFIYYA, L. L., V. R. IYER, J. DERISI, M. J. DEVIT, and P. O. BROWN et al., 1998  Characterization of three related glucose repressors and genes they regulate in Saccharomyces cerevisiae.. Genetics 150:1377-1391[Abstract/Free Full Text].

LYONS, T. J., A. P. GASCH, L. A. GAITHER, D. BOTSTEIN, and P. O. BROWN et al., 2000  Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc. Natl. Acad. Sci. USA 97:7957-7962[Abstract/Free Full Text].

MARTINEZ-PASTOR, M., G. MARCHLER, C. SCHULLER, A. MARCHLER-BAUER, and H. RUIS et al., 1996  The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J. 15:2227-2235[Medline].

MILLER, J. H., 1972 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

NEHLIN, J. O. and H. RONNE, 1990  Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumour finger proteins. EMBO J. 9:2891-2898[Medline].

OSTLING, J. and H. RONNE, 1998  Negative control of the Mig1p repressor by Snf1p-dependent phosphorylation in the absence of glucose. Eur. J. Biochem. 252:162-168[Medline].

OSTLING, J., M. CARLBERG, and H. RONNE, 1996  Functional domains in the Mig1 repressor. Mol. Cell. Biol. 16:753-761[Abstract].

PARK, S. H., S. S. KOH, J. H. CHUN, H. J. HWANG, and H. S. KANG, 1999  Nrg1 is a transcriptional repressor for glucose repression of STA1 gene expression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 19:2044-2050[Abstract/Free Full Text].

PRETORIUS, I. S., D. MODENA, M. VANONI, S. ENGLARD, and J. MARMUR, 1986  Transcriptional control of glucoamylase synthesis in vegetatively growing and sporulating Saccharomyces species. Mol. Cell. Biol. 6:3034-3041[Abstract/Free Full Text].

RAHNER, A., A. SCHOLER, E. MARTENS, B. GOLLWITZER, and H.-J. SCHULLER, 1996  Dual influence of the yeast Cat1p (Snf1p) protein kinase on carbon source-dependent transcriptional activation of gluconeogenic genes by the regulatory gene CAT8.. Nucleic Acids Res. 24:2331-2337[Abstract/Free Full Text].

RAHNER, A., M. HIESINGER, and H. SCHULLER, 1999  Deregulation of gluconeogenic structural genes by variants of the transcriptional activator Cat8p of the yeast Saccharomyces cerevisiae.. Mol. Microbiol. 34:146-156[Medline].

RANDEZ-GIL, F., J. A. PRIETO, and P. SANZ, 1995  The expression of a specific 2-deoxyglucose-6P phosphatase prevents catabolite repression mediated by 2-deoxyglucose in yeast. Curr. Genet. 28:101-107[Medline].

RANDEZ-GIL, F., N. BOJUNGA, M. PROFT, and K.-D. ENTIAN, 1997  Glucose derepression of gluconeogenic enzymes in Saccharomyces cerevisiae correlates with phosphorylation of the gene activator Cat8p. Mol. Cell. Biol. 17:2502-2510[Abstract].

ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics, a Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SONG, W. and M. CARLSON, 1998  Srb/mediator proteins interact functionally and physically with transcriptional repressor Sfl1. EMBO J. 17:5757-5765[Medline].

THOMPSON-JAEGER, S., J. FRANCOIS, J. P. GAUGHRAN, and K. TATCHELL, 1991  Deletion of SNF1 affects the nutrient response of yeast and resembles mutations which activate the adenylate cyclase pathway. Genetics 129:697-706[Abstract].

TREITEL, M. A. and M. CARLSON, 1995  Repression by SSN6–TUP1 is directed by MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. USA 92:3132-3136[Abstract/Free Full Text].

TREITEL, M. A., S. KUCHIN, and M. CARLSON, 1998  Snf1 protein kinase regulates phosphorylation of the Mig1 repressor in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:6273-6280[Abstract/Free Full Text].

TSUJIMOTO, Y., S. IZAWA, and Y. INOUE, 2000  Cooperative regulation of DOG2, encoding 2-deoxyglucose-6-phosphate phosphatase, by Snf1 kinase and the high-osmolarity glycerol-mitogen-activated protein kinase cascade in stress responses of Saccharomyces cerevisiae.. J. Bacteriol. 182:5121-5126[Abstract/Free Full Text].

TU, J. and M. CARLSON, 1994  The GLC7 type 1 protein phosphatase is required for glucose repression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 14:6789-6796[Abstract/Free Full Text].

TZAMARIAS, D. and K. STRUHL, 1995  Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9:821-831[Abstract/Free Full Text].

VINCENT, O. and M. CARLSON, 1998  Sip4, a Snf1 kinase-dependent transcriptional activator, binds to the carbon source-responsive element of gluconeogenic genes. EMBO J. 17:7002-7008[Medline].

VINCENT, O. and M. CARLSON, 1999  Gal83 mediates the interaction of the Snf1 kinase complex with the transcription activator Sip4. EMBO J. 18:6672-6681[Medline].

VINCENT, O., R. TOWNLEY, S. KUCHIN, and M. CARLSON, 2001  Subcellular localization of the Snf1 kinase is regulated by specific ß subunits and a novel glucose signaling mechanism. Genes Dev. 15(in press).

VOJTEK, A. B., S. M. HOLLENBERG, and J. A. COOPER, 1993  Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74:205-214[Medline].

YANG, X., E. J. HUBBARD, and M. CARLSON, 1992  A protein kinase substrate identified by the two-hybrid system. Science 257:680-682[Abstract/Free Full Text].

ZHOU, H. and F. WINSTON, 2001  NRG1 is required for glucose repression of the suc2 and GAL genes of Saccharomyces cerevisiae. BMC Genet. 2:5[Medline].

This article has been cited by other articles:

				N. Y. Villa, B. R. Kupchak, I. Garitaonandia, J. L. Smith, E. Alonso, C. Alford, L. A. Cowart, Y. A. Hannun, and T. J. Lyons Sphingolipids Function as Downstream Effectors of a Fungal PAQR Mol. Pharmacol., April 1, 2009; 75(4): 866 - 875. [Abstract] [Full Text] [PDF]

				T. Ye, K. Elbing, and S. Hohmann The pathway by which the yeast protein kinase Snf1p controls acquisition of sodium tolerance is different from that mediating glucose regulation Microbiology, September 1, 2008; 154(9): 2814 - 2826. [Abstract] [Full Text] [PDF]

				C. Hlynialuk, R. Schierholtz, A. Vernooy, and G. van der Merwe Nsf1/Ypl230w participates in transcriptional activation during non-fermentative growth and in response to salt stress in Saccharomyces cerevisiae Microbiology, August 1, 2008; 154(8): 2482 - 2491. [Abstract] [Full Text] [PDF]

				A. Ruiz and J. Arino Function and Regulation of the Saccharomyces cerevisiae ENA Sodium ATPase System Eukaryot. Cell, December 1, 2007; 6(12): 2175 - 2183. [Full Text] [PDF]

				M. Platara, A. Ruiz, R. Serrano, A. Palomino, F. Moreno, and J. Arino The Transcriptional Response of the Yeast Na+-ATPase ENA1 Gene to Alkaline Stress Involves Three Main Signaling Pathways J. Biol. Chem., December 1, 2006; 281(48): 36632 - 36642. [Abstract] [Full Text] [PDF]

				K. L. Cramer, Q. D. Gerrald, C. B. Nichols, M. S. Price, and J. A. Alspaugh Transcription Factor Nrg1 Mediates Capsule Formation, Stress Response, and Pathogenesis in Cryptococcus neoformans. Eukaryot. Cell, July 1, 2006; 5(7): 1147 - 1156. [Abstract] [Full Text] [PDF]

				G. M. Santangelo Glucose Signaling in Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 253 - 282. [Abstract] [Full Text] [PDF]

				V. K. Vyas, C. D. Berkey, T. Miyao, and M. Carlson Repressors Nrg1 and Nrg2 Regulate a Set of Stress-Responsive Genes in Saccharomyces cerevisiae Eukaryot. Cell, November 1, 2005; 4(11): 1882 - 1891. [Abstract] [Full Text] [PDF]

				K. Rothfels, J. C. Tanny, E. Molnar, H. Friesen, C. Commisso, and J. Segall Components of the ESCRT Pathway, DFG16, and YGR122w Are Required for Rim101 To Act as a Corepressor with Nrg1 at the Negative Regulatory Element of the DIT1 Gene of Saccharomyces cerevisiae Mol. Cell. Biol., August 1, 2005; 25(15): 6772 - 6788. [Abstract] [Full Text] [PDF]

				T. S. Kim, S. B. Lee, and H. S. Kang Glucose Repression of STA1 Expression Is Mediated by the Nrg1 and Sfl1 Repressors and the Srb8-11 Complex Mol. Cell. Biol., September 1, 2004; 24(17): 7695 - 7706. [Abstract] [Full Text] [PDF]

				C. D. Berkey, V. K. Vyas, and M. Carlson Nrg1 and Nrg2 Transcriptional Repressors Are Differently Regulated in Response to Carbon Source Eukaryot. Cell, April 1, 2004; 3(2): 311 - 317. [Abstract] [Full Text] [PDF]

				C. Dubacq, A. Chevalier, and C. Mann The Protein Kinase Snf1 Is Required for Tolerance to the Ribonucleotide Reductase Inhibitor Hydroxyurea Mol. Cell. Biol., March 15, 2004; 24(6): 2560 - 2572. [Abstract] [Full Text] [PDF]

				A. Kaniak, Z. Xue, D. Macool, J.-H. Kim, and M. Johnston Regulatory Network Connecting Two Glucose Signal Transduction Pathways in Saccharomyces cerevisiae Eukaryot. Cell, February 1, 2004; 3(1): 221 - 231. [Abstract] [Full Text] [PDF]

				E. T. Young, K. M. Dombek, C. Tachibana, and T. Ideker Multiple Pathways Are Co-regulated by the Protein Kinase Snf1 and the Transcription Factors Adr1 and Cat8 J. Biol. Chem., July 3, 2003; 278(28): 26146 - 26158. [Abstract] [Full Text] [PDF]

				V. K. Vyas, S. Kuchin, C. D. Berkey, and M. Carlson Snf1 Kinases with Different {beta}-Subunit Isoforms Play Distinct Roles in Regulating Haploid Invasive Growth Mol. Cell. Biol., February 15, 2003; 23(4): 1341 - 1348. [Abstract] [Full Text] [PDF]

				T. M. Lamb and A. P. Mitchell The Transcription Factor Rim101p Governs Ion Tolerance and Cell Differentiation by Direct Repression of the Regulatory Genes NRG1 and SMP1 in Saccharomyces cerevisiae Mol. Cell. Biol., January 15, 2003; 23(2): 677 - 686. [Abstract] [Full Text] [PDF]

				S. Kuchin, V. K. Vyas, and M. Carlson Snf1 Protein Kinase and the Repressors Nrg1 and Nrg2 Regulate FLO11, Haploid Invasive Growth, and Diploid Pseudohyphal Differentiation Mol. Cell. Biol., June 15, 2002; 22(12): 3994 - 4000. [Abstract] [Full Text] [PDF]