- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Betina, S.
- Articles by Wésolowski-Louvel, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Betina, S.
- Articles by Wésolowski-Louvel, M.
RAG4 Gene Encodes a Glucose Sensor in Kluyveromyces lactis
Svätopluk Betina1,a, Paola Goffrinib, Iliana Ferrerob, and Micheline Wésolowski-Louvelaa Unité Microbiologie et Génétique, Université Claude Bernard, 69622 Villeurbanne, France
b Istituto di Genetica, Università degli Studi di Parma, 43100 Parma, Italy
Corresponding author: Micheline Wésolowski-Louvel, Unité Microbiologie et Génétique, ERS 2009 CNRS/UCBL/INSA, Université Claude Bernard, Bâtiment 405, 43, Boulevard du 11 Novembre 1918, 69622 Villeurbanne Cédex, France., louvel{at}univ-lyon1.fr (E-mail)
Communicating editor: M. JOHNSTON
| ABSTRACT |
|---|
The rag4 mutant of Kluyveromyces lactis was previously isolated as a fermentation-deficient mutant, in which transcription of the major glucose transporter gene RAG1 was affected. The wild-type RAG4 was cloned by complementation of the rag4 mutation and found to encode a protein homologous to Snf3 and Rgt2 of Saccharomyces cerevisiae. These two proteins are thought to be sensors of low and high concentrations of glucose, respectively. Rag4, like Snf3 and Rgt2, is predicted to have the transmembrane structure of sugar transporter family proteins as well as a long C-terminal cytoplasmic tail possessing a characteristic 25-amino-acid sequence. Rag4 may therefore be expected to have a glucose-sensing function. However, the rag4 mutation was fully complemented by one copy of either SNF3 or RGT2. Since K. lactis appears to have no other genes of the SNF3/RGT2 type, we suggest that Rag4 of K. lactis may have a dual function of signaling high and low concentrations of glucose. In rag4 mutants, glucose repression of several inducible enzymes is abolished.
FERMENTATION is the main mode of energy acquisition in Saccharomyces cerevisiae, and the redundancy of many glycolytic genes in this yeast may reflect its importance. By contrast, in Kluyveromyces lactis fermentation is dispensable, and glycolytic genes are not redundant. This situation allowed us to isolate many mutants defective in key genes of the fermentation pathway. The central role of glucose transporters in the regulation of fermentation has thus been demonstrated (![]()
![]()
The glucose uptake system in K. lactis relies on two, nonredundant, glucose transporters with a few exceptions found in a variant set of strains: a low-affinity carrier encoded by RAG1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Yeast strains and growth conditions:
The strains used in this study are as follows: MW270-7B (MATa uraA1-1 leu2 metA1-1 Rag+; ![]()
![]()
![]()
lysA1-1 rag4-5 Rag-; ![]()
![]()
Yeast cells were grown at 28° either in a complete medium containing 1% Bacto yeast extract, 1% Bacto-peptone (Difco, Detroit), supplemented with glucose (as indicated) or in a minimal medium containing 0.7% yeast nitrogen base without amino acids (Difco) but with auxotrophic supplements as required and a specified carbon source. The Rag phenotype was tested on GAA medium (5% complete glucose medium supplemented with 5 µM antimycin A). The 2-deoxy-D-glucose- resistant phenotype Dgr+ was tested in a minimal medium containing 2-deoxy-D-glucose (Sigma, St. Louis) at the concentration of 5 g liter-1. The different carbon sources utilized were added at 2% (w/v).
Genetics methods have been described previously (![]()
![]()
Yeast transformation:
Replicative transformation of K. lactis was performed by electroporation. For integrative transformation of K. lactis, the procedure described by ![]()
Cloning and sequencing of RAG4 gene:
The RAG4 gene was cloned by in vivo complementation of rag4-1 mutation (strain PM6-7A/VV32) with a K. lactis genomic library made in the KCp491 vector. Out of 13,000 Ura+ transformants, two were found to be Rag+. The complementing plasmids extracted from these two transformants were then amplified in Escherichia coli. In each case, amplified DNA showed an expected pattern (vector + insert) for only one preparation out of three. In the other cases, the restriction profiles of DNA suggested loss of the insert together with reorganization of the vector. Further large-scale preparation of the complementing DNA turned out to be impossible, whatever the E. coli host (MC1066, XL1-Blue, and Sure). The complementing DNA that we had obtained in small quantities allowed us to establish that the two Rag+ transformants carried the same plasmid pSB1 containing a 6.0-kb insert (Fig 1). To save this DNA preparation, part of the restriction map of pSB1 was obtained from PCR-amplified DNA. The oligonucleotides used were as follows: TetBup, TCCTGCTCGCTTCGCTACTTGG (upstream of the BamHI site of tetracycline marker in which was cloned the genomic DNA of K. lactis) and TetBlw, CCATACCCACGCCGAAACAAGC (downstream of the BamHI site). Then, subfragments of the amplified insert were cloned into pCXJ18 vector and tested for their stability in E. coli as well as for their ability to complement the rag4-1 mutation. The results (Fig 1A) indicated that the largest subfragment (4.4-kb PvuII-BamHI) stable in E. coli did not complement the rag4 mutation. Therefore, the 2.7-kb PvuII-EcoRI fragment of the pSB1 plasmid (original DNA) cloned into SmaI and EcoRI sites of pCXJ18 plasmid was entirely sequenced on both strands. The 5' end of the RAG4 gene (upstream of the PvuII site) was sequenced after PCR amplification, using the Expand Long Template PCR system (Boehringer, Mannheim, Germany) with pSB1 original DNA as template. The oligonucleotides used were as follows: TetBup (see above) and RG-41, TGACGTGAACGATGTTCA (starting 100 nucleotides downstream of the PvuII site of pSB1 DNA). The resulting 1.8-kb PCR product was sequenced on both strands.
|
The RAG4 nucleotide sequence has been assigned the EMBL accession no. Y14849.
Construction of
rag4 deletion strains:
The 2.7-kb PvuII-EcoRI fragment containing most of the 3' region of the RAG4 gene and cloned into the pCXJ18 plasmid was recloned into the pBluescript KS phagemid (Stratagene, La Jolla, CA), using the BamHI and the EcoRI sites (Fig 1B). The resulting plasmid was digested with StyI, blunt ended with Klenow enzyme prior to digestion with BglII. Then, the internal 1.5-kb StyI-BglII fragment was replaced by a 1.0-kb SphI-EcoRI fragment that contained the URA3 marker from pAF101 vector (provided by B. Dujon, Institut Pasteur, Paris; ![]()
Complementation of the rag4 mutation by SNF3 and RGT2:
The two genes were cloned in low-copy-number URA3-marked vectors of K. lactis. The 4.1-kb HindIII-NruI fragment of the SNF3-containing plasmid pBL8 (provided by M. Carlson, Columbia University, New York; ![]()
![]()
![]()
Preparation of yeast RNA and probes:
Total RNA was extracted from cells grown to an OD600 of 2 to 3. Poly(A)+ enriched mRNA were obtained using an mRNA separator (CLONTECH, Palo Alto, CA). The RAG4 probe used was the 0.98-kb PvuII-KpnI fragment (Fig 1) of pSB1 DNA. The RAG1 probe used was a specific 0.9-kb SalI-PstI internal fragment of the gene (![]()
![]()
(provided by K. D. Breunig, Martin-Luther-University, Halle-Wittenberg, Germany) containing the whole LAC4 gene. KlCYB2 probe was a 1.9-kb SalI-EcoRI fragment from p30 plasmid (![]()
Measurement of glucose uptake:
Glucose uptake was measured as previously described (![]()
Preparation of cell-free extract and enzyme assays:
Cells, harvested at a density of
5 x 107 cells ml-1, were resuspended in extraction buffer (0.1 M Tris-HCl, pH 8.5, 1 mM phenylmethylsulfonyl fluoride) and disrupted by vortexing at 4° in the presence of glass beads. The supernatant was utilized for measurement of the enzyme activity.
ß-Galactosidase (EC 3.2.1.23) activity was assayed as described by ![]()
![]()
-glucosidase (maltase, EC 3.2.1.20 and isomaltase, EC 3.2.1.10) activity was tested with p-nitrophenyl-O-D-glucopyranoside as a substrate as described by ![]()
| RESULTS |
|---|
Isolation of the RAG4 gene and deduced amino acid sequence of its product:
We isolated a plasmid (pSB1) from a CEN-based K. lactis genomic library by its ability to complement the rag4-1 mutation and confer the Rag+ phenotype (see MATERIALS AND METHODS). The nucleotide sequence of the left end of the 4.4-kb PvuII-BamHI fragment revealed the presence of an open reading frame (ORF) whose putative product showed a high homology with SNF3 and RGT2 gene products of S. cerevisiae. This ORF should correspond to the RAG4 gene since the right half of the insert was not complementing. The complete nucleotide sequence of the RAG4 gene was established as reported in MATERIALS AND METHODS. The deduced Rag4 protein was found to be 716 amino acids long, of which the first 113 were localized to the left of the PvuII site of pSB1 DNA (Fig 1). Probably it is this or flanking region of the RAG4 gene that, for unknown reasons, contained the element(s) of instability (see MATERIALS AND METHODS). The predicted Rag4 protein presents 12 potential transmembrane domains, typical of sugar permeases, as well as a 251-residue C-terminal tail. This C-terminal extension is characteristic of the glucose sensor proteins of S. cerevisiae Snf3 and Rgt2, which have been shown to control the transcription of several glucose permease genes (![]()
![]()
![]()
![]()
Disruption and expression of RAG4 gene:
A rag4 null mutant is Rag-. Moreover, the allelism of the disrupted gene with rag4 was confirmed by the absence of complementation in a cross between the disruptant and the rag4-5 strain (MW109-8C/FA49). Thus, the cloned gene indeed corresponds to the RAG4 locus, and the rag4 null mutation is not lethal.
Transcript level of RAG4 was found to be very low, and the mRNA could be detected only when the poly (A)+ fraction of the total RNA was used (Fig 2). SNF3 and RGT2 genes of S. cerevisiae are also known to be transcribed at low level (![]()
![]()
|
Complementation of the rag4 mutation by RGT2 and SNF3 genes of S. cerevisiae:
The functional similarity of Rag4 and Snf3/Rgt2 was suggested by the impairment of transcription of glucose permease genes in the corresponding mutants: RAG1 gene transcription is affected in rag4 mutant in K. lactis (![]()
![]()
|
Growth phenotype and glucose uptake in the rag4 null mutant:
The S. cerevisiae snf3 mutant but not rgt2 is defective in growth on raffinose (low glucose) plus antimycin (![]()
![]()
![]()
![]()
|
In the rag4 mutant, the glucose-induced expression of the low-affinity glucose permease gene RAG1 is severely reduced (![]()
|
The expression of glucose-permease genes is controlled by Rag4:
As in the original rag4 strain, the transcription of RAG1 could not be detected in the null mutant (
rag4), while that of HGT1 was slightly increased in the mutant (Fig 6A and Fig B). Most K. lactis strains harbor the two single genes RAG1 and HGT1 coding for low- and high-affinity glucose permeases, respectively. However, some natural isolates do not contain the HGT1 gene (our unpublished data), and their RAG1 locus is replaced by two tandemly arranged glucose transporter genes, KHT1 (identical to RAG1), inducible by high levels of glucose, and KHT2 (a variant of RAG1), weakly induced by low glucose and repressed by high glucose (![]()
![]()
rag4 mutant cells grown either at low or high glucose concentration (Fig 6C). Therefore, Rag4 appears to be required for the specific glucose-induced expression of both of these genes. It is noteworthy that, in this case, induction by both low and high concentrations of glucose is dependent on Rag4.
|
Role of RAG4 gene in glucose repression:
The K. lactis strains most sensitive to glucose repression are those mentioned above that contain the two glucose transporter genes KHT1 and KHT2 (![]()
![]()
-glucosyl-
-glucose), raffinose (
-galactosyl-
-glucosyl-ß-fructose), ethanol, and lactate (![]()
![]()
|
The levels of the enzymes necessary for the utilization of lactose/galactose and L-lactate [ß-galactosidase and L-lactate ferricytochrome c-oxidoreductase (L-LCR), respectively] were completely derepressed in cells grown on glucose (Fig 8). Maltase activity was derepressed in the kht1 kht2 mutant, but not in the rag4 mutant. These results are fully consistent with the growth phenotypes observed in the presence of 2-DOG.
|
The derepression phenotypes observed in rag4 are mediated by changes in the transcription of the corresponding genes, since the levels of LAC4 and KlCYB2 mRNA are strongly reduced by glucose in wild type, but not in the rag4 mutant (Fig 9A).
|
The effect of Rag4 on glucose repression of LAC4 is probably mediated through one of the two regulatory genes of the lactose-galactose regulon: LAC9 (KlGAL4), the transcriptional activator (![]()
![]()
![]()
| DISCUSSION |
|---|
The RAG4 gene has been supposed to have some regulatory function in the glucose uptake system in K. lactis because, in this mutant, the induced transcription of the glucose transporter gene RAG1 is lost (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Snf3 has been proposed to function as a sensor of low levels of glucose and Rgt2 as a sensor of high glucose levels (![]()
![]()
![]()
![]()
rag4 strain of the CBS 2359 genetic background. In the JA6 genetic context where the single gene RAG1 has been replaced by KHT1 plus KHT2, the transcription of the two genes was no longer induced by high and low levels of glucose, respectively. Fourth, disruption of RAG4 in a glucose- responsive strain (JA6) abolished glucose repression of several genes (like LAC4 and KlCYB2), whereas in S. cerevisiae glucose repression of SUC2 and GAL1 can be prevented only in the snf3 rgt2 double mutant (![]()
![]()
Although less pronounced than in S. cerevisiae, glucose repression is also an important regulatory device in some strains of K. lactis (JA6 series; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Cancer Research Institute, Slovak Academy of Sciences, Department of Molecular Biology and Biochemistry, Bratislava 842 15, Slovakia. ![]()
| ACKNOWLEDGMENTS |
|---|
We are grateful to Sabira Özcan and Marian Carlson for sharing plasmids. We thank Hiroshi Fukuhara for encouragement and helpful discussions. Svätopluk Betina was a recipient of a Fellowship from the Ministère de l'Education Nationale, de l'Enseignement Supérieur et de la Recherche. This work was supported in part by a grant from the Commission of the European Communities (BIO4-CT96-0003) and in part by a grant from Ministero Università e Ricerca Scientifica e Tecnologica-Università di Parma Cofin 1999.
Manuscript received December 11, 2000; Accepted for publication February 19, 2001.
| LITERATURE CITED |
|---|
ALBERTI, A., P. GOFFRINI, I. FERRERO, and T. LODI, 2000 Cloning and characterization of the lactate-specific inducible gene KlCYB2, encoding the cytochrome b2 of Kluyveromyces lacti.. Yeast 16:657-665[Medline].
BILLARD, P., S. MÉNART, J. BLAISONNEAU, M. BOLOTIN-FUKUHARA, and H. FUKUHARA et al., 1996 Glucose uptake in Kluyveromyces lactis: Role of the HGT1 gene in glucose transport. J. Bacteriol 178:5860-5866
BLAISONNEAU, J., H. FUKUHARA, and M. WÉSOLOWSKI-LOUVEL, 1997 The Kluyveromyces lactis equivalent of caseine kinase I is required for the transcription of the gene encoding the low-affinity glucose permease. Mol. Gen. Genet. 253:469-477[Medline].
BREUNIG, K. D., 1989 Glucose repression of LAC gene expression in yeast is mediated by the transcriptional activator LAC9. Mol. Gen. Genet. 216:422-427[Medline].
BREUNIG, K. D., M. BOLOTIN-FUKUHARA, M. M. BIANCHI, D. BOURGAREL, and C. FALCONE et al., 2000 Regulation of primary carbon metabolism in Kluyveromyces lactis.. Enzyme Microb. Technol. 26:771-780[Medline].
CHEN, X. J., 1996 Low- and high-copy-number shuttle vectors for replication in the budding yeast Kluyveromyces lactis.. Gene 172:131-136[Medline].
CHEN, X. J., M. WÉSOLOWSKI-LOUVEL, and H. FUKUHARA, 1992 Glucose transport in the yeast Kluyveromyces lactis. II. Transcriptional regulation of the glucose transporter gene RAG1. Mol. Gen. Genet. 33:97-105.
COHN, M. and J. MONOD, 1951 Purification et proprieté de la ß-galactosidase d'Escherichia coli.. Biochem. Biophys. Acta 7:153-165[Medline].
COONS, D., M. P. VAGNOLI, and L. F. BISSON, 1997 The C-terminal domain of Snf3p is sufficient to complement the growth defect of snf3 null mutations in Saccharomyces cerevisiae: SNF3 functions in glucose recognition. Yeast 13:9-20[Medline].
DICKSON, R. C., R. M. SHEETZ, and L. R. LACY, 1981 Genetic regulation: yeast mutants constitutive for ß-galactosidase activity have an increased level of ß-galactosidase messenger ribonucleic acid. Mol. Cell. Biol. 1:1048-1056
DOHMEN, R. J., A. W. M. STRASSER, C. B. HÖNER, and C. P. HOLLENBERG, 1991 An efficient transformation procedure enabling long-term storage of competent cells of various yeast genera. Yeast 7:691-692[Medline].
FERRERO, I., C. ROSSI, M. P. LANDINI, and P. P. PUGLISI, 1978 Role of the mitochondrial protein synthesis in the carbon catabolite repression of the petite-negative yeast K. lactis.. Biochem. Biophys. Res. Commun. 80:340-348[Medline].
GOFFRINI, P., A. A. ALGERI, C. DONNINI, M. WÉSOLOWSKI-LOUVEL, and I. FERRERO, 1989 RAG1 and RAG2: nuclear genes involved in the dependence/independence on mitochondrial respiratory function for the growth on sugars. Yeast 5:99-106[Medline].
GOFFRINI, P., A. FICARELLI, and I. FERRERO, 1995 Hexokinase activity is affected in mutants of Kluyveromyces lactis resistant to glucose repression. Microbiology 141:441-447
LIANG, H. and R. F. GABER, 1996 A novel signal transduction pathway in Saccharomyces cerevisiae defined by Snf3-regulated expression of HXT6.. Mol. Biol. Cell 7:1953-1966[Abstract].
LODI, T., D. O'CONNOR, P. GOFFRINI, and I. FERRERO, 1994 Isolation and characterization of the KlDLD gene encoding the carbon catabolite repressible mitochondrial enzyme D-lactate ferricytochrome c oxidoreductase in Kluyveromyces lactis.. Mol. Gen. Genet. 244:622-629[Medline].
MARSHALL-CARLSON, L., J. L. CELENZA, B. C. LAURENT, and M. CARLSON, 1990 Mutational analysis of the SNF3 glucose transporter of Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:1105-1115
MEIJER, M., M. C. J. BOONSTRA, A. J. VERKLEIJ, and C. T. VERRIPS, 1998 Glucose repression in Saccharomyces cerevisiae is related to the glucose concentration rather than the glucose flux. J. Biol. Chem. 273:24102-24107
NEIGEBORN, L., P. SCHWARTZBERG, R. REID, and M. CARLSON, 1986 Null mutation in the SNF3 gene of Saccharomyces cerevisiae cause a different phenotype than do previously isolated missense mutations. Mol. Cell. Biol. 6:3569-3574
ÖZCAN, S., J. DOVER, A. G. ROSENWALD, S. WÖLFL, and M. JOHNSTON, 1996 Two glucose transporters in Saccharomyces cerevisiae are glucose sensors that generate a signal for induction of gene expression. Proc. Natl. Acad. Sci. USA 93:12428-12432
ÖZCAN, S., J. DOVER, and M. JOHNSTON, 1998 Glucose sensing and signaling by two glucose receptors in the yeast Saccharomyces cerevisiae.. EMBO. J. 17:2566-2573[Medline].
PRIOR, C. P., H. MAMESSIER, X. J. FUKUHARA, M. CHEN AND, and M. CHEN ANDWÉSOLOWSKI-LOUVEL, 1993 The hexokinase gene is required for the transcriptional regulation of the glucose transporter gene RAG1 in Kluyveromyces lactis.. Mol. Cell. Biol. 13:3882-3889
SALMERON, J. M. and S. A. JOHNSTON, 1986 Analysis of the Kluyveromyces lactis positive regulatory gene LAC9 reveals functional homology to, but sequence divergence from, the Saccharomyces cerevisiae GAL4 gene. Nucleic Acids Res. 14:7767-7781
SCHMIDT, M., C. R. R. MCCARTNEY, X. ZHANG, T. S. TILLMAN, and H. SOLIMEO et al., 1999 Std1 and Mth1 proteins interact with the glucose sensors to control glucose-regulated gene expression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 19:4561-4571
THIERRY, A., C. FAIRHEAD, and B. DUJON, 1990 The complete sequence of the 8.2 kb segment left of MAT on chromosome III reveals five ORFs, including a gene for a yeast ribokinase. Yeast 6:521-534[Medline].
VAGNOLI, P., D. M. COONS, and L. F. BISSON, 1998 The C-terminal domain of Snf3p mediates glucose-responsive signal transduction in Saccharomyces cerevisiae.. FEMS Microbiol. Lett. 160:31-36[Medline].
WEIRICH, J., P. GOFFRINI, P. KUGER, I. FERRERO, and K. D. BREUNIG, 1997 Influence of mutations in hexose-transporter genes on glucose repression in Kluyveromyces lactis.. Eur. J. Biochem. 249:248-257[Medline].
WÉSOLOWSKI, M., A. A. ALGERI, P. GOFFRINI, and H. FUKUHARA, 1982 Killer DNA plasmids of the yeast Kluyveromyces lactis. I. Mutations affecting the killer phenotype. Curr. Genet. 150:137-140.
WÉSOLOWSKI-LOUVEL, M., P. GOFFRINI, I. FERRERO, and H. FUKUHARA, 1992a Glucose transport in the yeast Kluyveromyces lactis. I. Properties of an inducible low-affinity glucose transporter gene. Mol. Gen. Genet. 33:89-96.
WÉSOLOWSKI-LOUVEL, M., C. PRIOR, D. BORNECQUE, and H. FUKUHARA, 1992b Rag- mutations involved in glucose metabolism in yeast: Isolation and genetic characterization. Yeast 8:711-719.
YE, L., A. L. KRUCKEBERG, J. A. BERDEN, and K. VAN DAM, 1999 Growth and glucose repression are controlled by glucose transport in Saccharomyces cerevisiae cells containing only one glucose transporter. J. Bacteriol. 181:4673-4675
ZENKE, F., W. ZACHARIAE, A. LUNKES, and K. D. BREUNIG, 1993 Gal80 proteins of Kluyveromyces lactis and Saccharomyces cerevisiae are highly conserved but contribute differently to glucose repression of the galactose regulon. Mol. Cell. Biol. 13:7566-7576
ZIMMERMANN, F. K. and I. SCHEEL, 1977 Mutants of Saccharomyces cerevisiae resistant to carbon catabolite repression. Mol. Gen. Genet. 154:75-82[Medline].
ZIMMERMANN, F. K., I. KAUFMANN, H. RASENBERGER, and P. HAUSMANN, 1977 Genetics of carbon catabolite repression in Saccharomyces cerevisiae: genes involved in the derepression process. Mol. Gen. Genet. 151:95-103[Medline].
This article has been cited by other articles:
![]() |
M. Hnatova, M. Wesolowski-Louvel, G. Dieppois, J. Deffaud, and M. Lemaire Characterization of KlGRR1 and SMS1 Genes, Two New Elements of the Glucose Signaling Pathway of Kluyveromyces lactis Eukaryot. Cell, August 1, 2008; 7(8): 1299 - 1308. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. G. Stasyk, M. M. Maidan, O. V. Stasyk, P. Van Dijck, J. M. Thevelein, and A. A. Sibirny Identification of Hexose Transporter-Like Sensor HXS1 and Functional Hexose Transporter HXT1 in the Methylotrophic Yeast Hansenula polymorpha Eukaryot. Cell, April 1, 2008; 7(4): 735 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rolland, M. Hnatova, M. Lemaire, J. Leal-Sanchez, and M. Wesolowski-Louvel Connection Between the Rag4 Glucose Sensor and the KlRgt1 Repressor in Kluyveromyces lactis Genetics, October 1, 2006; 174(2): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Suleau, P. Gourdon, J. Reitz-Ausseur, and S. Casaregola Transcriptomic Analysis of Extensive Changes in Metabolic Regulation in Kluyveromyces lactis Strains. Eukaryot. Cell, August 1, 2006; 5(8): 1360 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Abdel-Sater, M. El Bakkoury, A. Urrestarazu, S. Vissers, and B. Andre Amino Acid Signaling in Yeast: Casein Kinase I and the Ssy5 Endoprotease Are Key Determinants of Endoproteolytic Activation of the Membrane-Bound Stp1 Transcription Factor Mol. Cell. Biol., November 15, 2004; 24(22): 9771 - 9785. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lemaire and M. Wesolowski-Louvel Enolase and Glycolytic Flux Play a Role in the Regulation of the Glucose Permease Gene RAG1 of Kluyveromyces lactis Genetics, October 1, 2004; 168(2): 723 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. V. Stasyk, O. G. Stasyk, J. Komduur, M. Veenhuis, J. M. Cregg, and A. A. Sibirny A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha J. Biol. Chem., February 27, 2004; 279(9): 8116 - 8125. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Milkowski, S. Krampe, J. Weirich, V. Hasse, E. Boles, and K. D. Breunig Feedback Regulation of Glucose Transporter Gene Transcription in Kluyveromyces lactis by Glucose Uptake J. Bacteriol., September 15, 2001; 183(18): 5223 - 5229. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Betina, S.
- Articles by Wésolowski-Louvel, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Betina, S.
- Articles by Wésolowski-Louvel, M.

, open reading frame; + and -, presence or absence of complementation of rag4 mutation. (B) Internal fragment disruption of the RAG4 gene with URA3 marker (shaded box). The open and solid boxes indicate the genomic fragment. Solid boxes represent the RAG4 sequence (see MATERIALS AND METHODS).











