- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Pâques, F.
- Articles by Haber, J. E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Pâques, F.
- Articles by Haber, J. E.
Expansions and Contractions in 36-bp Minisatellites by Gene Conversion in Yeast
Frédéric Pâquesa,b, Guy-Franck Richarda,c, and James E. Haberaa Rosenstiel Center and Department of Biology, Brandeis University, Waltham, Massachusetts 02454-9110,
b Institut Jacques Monod, UMR 7592, Université Paris 6 et Paris 7, 75251 Paris Cedex 05, France
c Unité de Génétique Moléculaire des Levures, UMR 1300 CNRS and UFR 927 Université Pierre et Marie Curie, Paris, Institut Pasteur, 75724 Paris Cedex 15, France
Corresponding author: James E. Haber, Rosenstiel Center and Department of Biology, Brandeis University, 415 South St., Waltham, MA 02454-9110., haber{at}brandeis.edu (E-mail)
Communicating editor: L. S. SYMINGTON
| ABSTRACT |
|---|
The instability of simple tandem repeats, such as human minisatellite loci, has been suggested to arise by gene conversions. In Saccharomyces cerevisiae, a double-strand break (DSB) was created by the HO endonuclease so that DNA polymerases associated with gap repair must traverse an artificial minisatellite of perfect 36-bp repeats or a yeast Y' minisatellite containing diverged 36-bp repeats. Gene conversions are frequently accompanied by changes in repeat number when the template contains perfect repeats. When the ends of the DSB have nonhomologous tails of 47 and 70 nucleotides that must be removed before repair DNA synthesis can begin, 16% of gene conversions had rearrangements, most of which were contractions, almost always in the recipient locus. When efficient removal of nonhomologous tails was prevented in rad1 and msh2 strains, repair was reduced 10-fold, but among survivors there was a 10-fold reduction in contractions. Half the remaining events were expansions. A similar decrease in the contraction rate was observed when the template was modified so that DSB ends were homologous to the template; and here, too, half of the remaining rearrangements were expansions. In this case, efficient repair does not require RAD1 and MSH2, consistent with our previous observations. In addition, without nonhomologous DSB ends, msh2 and rad1 mutations did not affect the frequency or the distribution of rearrangements. We conclude that the presence of nonhomologous ends alters the mechanism of DSB repair, likely through early recruitment of repair proteins including Msh2p and Rad1p, resulting in more frequent contractions of repeated sequences.
MINISATELLITES are tandem repeats of a few dozen nucleotides that display an unusually high rate of instability, manifested by changes in number of tandem repeats. In humans, these changes arise during germline formation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Human minisatellite instability apparently arises through gene conversion events during or shortly after meiosis, many of which involve interallele transfers of information (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We previously studied frequent rearrangements of repeated sequences associated with mitotic gene conversion in budding yeast, using both 375-bp repeats and trinucleotide repeats (![]()
![]()
![]()
|
|
In this study, we provide direct evidence for DSB-induced rearrangements of minisatellite sequences in yeast, using arrays of either perfect or imperfect 36-bp repeats. Both expansions and contractions of minisatellites were induced by recombination, but their ratio, as well as the overall rearrangement frequency, is affected by the presence of nonhomologous sequences surrounding the DSB, and by mutations in the RAD1 and MSH2 genes affecting the removal of such sequences. We suggest that the early recruitment of Rad1p and Msh2p and associated repair proteins needed to trim off the nonhomologous DSB ends affects the subsequent steps of DNA repair, in a way that favors the contraction pathway.
| MATERIALS AND METHODS |
|---|
Strains:
The S. cerevisiae strains studied in this work all derive from YFP17 (![]()
![]()
![]()
![]()
Plasmids:
A series of five plasmids, described in Fig 1, were derived from Ted, a centromeric plasmid marked by the URA3 gene (provided by W. Kramer). In pFP14 (Fig 3C), a genomic XhoI-SalI fragment including the LEU2 gene was inserted into the polylinker of a URA3-marked centromeric plasmid, as described by ![]()
![]()
![]()
|
DSB induction and characterization of recombinants:
YEPD and synthetic dropout media used for the growth of S. cerevisiae were made according to ![]()
200 cells/plate. In the absence of any DSB, colonies appear on YEPD and YEP-galactose with the same efficiency (not shown). For strains with an HO cut site in the chromosomal LEU2 gene, DSB repair efficiency was scored as the ratio of the number of colonies on YEP-galactose to that on YEPD. Independent colonies were patched, and the patch was used to inoculate 2-ml cultures. PCR was performed directly on cells: about one-tenth of a 3-day-old colony was boiled 5 min in the PCR mixture, and then 5 units of Taq polymerase were added; PCR involved 35 cycles, including 1 min at 94°, 2 min at 42°, and 4 min at 65° for elongation. For precise rearrangement mapping (Fig 3B), PCRs were done on DNA and not cells. The DNA sequences of the oligonucleotides shown in Fig 1 are: TCATTTAATTGGTGGTGCTGCTATC (oligo 1), GATAAGTCTAAAAGAGAGTCGGATGC (oligo 2), TTGCAGATTCCCTTTTATGGATTCC (oligo 3), and GCTGCTTCCTAATGCAGGATCG (oligo 4).
For statistical analysis, we used Fisher's exact test. With pFP59 and pFP225 in the wild-type, rad1, and msh2 backgrounds, two independent experiments were performed. We first tested the homogeneity of two sets of results, and then pooled all the events in Table 1 and Table 3, to compare them with other substrates and/or genetic backgrounds.
|
|
|
| RESULTS |
|---|
A perfect 36-bp repeat undergoes frequent rearrangements during DSB repair:
Using the experimental system described in Fig 1, we examined gene conversion-associated rearrangements of 36-bp repeated sequences. A DSB was induced by the HO endonuclease in the yeast LEU2 gene (see MATERIALS AND METHODS). When there is no donor template (Fig 1B), the vast majority of cells die, because homologous recombination is impossible and most cells lose the broken chromosome. Cells were transformed with plasmid pFP59 (Fig 1D) that contains an octamer of directly oriented 36-bp repeats of the E. coli Lac operator (![]()
We studied the outcome of the gene conversion events in the survivors by the PCR assay illustrated in Fig 3, which allowed us to identify the structure of both the plasmid donor template and the chromosomal recipient molecule. The DSB was indeed repaired by a gene conversion event wherein the repeated locus was transferred into the broken molecule. Note that this gene conversion is necessarily not associated with crossing over, because such an event would integrate the donor plasmid in the chromosome, resulting in an unstable dicentric chromosome III. As shown in Table 1, 11 rearrangements among 69 products were found only in the recipient molecule (the chromosomal copy). These rearrangements are considered to occur during DSB repair and amount to an average of 15.9% of the repair events. In another case, both the donor and recipient had the same altered number of repeats, suggesting that the donor had rearranged prior to gene conversion, although we cannot exclude that both molecules were concomitantly rearranged during DSB repair. One survivor colony carried on two different donor molecules, and in the recipient, the tandem array had the same size as in the rearranged donor. In this case, prior rearrangement of the donor may have appeared during the S phase that preceded a gene conversion induced in G2. In a control experiment, where HO was not expressed, there was only one rearrangement of plasmid sequences among 176 cells, an expansion of one repeat.
The same experiment was done with pFP58 as a template donor. pFP58 contains an array of 16 repeats, interrupted in the middle by 32 bp of a polylinker. Among 38 recombinants, 10 exhibited rearrangements in the recipient molecules (26.3%), 9 of 10 being contractions (Table 2). One expansion was also found in the donor. Since the recipient molecules of the same cells display a nonrearranged tandem array, this rearrangement in the donor is likely to be a consequence of DSB. However, a spontaneous event occurring immediately after DSB repair cannot be ruled out.
3' nonhomologous ends affect the DSB-induced rearrangement distribution and frequency:
With the pFP58 and pFP59 templates, one of the early steps of gene conversion is the efficient removal of the nonhomologous sequences at the ends of the DSB by a MSH2- and RAD1-dependent process (![]()
![]()
![]()
However, the rearrangement rate using pFP225 was four times lower than with pFP59, dropping from 15.9 to 3.8% (Table 3). Nevertheless, these rearrangements still kept the signature of SDSA, for they were mostly found in the recipient molecule. An intriguing feature was that the ratio of expansions and contractions was significantly shifted toward expansions, which now represented one-half (three out of six) of the rearrangements. In contrast, 11 contractions but no expansions were found among 69 DSB repair events with pFP59. By Fisher's exact test, the contractions are clearly more frequent in pFP59 than pFP225 (P = 1.8 x 10-4), but the expansion rates are not distinguishable (P = 0.55). Thus, the difference between pFP59 and pFP225 lies essentially in the higher rate of contraction among successful recombinants in pFP59.
Requirement for the Msh2 and Rad1 proteins in the DSB-induced tandem repeat rearrangements:
We have previously shown that the excision endonuclease Rad1p-Rad10p and the mismatch repair proteins Msh2p and Msh3p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We therefore tested the impact of msh2 and rad1 mutants on the rearrangement process. With pFP58 and pFP59, the HO-cleaved ends of the DSB have 47 and 70 bp of the HO recognition site that are not homologous to the donor templates, and that must be excised by Rad1p and Msh2p (![]()
![]()
We then analyzed the survivors. In the rad1 strain, we characterized 71 survivor cells from two independent experiments with pFP59. Six proved to have repaired the DSB by nonhomologous end-joining, a RAD1-independent process (![]()
The three events found in the msh2 strain with pFP59 are all +1 expansions. This contrasts with wild-type cells, where only contractions were seen in 11 cases. The higher rate of contractions in the wild-type strain is clearly significant (P = 6 x 10-6), but the expansion rates are not distinguishable (P = 0.81), indicating thatas with the comparison of events in templates that did or did not contain homology to the DSB endsonly the contraction rate is affected by msh2. It is also important to note that in two of the three cases of expansion in msh2, the expansion was found in a mixed colony in which one-half of the cells had an unrearranged number of repeats and one-half had an expansion. Sectored colonies could be attributed to the lack of Rad1p- and Msh2p-dependent mismatch correction of a heteroduplex containing a 36-bp loop, analogous to postmeiotic segregations that were shown to have a similar dependence on Rad1p and Msh2p (![]()
We also tested deletions of MSH6 and PMS1. These two genes act with MSH2 in the mismatch repair pathway but do not participate in nonhomologous tail removal. In addition, PMS1 is required together with MSH2 and RAD1 for heteroduplex loop correction during HO-induced mitotic gene conversion (![]()
![]()
A completely different situation was observed with plasmid pFP225 (see Table 1 and Table 3). Rearrangements were already relatively rare in a wild-type strain, but neither msh2 nor rad1 mutations affected the contraction rate (P = 0.16). This is clearly different from the effect in pFP59. There was also no significant change in the expansion rate. A single expansion was observed in msh2 and none in rad1 out of 363 total colonies, vs. 3/157 in wild type; however, the result is statistically not significant (P = 0.08).
DSB-induced rearrangements appear with a low frequency in a natural diverged yeast minisatellite:
Natural minisatellites generally contain diverged repeats. To determine if base pair differences within the repeats have an effect on minisatellite stability during mitotic recombination, we replaced the artificial perfect repeat by a natural yeast minisatellite locus, normally found in subtelomeric Y' sequences (![]()
![]()
When we induced DSB repair with pFP46 as a donor template, the repair efficiency did not change compared to the result obtained with a perfect repeat (Fig 1); however, the frequency of rearrangements was greatly reduced. Among 194 gene conversion events, only two rearrangements, one expansion and one contraction, were found within the minisatellite, both in the recipient molecule (Table 4). This 1% rate of rearrangement is 16 times lower than what was observed with a perfect repeat. We conclude that the difference in the rearrangement rate is very likely to be due to the sequence divergence, although we cannot rule out that the difference results from some sequence-specific features.
|
In yeast and bacteria, recombination between diverged sequences is inhibited by the mismatch repair system (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Neither msh6 nor pms1 mutations had much effect on this system; the frequencies of rearrangements were 1.4% (1/72) and 2.7% (2/74), respectively, which are not statistically significantly different from the 1% observed in wild type and still far from the 18.5% contractions observed with a shorter but perfect repeat. We also tested a msh2 mutant. As with the other templates, a low rate of survivors was obtained because of the requirement of Msh2p to remove nonhomologous tails. We tested 40 survivors, and no rearrangement was observed.
| DISCUSSION |
|---|
Gene conversion as a major source of tandem repeat rearrangements:
Expansions and contractions of tandemly repeated sequences, from micro- and minisatellites to gene-sized repeats, occur during or around meiosis (![]()
![]()
![]()
![]()
![]()
![]()
We developed a mitotic system in Saccharomyces, where it is possible to examine repeat instability accompanying DSB repair in great detail and provide a paradigm for the study of the mechanism and genetic requirements of this instability. This approach was used to examine rearrangements in 375-bp repeats (![]()
![]()
![]()
An examination of the rates and types of rearrangements with different templates provides some further insight into the origins of expansions and contractions of repeated sequences. First, the rearrangement rate is not strongly a function of the total length of the interval between the ends of the DSB. With 8 375-bp repeats (total length 2900 bp)
36% of gene conversions had either fewer or >8 repeats (![]()
![]()
On the other hand, either the size of the repeats or some sequence-specific feature influences the nature of the rearrangements. With 8 375-bp repeats, more than one-third of the events were expansions, whereas virtually all the changes with 8 36-bp repeats were contractions. A few expansions were seen with pFP58, which has 16 repeats, whereas all events with a template carrying 8 repeats were contractions. Similarly, with a donor template carrying (CAG)39, all rearrangements were contractions (![]()
![]()
![]()
It appears that those sequences that have high frequencies of recombination-associated expansions are capable of forming stable single-stranded secondary structures. CAG repeats are known to form hairpin structures in vitro and show frequent rearrangements, whereas CAA repeats, which do not form stable single-strand hairpin structures, have low rates of rearrangement (![]()
![]()
![]()
![]()
![]()
Ratio of expansions vs. contractions:
In many previous studies on tandem repeat instability in yeast, contractions were generally found to be the major class of events (![]()
![]()
![]()
![]()
The first case concerns plasmid pFP225. When an HO-cleaved chromosomal site is repaired using plasmids pFP59, pFP58, and pFP46 as the template, there is no homology with the HO cut site, and the two nonhomologous sequences must be excised. In pFP225, two half-HO cut sites restore perfect homology with the DSB extremities. pFP59 and pFP225 are identical in all other respects, and yet yield strikingly different results. The overall rearrangement frequency is fourfold higher with pFP59, but this difference is due entirely to a very high rate of contractions. These contractions are suppressed in pFP225, but expansions are now found and amount to one-half of the events. Thus the presence of nonhomologous tails profoundly influences what kind of repair events are seen.
A second case where expansions are also prevalent is when there are nonhomologous tails, using pFP59 as the template, but in msh2 and rad1 derivatives, where efficient removal of such tails is prevented. In fact, only expansions were found, whereas the frequent contractions observed in wild type were completely suppressed. Why should nonhomologous ends result in a substantially higher rate of contractions? One possibility is that such 3' overhangs, which have to be removed by a Msh2p-Rad1p complex, would channel DSB repair in a specific, contraction prone, recombination process. But curiously, in the few survivors we recover with pFP59 in the msh2 and rad1 mutant strains, contractions are infrequent. We previously showed that there is a relatively inefficient Rad1p-, Msh2p-independent pathway to remove nonhomologous DNA tails (![]()
![]()
Mechanisms of expansions and contractions:
Recently, two groups tested the impact of msh2 on minisatellite rearrangement in yeast meiosis (![]()
![]()
![]()
![]()
In a yeast strain defective for both msh2 and pms1, ![]()
![]()
![]()
![]()
Instead, we interpret most of the observed rearrangements in terms of out-of-frame annealing or out-of-frame reinvasion during SDSA. SDSA models (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
A number of SDSA intermediates leading to repeat rearrangement require the processing of 3'-overhangs by Msh2p-Rad1p (Fig 2F and Fig L). One possibility is that the early recruitment of Msh2p and Rad1p favors the later processing of these intermediates, maybe because Rad1p and Msh2p remain somewhat associated with the replication proteins. Without this early interaction, these proteins would have to be recruited de novo, and the potentially unstable intermediates shown in Fig 2F and Fig L, would dissociate most of the time before Rad1p and Msh2p have a chance to process them. In this case, only contractions would depend on Rad1p and Msh2p, because most of the intermediates leading to expansions (Fig 2H and Fig M) can right away initiate new DNA synthesis.
Another possibility is that the recruitment of Msh2p and Rad1p to the end of the DSB, when nonhomologous tails must be removed, facilitates the loading or retention of proteins that decrease the processivity of repair DNA synthesis. When there are no nonhomologous tails, repair synthesis proceeds with only occasional dissociation. Then most gene conversions should be accurate, provided one-ended strand invasion (Fig 2, IL) is the major pathway. When Rad1p-Rad10p and Msh2p-Msh3p are recruited (along with the participation of both Rad59p and Srs2p; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
DSB-induced repeat rearrangements are less frequent in a heterogeneous repeat than in a perfect one:
We also examined the effect of sequence divergence on repeat rearrangement. Although we observed nearly 16% of DSB-induced rearrangements in a perfect 36-bp repeat, the rearrangement frequency was only 1% with a heterogeneous 36-bp repeat, encompassing even more repeat units (12 instead of 8). This result is not surprising, for homeologous recombination is usually impaired by the mismatch repair machinery. In the human CEB1 locus, the very heterogeneous alleles are more stable than the rather (but never fully) homogeneous ones (![]()
Mismatch repair proteins discourage recombination between mismatched substrates. However, msh2, msh6, and pms1 mutations did not restore a level of recombination-induced rearrangements similar to that observed with perfect repeats. Previous studies suggested that sequences diverged by 10% would be outside the range that could be suppressed by mismatch repair mutants during mitosis (![]()
![]()
![]()
![]()
Nevertheless, we do see an
1% rate of change in the size of the Y' sequences during recombination, which is an evolutionarily significant rate. In meiosis, the same minisatellite array is rearranged in 0.5% of the tetrads (![]()
![]()
The results we presented provide evidence that, depending on the exact nature of the DNA ends and of the template sequences, both expansions and contractions can be obtained. Several different mechanisms appear to be important, depending on these different variables. The development of a mitotic recombination system in which virtually all cells can be induced to undergo recombination at the same time, from a defined DSB, now provides us with a way of exploring in greater detail the process of minisatellite repeat rearrangements.
| ACKNOWLEDGMENTS |
|---|
We thank T. Grange for critical reading of the manuscript and D. Higuet for statistical analysis. This work was supported by National Institutes of Health grant GM20056. F.P. was a fellow from the American Cancer Society.
Manuscript received December 12, 2000; Accepted for publication February 10, 2001.
| LITERATURE CITED |
|---|
APPELGREN, H., H. CEDERBERG, and U. RANNUG, 1997 Mutations at the human minisatellite MS32 integrated in yeast occur with high frequency in meiosis and involve complex recombination events. Mol. Gen. Genet. 256:7-17[Medline].
APPELGREN, H., H. CEDERBERG, and U. RANNUG, 1999 Meiotic interallelic conversion at the human minisatellite MS32 in yeast triggers recombination in several chromatids. Gene 239:29-38[Medline].
ARMOUR, J. A. and A. J. JEFFREYS, 1992 Biology and applications of human minisatellite loci. Curr. Opin. Genet. Dev. 2:850-856[Medline].
BALAKUMARAN, B. S., C. H. FREUDENREICH, and V. A. ZAKIAN, 2000 CGG/CCG repeats exhibit orientation-dependent instability and orientation-independent fragility in Saccharomyces cerevisiae. Hum. Mol. Genet. 9:93-100
BAUDAT, F., K. MANOVA, J. PUI YEN, M. JASIN, and S. KEENEY, 2000 Chromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11. Mol. Cell 6:989-998[Medline].
BERGERAT, A., B. DE MASSY, D. GADELLE, P. C. VAROUTAS, and A. NICOLAS et al., 1997 An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature 386:414-417[Medline].
BISHOP, A. J., E. J. LOUIS, and R. H. BORTS, 2000 Minisatellite variants generated in yeast meiosis involve DNA removal during gene conversion. Genetics 156:7-20
BORTS, R. H., W. Y. LEUNG, W. KRAMER, B. KRAMER, and M. WILLIAMSON et al., 1990 Mismatch repair-induced meiotic recombination requires the pms1 gene product. Genetics 124:573-584[Abstract].
BUARD, J. and A. J. JEFFREYS, 1997 Big, bad minisatellites. Nat. Genet. 15:327-328[Medline].
BUARD, J. and G. VERGNAUD, 1994 Complex recombination events at the hypermutable minisatellite CEB1 (D2S90). EMBO J. 13:3203-3210[Medline].
BUARD, J., A. BOURDET, J. YARDLEY, Y. DUBROVA, and A. J. JEFFREYS, 1998 Influences of array size and homogeneity on minisatellite mutation. EMBO J. 17:3495-3502[Medline].
CHAMBERS, S. R., N. HUNTER, E. J. LOUIS, and R. H. BORTS, 1996 The mismatch repair system reduces meiotic homeologous recombination and stimulates recombination-dependent chromosome loss. Mol. Cell. Biol. 16:6110-6120[Abstract].
CHEN, D. C., B. C. YANG, and T. T. KUO, 1992 One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].
CLIKEMAN, J. A., S. L. WHEELER, and J. A. NICKOLOFF, 2001 Efficient incorporation of large (>2 kb) heterologies into heteroduplex DNA: Pms1/Msh2-dependent and -independent large loop mismatch repair in Saccharomyces cerevisiae. Genetics 157:1481-1491
COLAIÁCOVO, M. P., F. PÂQUES, and J. E. HABER, 1999 Removal of nonhomologous DNA ends during gene conversion by a RAD1-, MSH2-independent pathway. Genetics 151:1409-1423
CORRELL, C. C., B. FREEBORN, P. B. MOORE, and T. A. STEITZ, 1997 Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain. Cell 91:705-712[Medline].
DATTA, A., A. ADJIRI, L. NEW, G. F. CROUSE, and R. S. JINKS, 1996 Mitotic crossovers between diverged sequences are regulated by mismatch repair proteins in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:1085-1093[Abstract].
DATTA, A., M. HENDRIX, M. LIPSITCH, and R. S. JINKS, 1997 Dual roles for DNA sequence identity and the mismatch repair system in the regulation of mitotic crossing-over in yeast. Proc. Natl. Acad. Sci. USA 94:9757-9762
DEBRAUWÈRE, H., J. BUARD, J. TESSIER, D. AUBERT, and G. VERGNAUD et al., 1999 Meiotic instability of human minisatellite CEB1 in yeast requires double-strand breaks. Nat. Genet. 23:367-371[Medline].
EVANS, E., N. SUGAWARA, J. E. HABER, and E. ALANI, 2000 The Saccharomyces cerevisiae Msh2 mismatch repair protein localizes to recombination intermediates in vivo. Mol. Cell 5:789-799[Medline].
FERGUSON, D. O. and W. K. HOLLOMAN, 1996 Recombinational repair of gaps in DNA is asymmetric in Ustilago maydis and can be explained by a migrating D-loop model. Proc. Natl. Acad. Sci. USA 93:5419-5424
FISHMAN-LOBELL, J. and J. E. HABER, 1992 Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1. Science 258:480-484
FREUDENREICH, C. H., J. B. STAVENHAGEN, and V. A. ZAKIAN, 1997 Stability of a CTG/CAG trinucleotide repeat in yeast is dependent on its orientation in the genome. Mol. Cell. Biol. 17:2090-2098[Abstract].
FU, Y. H., D. P. KUHL, A. PIZZUTI, M. PIERETTI, and J. S. SUTCLIFFE et al., 1991 Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell 67:1047-1058[Medline].
GACY, A. M., G. GOELLNER, N. JURANIC, S. MACURA, and C. T. MCMURRAY, 1995 Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell 81:533-540[Medline].
HEWETT, D. R., O. HANDT, L. HOBSON, M. MANGELSDORF, and H. J. EYRE et al., 1998 FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis. Mol. Cell 1:773-781[Medline].
HOLMES, A. M. and J. E. HABER, 1999 Double-strand break repair in yeast requires both leading and lagging strand DNA polymerases. Cell 96:415-424[Medline].
HOROWITZ, H. and J. E. HABER, 1984 Subtelomeric regions of yeast chromosome contain a 36 base-pair repeat sequence. Nucleic Acids Res. 12:7105-7121
IRELAND, M. J., S. S. REINKE, and D. M. LIVINGSTON, 2000 The impact of lagging strand replication mutations on the stability of CAG repeat tracts in yeast. Genetics 155:1657-1665
IVANOV, E. L. and J. E. HABER, 1995 RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:2245-2251[Abstract].
JEFFREYS, A. J., K. TAMAKI, A. MCLEOD, D. G. MONCKTON, and D. L. NEIL et al., 1994 Complex gene conversion events in germline mutation at human minisatellites. Nat. Genet. 6:136-145[Medline].
KEENEY, S., C. N. GIROUX, and N. KLECKNER, 1997 Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88:375-384[Medline].
KIRKPATRICK, D. T. and T. D. PETES, 1997 Repair of DNA loops involves DNA-mismatch and nucleotide-excision repair proteins. Nature 387:929-931[Medline].
KOLODNER, R. D. and G. T. MARSISCHKY, 1999 Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9:89-96[Medline].
LALIOTI, M. D., H. S. SCOTT, C. BURESI, C. ROSSIER, and A. BOTTANI et al., 1997 Dodecamer repeat expansion in cystatin B gene in progressive myoclonus epilepsy. Nature 386:847-851[Medline].
MALTER, H. E., J. C. IBER, R. WILLEMSEN, E. DE GRAAFF, and J. C. TARLETON et al., 1997 Characterization of the full fragile X syndrome mutation in fetal gametes. Nat. Genet. 15:165-169[Medline].
MAURER, D. J., B. L. O'CALLAGHAN, and D. M. LIVINGSTON, 1996 Orientation dependence of trinucleotide CAG repeat instability in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:6617-6622[Abstract].
MAY, C. A., A. J. JEFFREYS, and J. A. ARMOUR, 1996 Mutation rate heterogeneity and the generation of allele diversity at the human minisatellite MS205 (D16S309). Hum. Mol. Genet. 5:1823-1833
MCMURRAY, C. T., 1999 DNA secondary structure: a common and causative factor for expansion in human disease. Proc. Natl. Acad. Sci. USA 96:1823-1825
MOORE, J. K. and J. E. HABER, 1996 Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:2164-2173[Abstract].
PÂQUES, F. and J. E. HABER, 1997 Two pathways for removal of non-homologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Moll. Cell. Biol. 17:6765-6771[Abstract].
PÂQUES, F. and J. E. HABER, 1999 Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 63:349-404
PÂQUES, F. and M. WEGNEZ, 1993 Deletions and amplifications of tandemly arranged ribosomal 5S genes internal to a P element occur at a high rate in a dysgenic context. Genetics 135:469-476[Abstract].
PÂQUES, F., W.-Y. LEUNG, and J. E. HABER, 1998 Expansions and contractions in a tandem repeat induced by double-strand break repair. Mol. Cell. Biol. 18:2045-2054
RAYSSIGUIER, C., D. S. THALER, and M. RADMAN, 1989 The barrier to recombination between Escherichia coli and Salmonella typhimurium is disrupted in mismatch-repair mutants. Nature 342:396-401[Medline].
RICHARD, G.-F. and F. PÂQUES, 2000 Mini- and microsatellite expansions: the recombination connection. EMBO Rep. 1:122-126[Medline].
RICHARD, G.-F., B. DUJON, and J. HABER, 1999 High frequency of rearrangements of short CAG/CTG trinucleotide repeats in yeast induced by double-strand break repair. Mol. Gen. Genet. 261:871-882[Medline].
RICHARD, G.-F., G. M. GOELLNER, C. T. MCMURRAY, and J. E. HABER, 2000 Recombination-induced CAG trinucleotide repeat expansions in yeast involve the Mre11/Rad50/Xrs2 complex. EMBO J. 19:2381-2390[Medline].
RICHARDS, R. I. and G. R. SUTHERLAND, 1997 Dynamic mutation: possible mechanisms and significance in human disease. Trends Biochem. Sci. 22:432-436[Medline].
ROBINETT, C. C., A. STRAIGHT, G. LI, C. WILLHELM, and G. SUDLOW et al., 1996 In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J. Cell Biol. 135:1685-1700
ROMANIENKO, P. J. and R. D. CAMERINI-OTERO, 2000 The mouse Spo11 gene is required for meiotic chromosome synapsis. Mol. Cell 6:975-987.
SANDELL, L. L. and V. A. ZAKIAN, 1993 Loss of a yeast telomere: arrest, recovery, and chromosome loss. Cell 75:729-739[Medline].
SELVA, E. M., L. NEW, G. F. CROUSE, and R. S. LAHUE, 1995 Mismatch correction acts as a barrier to homeologous recombination in Saccharomyces cerevisiae. Genetics 139:1175-1188[Abstract].
SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Methods in Yeast Genetics: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SUGAWARA, N., F. PÂQUES, M. COLAIACOVO, and J. H. HABER, 1997 Role of Saccharomyces cerevisiae Msh2 and Msh3 repair proteins in double-strand break-induced recombination. Proc. Natl. Acad. Sci. USA 94:9214-9219
SUGAWARA, N., G. IRA, and J. E. HABER, 2000 DNA length dependence of the single-strand annealing pathway and the role of Saccharomyces cerevisiae RAD59 in double-strand break repair. Mol. Cell. Biol. 20:5300-5309
VERGNAUD, G., D. MARIAT, F. APIOU, A. AURIAS, and M. LATHROP et al., 1991 The use of synthetic tandem repeats to isolate new VNTR loci: cloning of a human hypermutable sequence. Genomics 11:135-144[Medline].
VIRTANEVA, K., E. D'AMATO, J. MIAO, M. KOSKINIEMI, and R. NORIO et al., 1997 Unstable minisatellite expansion causing recessively inherited myoclonus epilepsy, EPM1. Nat. Genet. 15:393-396[Medline].
WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994 New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[Medline].
WELCH, J. W., D. H. MALONEY, and S. FOGEL, 1990 Unequal crossing-over and gene conversion at the amplified CUP1 locus of yeast. Mol. Gen. Genet. 222:304-310[Medline].
WELCH, J. W., D. H. MALONEY, and S. FOGEL, 1991 Gene conversions within the Cup1r region from heterologous crosses in Saccharomyces cerevisiae. Mol. Gen. Genet. 229:261-266[Medline].
YU, A. and M. MITAS, 1995 The purine-rich trinucleotide repeat sequences d(CAG)15 and d(GAC)15 form hairpins. Nucleic Acids Res. 23:4055-4057
YU, S., M. MANGELSDORF, D. HEWETT, L. HOBSON, and E. BAKER et al., 1997 Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat. Cell 88:367-374[Medline].
This article has been cited by other articles:
![]() |



