- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hadjimarcou, M. I.
- Articles by Reha-Krantz, L. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hadjimarcou, M. I.
- Articles by Reha-Krantz, L. J.
Identification of a Mutant DNA Polymerase
in Saccharomyces cerevisiae With an Antimutator Phenotype for Frameshift Mutations
Michalis I. Hadjimarcoua,
Robert J. Kokoskab,
Thomas D. Petesb, and
Linda J. Reha-Krantza
a Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada
b Department of Biology, University of North Carolina, Chapel Hill, North Carolina 27599-3280
Corresponding author: Linda J. Reha-Krantz, Department of Biological Sciences, CW405 BioSciences Bldg., University of Alberta, Edmonton, Alberta T6G 2E9, Canada., lreha{at}gpu.srv.ualberta.ca (E-mail)
Communicating editor: S. SANDMEYER
| ABSTRACT |
|---|
We propose that a ß-turn-ß structure, which plays a critical role in exonucleolytic proofreading in the bacteriophage T4 DNA polymerase, is also present in the Saccharomyces cerevisiae DNA pol
. Site-directed mutagenesis was used to test this proposal by introducing a mutation into the yeast POL3 gene in the region that encodes the putative ß-turn-ß structure. The mutant DNA pol
has a serine substitution in place of glycine at position 447. DNA replication fidelity of the G447S-DNA pol
was determined in vivo by using reversion and forward assays. An antimutator phenotype for frameshift mutations in short homopolymeric tracts was observed for the G447S-DNA pol
in the absence of postreplication mismatch repair, which was produced by inactivation of the MSH2 gene. Because the G447S substitution reduced frameshift but not base substitution mutagenesis, some aspect of DNA polymerase proofreading appears to contribute to production of frameshifts. Possible roles of DNA polymerase proofreading in frameshift mutagenesis are discussed.
DNA polymerases replicate DNA with high accuracy due to their ability to discriminate between "right" and "wrong" nucleotides in the nucleotide incorporation reaction and due to exonucleolytic proofreading, which removes misinserted nucleotides. We used a genetic approach to study proofreading by the bacteriophage T4 DNA polymerase, a model for a large family of DNA polymerases that includes the human DNA polymerase
(![]()
![]()
![]()
of Saccharomyces cerevisiae.
The most frequently identified T4 DNA polymerase active-site-switching mutant has a serine substitution for glycine at position 255, the G255S substitution. The T4 G255S-DNA polymerase and other active-site-switching mutants are not defective in cleaving the phosphodiester bond; instead, these mutants are impaired in one or more earlier steps in the proofreading pathway that prepare the primer terminus for the hydrolysis reaction. Proofreading begins with recognition of a mismatched base pair in the polymerase active center and then the primer end with the incorrect nucleotide is separated from the template strand and transferred to the exonuclease active center where hydrolysis takes place. The G255S-DNA polymerase is slow to form the partially strand-separated editing complex compared to the wild-type T4 DNA polymerase (![]()
![]()
![]()
![]()
![]()
![]()
The participation of the ß-hairpin structure in forming the strand-separated editing complex is a critical step in the T4 DNA polymerase proofreading pathway. The reduced ability of the T4 G255S-DNA polymerase to form editing complexes means reduced proofreading and increased DNA replication errors. A strong mutator phenotype is observed for the T4 G255S-DNA polymerase in vivo, similar in magnitude to mutant T4 DNA polymerases with amino acid substitutions in the exonuclease active center that prevent the hydrolysis reaction (![]()
![]()
Given the importance of the ß-hairpin structure for proofreading by the T4 DNA polymerase, we have carried out a series of genetic experiments with the DNA pol
of S. cerevisiae to determine if this DNA polymerase has a similar structure that functions in proofreading. Eukaryotic DNA pol
is the major replicative DNA polymerase in the cell and DNA pol
also functions in DNA repair (![]()
| MATERIALS AND METHODS |
|---|
Protein sequence alignments:
DNA polymerase protein sequence comparisons were performed by using the PepTools software (BioTools, Edmonton, Alberta, Canada).
Construction of yeast strains:
All yeast strains used for this study were derived from MS71 (![]()
ade5-1 leu2-3,112 trp1-289 ura3-52 his7-2), obtained from A. Morrison and A. Sugino, Osaka University, Osaka, Japan. Strains EAS74 (msh2) and EAS38 (msh6) were described previously (![]()
MIH1 (pol3-447) was constructed by first subcloning 2.2 kb of the 5' end of the POL3 (DNA pol
) gene from the full-length gene. The full-length gene was obtained from a plasmid provided by Peter Burgers (St. Louis). Greater plasmid stability in bacteria was obtained with this partial POL3 construct, which contains the exonuclease domain. Site-directed mutagenesis to produce the G447S substitution was done by the method of ![]()
![]()
gene was sequenced to verify the presence of the mutation that encodes the G447S substitution and the absence of other mutations (![]()
RJK224 (pol3-447 msh2) was derived by sporulating the diploid formed by crossing haploid strains MIH1 and EAS56. RJK346 (pol3-447 msh6) was derived by sporulating the diploid formed by crossing the haploid strains MIH1 and EAS48. The msh2 and msh6 genotypes were identified by PCR analysis as described previously (![]()
Determination of spontaneous mutation rates and mutational spectra in yeast:
The forward mutation rate at the CAN1 locus was determined by innoculating 20 colonies of each strain into 5 ml of liquid growth medium (YPD) and growing the cultures to saturation. Each culture was washed once with 1 ml of sterile distilled water. The number of Canr mutants was determined by plating appropriate dilutions onto solid synthetic minimal medium lacking arginine and containing 60 mg/liter canavanine. Each culture was also titered onto complete minimal medium without canavanine to determine the viable cell count.
Cultures were prepared in a similar manner for determining the rate of his7-2 reversion. The number of His+ revertants was determined by plating appropriate dilutions onto minimal medium lacking histidine and the viable cell count was determined by plating onto complete minimal medium.
Mutation rates for each experiment were determined by using the method of the median (![]()
![]()
The mutations present in individual Canr isolates were identified by sequencing a PCR-amplified copy of the 1.8-kb CAN1 gene made by using the primers CAN1UP (5' CAGAGTTCTTCAGACTTC) and CAN1DOWN (5' AGGGTGAGAATGCGAAAT). Three separate primers were used to sequence this fragment: CAN1583C, corresponding to nucleotides 602 to 583 of the CAN1 open reading frame (5' AGTGGAACTTTGTACGTCCA); CAN1552, corresponding to nucleotides 533 to 552 (5' CAATCACTTTTGCCCTGGAA); and CAN1DOWN (sequence given above).
The sequences of His+ revertants were determined by sequencing a PCR fragment containing this region. This fragment was amplified using primer F1, corresponding to positions (-56) to (-34) relative to the HIS7 open reading frame (5' GAAGTAGCAGTATCCAGTTTAGG), and primer R1, corresponding to positions 886 to 865 (5' ATGTTACTTCATCCGCACCCTG). Sequencing was performed using the R1 primer.
Determination of spontaneous mutation frequencies in bacteriophage T4:
Bacterial and T4 strains and culture conditions have been described (![]()
![]()
GC transition mutation (![]()
TA or AT
CG transversion mutations (![]()
(A)6, to restore the wild-type sequence (![]()
![]()
![]()
| RESULTS |
|---|
Identification of the G255-type ß-hairpin in other DNA polymerases by protein sequence comparisons:
From protein sequence similarities we proposed that the G255 ß-hairpin in the T4 DNA polymerase may be conserved in the yeast and human DNA pol
's (![]()
![]()
![]()
's (Fig 1). The sequence alignments begin with a highly conserved exonuclease motif (![]()
![]()
![]()
's. The ß-hairpin is followed by a short ß-strand and two
-helices; conserved Gly, Asp, and Leu residues, which demarcate these structures in the T4, RB69, and DTOK DNA polymerases, appear to be present in the other DNA polymerases. In the RB69 DNA polymerase editing complex, residue Arg260 projects into the junction where the single-stranded primer terminus is separated from the template strand (![]()
|
As a first attempt to determine if the proposed protein sequence similarities mean similar function, the S. cerevisiae G447S-DNA pol
was constructed by site-directed mutagenesis. Residue G447 in the yeast DNA pol
appears to be analogous to G255 in the T4 DNA polymerase (Fig 1); thus, the yeast G447S-DNA pol
was predicted to have reduced proofreading as observed for the T4 G255S-DNA polymerase. Construction of the pol3-447 allele to encode the yeast G447S-DNA pol
was achieved by using standard site-directed mutagenesis procedures, which are described in MATERIALS AND METHODS section. Growth rates were the same for the mutant and wild-type yeast strains and the mutant strain was not temperature sensitive (![]()
![]()
are described below.
Base substitution and frameshift mutagenesis by the T4 G255S-DNA polymerase and the exonuclease-deficient D324G-DNA polymerase:
Although a strong mutator phenotype was observed for the T4 G255S-DNA polymerase by previous reversion and forward mutation tests (![]()
![]()
![]()
104-fold compared to the wild-type T4 DNA polymerase (![]()
|
Transition and transversion mutation frequencies were increased
100- to 200-fold for the G255S- and D324G-DNA polymerases compared to the wild-type T4 DNA polymerase (Table 1). While very similar mutation frequencies were observed for the G255S- and D324G-DNA polymerases for base substitution errors, a lower frameshift mutation frequency was observed for the G255S-DNA polymerase compared to the D324G-DNA polymerase (Table 1). A 7-fold increase in +1 frameshifts compared to the wild-type DNA polymerase was detected at the rII131 site for the G255S-DNA polymerase and a 20-fold increase was observed at the rII117 site; however, much larger 150- to 200-fold increases were observed for the D324G-DNA polymerase. Some of the rII131+ and rII117+ revertants were sequenced. For the wild-type T4 DNA polymerase, 67% (14/21) of the rII131+ revertants were +1 frameshifts that expanded the run of five As to six, (A)5
(A)6, which restores the wild-type sequence. The other revertants were pseudorevertants with mutations at nearby sites: four +1 frameshift mutations, one -2 deletion, and two complex duplications. For the G255S-DNA polymerase, 94% (15/16) of the rII131+ revertants restored the wild-type sequence from (A)5
(A)6 and a similar number, 92% (11/12), was detected for the D324A-DNA polymerase. Less sequencing was done at the rII117 site, but 75% or more of the revertants were +1 frameshifts, (A)5
(A)6, that restored the wild-type sequence.
These results show that the G255S-DNA polymerase, which is defective in forming the partially strand-separated editing complex, is more prone to base substitution mutations than to frameshifts. The exonuclease-deficient D324G-DNA polymerase, on the other hand, which can form the editing complex but is defective in the hydrolysis reaction, is a strong mutator for both base substitution and frameshift mutations. Thus, amino acid substitutions that affect different steps of the proofreading pathway have different effects on base substitution and frameshift fidelity.
Frameshift fidelity by the S. cerevisiae wild-type and G447S-DNA pol
's:
DNA replication fidelity in yeast was determined by two methods: (1) reversion of the his7-2 allele, which reverts primarily by a +1 frameshift mutation to expand the tract of seven As to eight, (A)7
(A)8, which is the wild-type sequence (![]()
![]()
![]()
No significant differences in mutation rates for production of His+ revertants or Canr mutants were observed between the wild-type and pol3-447 strains (Table 2). These mutation rates, however, do not provide a true measure of replication errors made by DNA pol
since many errors will be corrected by postreplication mismatch repair, which is present in yeast and in many other organisms, but not in phage T4. Replication fidelity by the G447S-DNA pol
was measured in an msh2 background since the Msh2 protein is required for repair of both single-base mispairs and insertion/deletion mispairs (![]()
30-fold increase in the Canr mutation rate was observed for the msh2 strain compared to the wild-type strain and a 170-fold rate increase was observed for reversion of the his7-2 allele (Table 2). Fewer Canr mutations and his7-2 revertants were observed for the msh2 pol3-447 strain compared to the msh2 strain (Table 2); the Canr mutation rate was
3-fold lower and the his7-2 rate was
5-fold lower. The lower mutation rates observed for the msh2 pol3-447 strain compared to the msh2 strain are significant by the Fisher exact test (P < 0.0001) for both the his7-2 reversion assay and for production of Canr mutations.
|
Ten independent His+ revertants arising in the msh2 strain and 10 His+ revertants arising in the msh2 pol3-447 strain were sequenced. All 20 His+ revertants were +1 insertions, A7
A8, which restored the wild-type sequence. Twenty independent Canr mutants for the wild-type, pol3-447, msh2, and msh2 pol3-447 strains (80 total) were sequenced (Table 3). In the presence of active mismatch repair, most of the Canr mutations were single-base substitutions, but most of the mutations for the msh2 strains were single-base insertion/deletion mutations, primarily -1 deletions in short mononucleotide repeat sequences, as observed by ![]()
|
Base substitution fidelity by the S. cerevisiae wild-type and G447S-DNA pol
's:
A strong mutator phenotype for base substitution mutations was expected for the G447S-DNA pol
as observed for the T4 G255S-DNA polymerase (Table 1). The Canr mutation rates for the wild-type and pol3-447 strains, however, are indistinguishable (Table 2 and Table 3). Although the base substitution mutator phenotype for the G447S-DNA pol
was expected to be strong enough to be detected in the presence of postreplication mismatch repair, mismatch repair may be sufficient to correct base substitution errors made by a weak mutator DNA polymerase. The Msh6 protein is required for repair of base substitution errors (![]()
's. An approximately sevenfold rate increase in Canr mutants was observed for the msh6 strain compared to the wild-type strain (Table 2) and 95% (19/20) of the Canr mutants were base substitutions (Table 3); however, no significant differences were seen for the msh6 pol3-447 strain. Thus, the yeast G447S-DNA pol
does not appear to be a mutator for base substitution errors, but we cannot rule out the possibility that replication errors made by the G447S-DNA pol
may be repaired by another proofreading exonuclease activity, such as by DNA pol
(![]()
| DISCUSSION |
|---|
Genetic (![]()
![]()
![]()
![]()
![]()
![]()
![]()
The discovery of a similar ß-turn-ß structure in the exonuclease domain of an archaeal DNA polymerase, the DTOK DNA polymerase (![]()
, an essential DNA polymerase for chromosome replication (![]()
's (Fig 1). Although there is only limited sequence similarity in the region of the ß-turn-ß structure, amino acid residues that demarcate ß-strands and
-helices in the T4, RB69, and DTOK DNA polymerases appear to be conserved in the other DNA polymerases compared. A star in Fig 1 indicates the position of residue G255 in the turn of the ß-hairpin of the T4 DNA polymerase and large boldface letters indicate this residue and other apparent conserved residues.
To determine if the apparent conserved ß-turn-ß structure in other DNA polymerases is important for proofreading, as observed for the T4 DNA polymerase, site-directed mutagenesis was used to construct the S. cerevisiae G447S-DNA pol
. The expectation was that the yeast G447S-DNA pol
would confer a strong mutator phenotype for base substitutions and a weaker mutator phenotype for frameshifts, as detected for the T4 G255S-DNA polymerase (Table 1). DNA replication fidelity in yeast was determined in vivo by reversion and forward mutation tests (Table 2 and Table 3). A mutator phenotype for base substitution errors was not detected for the yeast G447S-DNA pol
, but an antimutator phenotype for +1 and -1 frameshifts in short homopolymeric tracts was observed (Table 2 and Table 3). The frameshift antimutator phenotype was observed only in the absence of postreplication mismatch repair, which was achieved by inactivation of the MSH2 gene. These results will be discussed first with respect to the role of the ß-hairpin structure in the yeast DNA polymerase proofreading pathway and second with respect to the role of DNA polymerase proofreading in frameshift mutagenesis.
Because a strong mutator phenotype for base substitution errors was not observed for the yeast G447S-DNA pol
, a ß-hairpin structure may not exist or, if the structure is present, the structure does not function in proofreading in the yeast DNA pol
as it does for the T4 DNA polymerase. Alternatively, if yeast DNA pol
has a ß-hairpin structure, as supported by the protein sequence alignments (Fig 1), the serine substitution for G447 may not be sufficient to alter the yeast ß-hairpin structure as much as the G255S substitution alters the T4 ß-hairpin structure. Additional mutational analysis of the yeast DNA pol
is required to determine which of the proposals is correct, but we favor the proposal that the yeast DNA pol
has a ß-hairpin that functions in proofreading since the G447S substitution does affect DNA replication fidelity (Table 2 and Table 3). The antimutator phenotype of the G447S-DNA pol
most likely indicates a direct role of DNA pol
in frameshift mutagenesis; an indirect role would involve the G447S substitution allowing proofreading by another, more accurate DNA polymerase.
The antimutator phenotype observed for the yeast G447S-DNA pol
for frameshift mutations, but not for base substitutions, emphasizes the differences in the mechanisms responsible for producing the two types of mutations. The antimutator phenotype is even more interesting because of the location of the G447S substitution in the proofreading 3'
5' exonuclease domain since antimutator alleles of the T4 DNA polymerase (![]()
![]()
, the pol3-01 allele (![]()
Base substitutions are believed to arise by misinserted nucleotides that are not corrected by exonucleolytic proofreading or by postreplication mismatch repair. Frameshifts, however, are believed to arise by transient misalignment of the primer and template strands, most likely in sequences with simple repeats (![]()
![]()
Two models for production of misaligned DNA strands have been proposed: one model requires DNA polymerase dissociation and the second occurs during processive DNA replication. Since frameshift mutagenesis is stimulated in in vitro assays by conditions that favor DNA polymerase dissociation, strand misalignments are proposed to either occur spontaneously when the DNA strands are unbound or to be formed during reassociation of the DNA polymerase to the primer template (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
The G255S substitution in the T4 DNA polymerase produces a mutant enzyme with decreased ability to form the partially strand-separated editing complex (![]()
![]()
![]()
![]()
Antimutator DNA polymerases provide an opportunity to learn how DNA replication errors are made. The frameshift antimutator G447S-DNA pol
differs from the T4 antimutator DNA polymerases, which sharply reduce AT
GC transitions, but have little effect or may even increase other types of mutations (![]()
![]()
![]()
![]()
also differs from the E. coli dnaE antimutators, which reduce transitions, but not transversions or frameshifts (![]()
![]()
is the link between frameshift mutagenesis and postreplication mismatch repair. Since the frameshift antimutator phenotype for the G447S-DNA pol
was detected only in the absence of postreplication mismatch repair, postreplication mismatch repair normally repairs these insertion/deletion mismatches. Thus, postreplication mismatch repair may have evolved to remedy not only nucleotide misincorporation errors and strand misalignments that escape proofreading, but also errors that result from strand misalignments that may be formed during proofreading.
| ACKNOWLEDGMENTS |
|---|
We thank D. Wishart and BioTools Inc. (Edmonton, Alberta, Canada) for assistance with protein sequence alignments, L. Stefanovic for assistance in determining yeast mutation rates, and S. Stocki and D. Zhao for assistance in determining the T4 mutation rates. We also thank M. Goodman, T. Kunkel, and lab members for helpful comments on the manuscript. This research was supported by a grant from the Medical Research Council of Canada (MT-13651 to L.J.R.-K.) and by grants from the National Institutes of Health (GM-52319 to T.D.P. and GM-17879 to R.J.K). M.I.H. was supported by the International Council for Canadian Studies and the Canadian Commonwealth Scholarship and Fellowship Program. L.R.-K. is a Scientist of the Alberta Heritage Foundation for Medical Research.
Manuscript received November 3, 2000; Accepted for publication February 13, 2001.
| LITERATURE CITED |
|---|
BAKER, R. P. and L. J. REHA-KRANTZ, 1998 Identification of a transient excision intermediate at the crossroads between DNA polymerase extension and proofreading pathways. Proc. Natl. Acad. Sci. USA 95:3507-3512
BEBENEK, K., W. A. BEARD, J. R. CASAS-FINET, H.-R. KIM, and T. A. DARDEN et al., 1995 Reduced frameshift fidelity and processivity of HIV-1 reverse transcriptase mutants containing alanine substitutions in helix H of the thumb subdomain. J. Biol. Chem. 270:19516-19523
BENZER, S., 1960 On the topography of the genetic fine structure. Genetics 47:403-415.
BLOOM, L. B., X. CHEN, D. K. FYGENSON, J. TURNER, and M. O'DONNELL et al., 1997 Fidelity of Escherichia coli DNA polymerase III holoenzyme. The effects of ß,
complex processivity proteins and
proofreading exonuclease on nucleotide misincorporation efficiencies. J. Biol. Chem. 272:27919-27930
BRAITHWAITE, D. K. and J. ITO, 1993 Compilation, alignment, and phylogenetic relationships of DNA polymerases. Nucleic Acids Res. 21:787-802
DRAKE, J. W., 1993 General antimutators are improbable. J. Mol. Biol. 229:8-13[Medline].
DRAKE, J. W. and E. O. GREENING, 1970 Suppression of chemical mutagenesis in bacteriophage T4 by genetically modified DNA polymerases. Proc. Natl. Acad. Sci. USA 66:823-829
ELISSEEVA, E., S. S. MANDAL, and L. J. REHA-KRANTZ, 1999 Mutational and pH studies of the 3'
5' exonuclease activity of bacteriophage T4 DNA polymerase. J. Biol. Chem. 274:25151-25158
FIDALGO DA SILVA, E. and L. J. REHA-KRANTZ, 2000 Dinucleotide repeat expansion catalyzed by bacteriophage T4 DNA polymerase in vitro.. J. Biol. Chem. 275:31528-31535
FUJII, S., M. AKIYAMA, K. AOKI, Y. SUGAYA, and K. HIGUCHI et al., 1999 DNA replication errors produced by the replicative apparatus of Escherichia coli. J. Mol. Biol. 289:835-850[Medline].
HACKER, K. J. and B. A. ALBERTS, 1994 The slow dissociation of the T4 DNA polymerase holoenzyme when stalled by nucleotide omission. J. Biol. Chem. 269:24209-24220
HADJIMARCOU, M. I., 1999 Proofreading by yeast DNA polymerase delta. M.Sc. Thesis, University of Alberta, Edmonton, Alberta, Canada.
KROUTIL, L. C., M. W. FREY, B. F. KABOORD, T. A. KUNKEL, and S. J. BENKOVIC, 1998 Effect of accessory proteins on T4 DNA polymerase replication fidelity. J. Mol. Biol. 278:135-146[Medline].
KUNKEL, T. A., 1985a Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492
KUNKEL, T. A., 1985b The mutational specificity of DNA polymerases-
and -
during in vitro DNA synthesis. J. Biol. Chem. 260:12866-12874
KUNKEL, T. A. and A. SONI, 1988 Mutagenesis by transient misalignment. J. Biol. Chem. 263:14784-14789
KUNKEL, T. A., S. S. PATEL, and K. A. JOHNSON, 1994 Error-prone replication of repeated DNA sequences by T7 DNA polymerase in the absence of its processivity subunit. Proc. Natl. Acad. Sci. USA 91:6830-6834
LEA, D. E. and C. A. COULSON, 1949 The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-285.
MARQUEZ, L. A. and L. J. REHA-KRANTZ, 1996 Using 2-aminopurine fluorescence and mutational analysis to demonstrate an active role of bacteriophage T4 DNA polymerase in strand separation required for 3'
5' exonuclease activity. J. Biol. Chem. 271:28903-28911
MARSISCHKY, G. T., N. FILOSI, M. F. KANE, and R. KOLODNER, 1996 Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10:407-420
MCPHEETERS, D. S., A. CHRISTENSEN, E. T. YOUNG, G. STORMO, and L. GOLD, 1986 Translational regulation of expression of the bacteriophage T4 lysozyme gene. Nucleic Acids Res. 14:5813-5826
MORRISON, A. and A. SUGINO, 1994 The 3'
5' exonucleases of both DNA polymerase
and
participate in correcting errors of DNA replication in Saccharomyces cerevisiae.. Mol. Gen. Genet. 242:289-296[Medline].
MORRISON, A., A. L. JOHNSON, L. H. JOHNSTON, and A. SUGINO, 1993 Pathway correcting DNA replication errors in Saccharomyces cerevisiae.. EMBO J. 12:1467-1473[Medline].
NOSSAL, N. G., 1998 A new look at old mutants of T4 DNA polymerase. Genetics 148:1535-1538
PRIBNOW, D., D. C. SIGURDSON, L. GOLD, B. S. SINGER, and C. NAPOLI et al., 1981 rII cistrons of bacteriophage T4. J. Mol. Biol. 149:337-376[Medline].
REHA-KRANTZ, L. J., 1988 Amino acid changes coded by bacteriophage T4 DNA polymerase mutator mutants. J. Mol. Biol. 202:711-724[Medline].
REHA-KRANTZ, L. J., 1995 Learning about DNA polymerase function by studying antimutator DNA polymerases. Trends Biochem. Sci. 232:133-140.
REHA-KRANTZ, L. J. and R. L. NONAY, 1993 Genetic and biochemical studies of bacteriophage T4 DNA polymerase 3'
5' exonuclease activity. J. Biol. Chem. 268:27100-27108
RIPLEY, L. S., 1975 Transversion mutagenesis in bacteriophage T4. Mol. Gen. Genet. 141:23-40[Medline].
RIPLEY, L. S. and N. B. SHOEMAKER, 1983 A major role for bacteriophage T4 DNA polymerase in frameshift mutagenesis. Genetics 103:353-366
ROTHSTEIN, R., 1983 One-step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].
SCHAAPER, R. M., 1993 The mutational specificity of two Escherichia coli dnaE antimutator alleles as determined from lacI mutation spectra. Genetics 134:1031-1038[Abstract].
SCHLÖTTERER, C. and D. TAUTZ, 1992 Slippage synthesis of simple sequence DNA. Nucleic Acids Res. 20:211-215
SHAMOO, J. and T. A. STEITZ, 1999 Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex. Cell 99:155-166[Medline].
SHCHERBAKOVA, P. V. and T. A. KUNKEL, 1999 Mutator phenotypes conferred by MLH1 overexpression and by heterozygosity for mlh1 mutations. Mol. Cell. Biol. 19:3177-3183
SIA, E., R. KOKOSKA, M. DOMINSKA, P. GREENWELL, and T. D. PETES, 1997 Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17:2851-2858[Abstract].
SITNEY, K. C., M. E. BUDD, and J. L. CAMPBELL, 1989 DNA polymerase III, a second essential DNA polymerase, is encoded by the S. cerevisiae CDC2 gene. Cell 56:599-605[Medline].
SPICER, E. K., J. RUSH, C. FUNG, L. J. REHA-KRANTZ, and J. D. KARAM et al., 1988 Primary structure of T4 DNA polymerase. Evolutionary relatedness to eucaryotic and other procaryotic DNA polymerases. J. Biol. Chem. 263:7478-7486
STOCKI, S. A., R. L. NONAY, and L. J. REHA-KRANTZ, 1995 Dynamics of bacteriophage T4 DNA polymerase function: identification of amino acid residues that affect switching between polymerase and 3'
5' exonuclease activities. J. Mol. Biol. 254:15-28[Medline].
STRAND, M., M. C. EARLEY, G. F. CROUSE, and T. D. PETES, 1995 Mutations in the MSH3 gene preferentially lead to deletions within tracts of simple repetitive DNA in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 92:10418-10421
STREISINGER, G., Y. OKADA, J. EMRICH, J. NEWTON, and A. TSUGITA et al., 1966 Frameshift mutations and the genetic code. Cold Spring Harbor Symp. Quant. Biol. 31:77-84
TSURIMOTO, T. and B. STILLMAN, 1990 Functions of replication factor C and proliferating-cell nuclear antigen: functional similarity of DNA polymerase accessory proteins from human cells and bacteriophage T4. Proc. Natl. Acad. Sci. USA 87:1023-1027
WAGA, S. and B. STILLMAN, 1998 The DNA replication fork in eukaryotic cells. Annu. Rev. Biochem. 67:721-751[Medline].
WANG, J., P. YU, T. C. LIN, W. H. KONIGSBERG, and T. A. STEITZ, 1996 Crystal structures of an NH2-terminal fragment of T4 DNA polymerase and its complexes with single-stranded DNA and with divalent metal ions. Biochemistry 35:8110-8119[Medline].
WANG, J., A. K. M. A. SATTAR, C. C. WANG, J. D. KARAM, and W. H. KONIGSBERG et al., 1997 Crystal structure of a pol
family replication DNA polymerase from bacteriophage RB69. Cell 89:1087-1099[Medline].
WANG, T. S.-F., S. W. WONG, and D. KORN, 1989 Human DNA polymerase
: predicted functional domains and relationships with viral DNA polymerases. FASEB J. 3:14-21[Abstract].
WIERDL, M., C. N. GREENE, A. DATTA, S. JINKS-ROBERTSON, and T. D. PETES, 1996 Destabilization of simple repetitive DNA sequences by transcription in yeast. Genetics 143:713-721[Abstract].
ZHAO, Y., D. JERUZALMI, I. MOAREFI, L. LEIGHTON, and R. LASKEN et al., 1999 Crystal structure of an archaebacterial DNA polymerase. Structure Fold Des. 7:1189-1199[Medline].
This article has been cited by other articles:
![]() |
M. M. Desai, D. Weissman, and M. W. Feldman Evolution Can Favor Antagonistic Epistasis Genetics, October 1, 2007; 177(2): 1001 - 1010. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. d. Silva and L. J. Reha-Krantz DNA polymerase proofreading: active site switching catalyzed by the bacteriophage T4 DNA polymerase Nucleic Acids Res., August 15, 2007; (2007) gkm591v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. F. Pursell, I. Isoz, E.-B. Lundstrom, E. Johansson, and T. A. Kunkel Regulation of B family DNA polymerase fidelity by a conserved active site residue: characterization of M644W, M644L and M644F mutants of yeast DNA polymerase {varepsilon} Nucleic Acids Res., May 14, 2007; 35(9): 3076 - 3086. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Sterling and J. B. Sweasy DNA Polymerase 4 of Saccharomyces cerevisiae Is Important for Accurate Repair of Methyl-Methanesulfonate-Induced DNA Damage Genetics, January 1, 2006; 172(1): 89 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, K. M. Murphy, U. Kanevets, and L. J. Reha-Krantz Sensitivity to Phosphonoacetic Acid: A New Phenotype to Probe DNA Polymerase {delta} in Saccharomyces cerevisiae Genetics, June 1, 2005; 170(2): 569 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Jin, P. Garg, C. M. W. Stith, H. Al-Refai, J. F. Sterling, L. J. W. Murray, T. A. Kunkel, M. A. Resnick, P. M. Burgers, and D. A. Gordenin The Multiple Biological Roles of the 3'->5' Exonuclease of Saccharomyces cerevisiae DNA Polymerase {delta} Require Switching between the Polymerase and Exonuclease Domains Mol. Cell. Biol., January 1, 2005; 25(1): 461 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Miller, E. Kutter, G. Mosig, F. Arisaka, T. Kunisawa, and W. Ruger Bacteriophage T4 Genome Microbiol. Mol. Biol. Rev., March 1, 2003; 67(1): 86 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Rattray, B. K. Shafer, C. B. McGill, and J. N. Strathern The Roles of REV3 and RAD57 in Double-Strand-Break-Repair-Induced Mutagenesis of Saccharomyces cerevisiae Genetics, November 1, 2002; 162(3): 1063 - 1077. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Degtyareva, P. Greenwell, E. R. Hofmann, M. O. Hengartner, L. Zhang, J. G. Culotti, and T. D. Petes Caenorhabditis elegans DNA mismatch repair gene msh-2 is required for microsatellite stability and maintenance of genome integrity PNAS, February 19, 2002; 99(4): 2158 - 2163. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hadjimarcou, M. I.
- Articles by Reha-Krantz, L. J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hadjimarcou, M. I.
- Articles by Reha-Krantz, L. J.






