Genetics, Vol. 157, 1723-1733, April 2001, Copyright © 2001

Regulation of Activator/Dissociation Transposition by Replication and DNA Methylation

Francesca Rosa and Reinhard Kunzea
a Institut für Genetik und Mikrobiologie, Universität München, 80638 Munich, Germany

Corresponding author: Reinhard Kunze, Botanisches Institut II, Universität zu Köln, Gyrhofstrasse 15, 50931 Cologne, Germany., reinhard.kunze{at}uni-koeln.de (E-mail)

Communicating editor: V. SUNDARESAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

In maize the transposable elements Activator/Dissociation (Ac/Ds) transpose shortly after replication from one of the two resulting chromatids ("chromatid selectivity"). A model has been suggested that explains this phenomenon as a consequence of different affinity for Ac transposase binding to holo-, hemi-, and unmethylated transposon ends. Here we demonstrate that in petunia cells a holomethylated Ds is unable to excise from a nonreplicating vector and that replication restores excision. A Ds element hemi-methylated on one DNA strand transposes in the absence of replication, whereas hemi-methylation of the complementary strand causes a >6.3-fold inhibition of Ds excision. Consistently in the active hemi-methylated state, the Ds ends have a high binding affinity for the transposase, whereas binding to inactive ends is strongly reduced. These results provide strong evidence for the above-mentioned model. Moreover, in the absence of DNA methylation, replication enhances Ds transposition in petunia protoplasts >8-fold and promotes formation of a predominant excision footprint. Accordingly, replication also has a methylation-independent regulatory effect on transposition.


THE maize transposable element Activator (Ac) is the prototype element of the class of "hAT" eukaryotic transposons. These elements are characterized by common conserved transposase segments including a unique signature motif (CALVI et al. 1991 Down; FELDMAR and KUNZE 1991 Down; ESSERS et al. 2000 Down) and similar terminal inverted repeats (reviewed in KUNZE 1996 Down). The hAT elements transpose conservatively by a cut-and-paste mechanism and supposedly use the same transposition mechanism.

In the maize sporophyte Ac transposes predominantly during or shortly after replication, and only one of the two resulting daughter elements is transposition competent (chromatid selectivity; GREENBLATT and BRINK 1963 Down; GREENBLATT 1984 Down; CHEN et al. 1987 Down, CHEN et al. 1992 Down). In these properties Ac closely resembles the bacterial IS10 element, where differential binding of the IS10 transposase to hemi- and holomethylated transposon ends mediates these effects (ROBERTS et al. 1985 Down). In maize kernels, the Ac TPase binding sites in the subterminal regions of Ac and Dissociation (Ds) elements are heavily C-methylated, and the TPase protein binds in vitro with different affinities to holo-, hemi-, and unmethylated target DNA (KUNZE and STARLINGER 1989 Down; WANG et al. 1996 Down; WANG and KUNZE 1998 Down). On the basis of these findings a model has been proposed according to which DNA methylation of the transposon ends is responsible for the replication dependence and chromatid selectivity of transposition (FEDOROFF 1989 Down; WANG et al. 1996 Down).

However, DNA methylation-mediated replication dependence cannot completely explain the behavior of Ac/Ds transposition. In several studies it was found that in a transient assay Ac/Ds element excision from extrachromosomal geminivirus vectors in maize, barley, wheat, and rice cells is dependent on vector replication, although the transfected DNAs were not C-methylated (LAUFS et al. 1990 Down; MCELROY et al. 1997 Down; WIRTZ et al. 1997 Down). In contrast, Ds is able to excise from nonreplicating plasmids in petunia, parsley, and Nicotiana plumbaginifolia cells (HOUBA-HERIN et al. 1990 Down, HOUBA-HERIN et al. 1994 Down; R. LÜTTICKE and R. KUNZE, unpublished results).

In this article we studied the correlation between Ds transposition in petunia cells and DNA replication by use of a replicon sequence derived from the genome of the monopartite geminivirus tomato yellow leaf curl virus (TYLCV; KHEYR-POUR et al. 1992 Down). This family of geminiviruses infects a variety of dicotyledonous hosts. TYLCV contains two divergently transcribed gene clusters that are separated by an intergenic region (IR). The IR contains the DNA-binding site for the Rep protein, the origin of replication, and eukaryotic promoter signals (FONTES et al. 1994 Down). Except for the Rep protein that catalyzes cleavage and joining at the viral origin of replication (LAUFS et al. 1995 Down), geminivirus DNA synthesis relies entirely on the DNA replication apparatus of the host plant, although host cell division does not appear to be a prerequisite for geminiviral DNA replication (NAGAR et al. 1995 Down).

We show that transposition of a Ds element from an extrachromosomal vector in petunia cells is regulated by DNA replication in a methylation-dependent and independent mode. Holomethylation completely inhibits Ds excision from a nonreplicating plasmid, whereas Ds transposition is restored by replication. Moreover, Ds elements that are hemi-methylated on one DNA strand transpose in the absence of replication, whereas methylation on the complementary DNA strand results in at least 6.3-fold reduced excision frequencies. These data strongly support the transposition model of WANG et al. 1996 Down. Beyond that, Ds transposition also is strongly promoted by replication in the absence of methylation.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Plasmid constructs:
pMiDsf1 and pMiDs<f1 were derived from pNT150Ds (BECKER et al. 1992 Down) by replacement of the Ds with a smaller Ds element that consists of the 246 5'-terminal and the 446 3'-terminal Ac residues (CHATTERJEE and STARLINGER 1995 Down). Between the ß-glucuronidase (GUS) and the ampicillin resistance genes the M13 f1 origin was inserted as a 414-bp BglII-SspI fragment from pT7T3 in the (+) (pMiDsf1) or (-) (pMiDs<f1) orientation, respectively. In pMiDsf1-RI the luciferase gene of pMiDsf1 was replaced with the cis- and trans-acting TYLCV replication sequences from pTYSst14 (KHEYR-POUR et al. 1992 Down; details of the construct are provided upon request). In pMiDsf1-rI the C1 gene (Rep) was mutated by inverting a BstI107I/PflMI fragment. In pMiDsf1-R, a PflMI/NcoI fragment corresponding to the TYLCV replicon cis-acting IR was deleted.

Ds excision assay in petunia protoplasts and DNA extraction:
Transpositional activity of Ds reporter plasmids in petunia cells was assessed as described by HOUBA-HERIN et al. 1990 Down and HEINLEIN et al. 1994 Down. Briefly, sterile shoot cultures of Petunia hybrida ssp.RL01 x ssp.Blue were grown in Gamborg's B5 medium (basal salts mixture) at 26° under a 16-hr light/8-hr dark cycle. Mesophyll protoplasts from 3- to 5-wk-old shoots were cotransfected with the TPase expression plasmid pNT600-10.ATG and a Ds excision reporter plasmid. Two aliquots of the transfected protoplasts were plated on nitrocellulose filters for GUS staining; the remaining cells were sedimented by centrifugation and DNA was extracted by using the DNeasy Plant mini kit (QIAGEN, Hilden, Germany).

Preparation of holo- and hemi-methylated reporter plasmids:
To generate holomethylated plasmids, pMiDsf1 and pMiDsf1-RI were treated with M-SssI (New England Biolabs, Beverly, MA) for 16 hr at 37° as recommended by the manufacturer. After phenol extraction, the completeness of the reaction was confirmed by HpaII and BsiEI digestion. The mock-methylated plasmids were prepared under the same conditions except for the presence of M-SssI.

The preparation of locally hemi-methylated plasmid DNA is depicted in Fig 5. Phagemid single-stranded DNA was isolated from pMiDsf1, pMiDs<1f, and pMiDsf1-RI as described by SAMBROOK et al. 1989 Down. Amplification of the Ds element was carried out using primers Ds2 (GACCCAGGGATGAAAGTAGGATGGGAAAATCC) and Ds3 (CGGTCGGTAACGGTCGGTAAAATACCTCTA) on pMiDsf1 as a template and with one primer being biotinylated at the 5' end. The PCR cocktail (50 µl) contained 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.1 mg/ml nuclease-free BSA, 0.2 mM of each dNTP (with dCTP facultatively replaced by 5mdCTP), 0.2 µM of each primer, 10 ng of plasmid template, and 1.25 units of Pfu DNA polymerase (Stratagene, La Jolla, CA). After 5 min of initial denaturation at 95°, 30 cycles of amplification were carried out (94°, 30 sec; 55°, 30 sec; 72°, 1:55 min), followed by a final 5-min extension at 72°. The methylated single-stranded Ds element was prepared by adsorption of the biotinylated PCR product (50 µl) to 0.7 mg streptavidin-conjugated magnetic beads (Merck, Darmstadt, Germany) in 10 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, and 1 M NaCl for 30 min at room temperature, followed by elution of the nonbiotinylated DNA strand in 0.1 N NaOH for 8 min at room temperature. The eluate was neutralized by adding 0.5 volume of 0.2 M HCl, 77 mM Tris-HCl (pH 8).



View larger version (29K):
In this window
In a new window
Download PPT slide
 
Figure 1. The TYLCV Rep protein and replication origin are active in petunia protoplasts. (A) Structure of the reporter plasmids pMiDsf1 and pMiDsf1-RI. In both plasmids a nonautonomous Ds transposon blocks expression of the GUS gene. In pMiDsf1-RI the C1 gene for the TYLCV replication initiator protein (Rep) and the origin of viral-strand DNA replication IR replace a deleted, nonfunctional fragment of the Luciferase gene in pMiDsf1. The arrowheads indicate the T-DNA 1'–2' promoter and a TYLCV promoter. The hatched bar below pMiDsf1-RI denotes the 1024-bp MboI fragment used as a hybridization probe on the gel blots shown below. (B) DNA isolated from petunia protoplasts at different time points after cotransfection with the TPase expression plasmid pNT600-10.ATG (7.8 kb) and pMiDsf1-RI (lanes 2–4) or pMiDsf1 (lanes 5–7) was digested with the dam methylation-sensitive enzyme MboI, electrophoresed, blotted, and hybridized with the probe shown in A, which hybridizes with the same MboI fragment in all reporter plasmids. Lane 1, unlabeled probe fragment (K). oc, undigested, open circle forms of TPase expression plasmid and reporter plasmid; sc, undigested, supercoiled TPase expression and reporter plasmid; ex, 1-kb MboI digestion product of the reporter plasmid. (C) Gel blot analysis of DNA isolated from petunia protoplasts cotransfected with pNT600-10.ATG and pMiDsf1-RI or the replication-deficient mutants pMiDsf1-rI (8.7 kb) or pMiDsf1-R (8.4 kb), respectively. The DNA was digested with MboI and ScaI, electrophoresed, blotted, and hybridized with the probe shown in A. li, linearized TPase expression and Ds reporter plasmids.



View larger version (37K):
In this window
In a new window
Download PPT slide
 
Figure 2. Replication enhances Ds excision. (A) Schematic of the restriction and gel blot hybridization analysis. DNA was isolated from petunia protoplasts cotransfected with the TPase expression plasmid pNT600-10.ATG and pMiDsf1-RI or pMiDsf1, digested with AseI, and analyzed by gel blot hybridization. The probe (p) hybridizes equally well with the 2.8-kb pMiDsf1(-RI) vector fragment, the 1.8-kb fragment containing the Ds, and the 1.1-kb fragment resulting from Ds excision. (B) Gel blots of AseI-digested pNT600-10.ATG, pMiDsf1-RI, and pMiDsf1 plasmid DNA as controls (lanes 1 to 3) and DNA from petunia protoplasts cotransfected with pNT600-10.ATG and pMiDsf1-RI or pMiDsf1 (lanes 4 and 5). {alpha}, ratio of 2.8-kb vector bands in lanes 4 and 5; ß, ratio of 1.1-kb Ds excision bands in lanes 4 and 5.



View larger version (47K):
In this window
In a new window
Download PPT slide
 
Figure 3. Transposon footprints after Ds excision. (A) Footprints from the replicating pMiDsf1-RI plasmid. (B) Footprints from the nonreplicating pMiDsf1 plasmid. The top lines show the sequence at the Ds insertion site. Lines below show empty donor site sequences of Ds excision events. The numbers to the left indicate the frequency of each excision footprint.



View larger version (68K):
In this window
In a new window
Download PPT slide
 
Figure 4. Methylation inhibits transposition of a Ds element. (A) Methylation does not impede replication of plasmids. DNA was isolated from petunia protoplasts 30 hr after cotransfection with TPase expression plasmid pNT600-10. ATG and unmethylated (lanes 1 and 3) or methylated (lanes 2 and 4) pMiDsf1-RI or pMiDsf1, digested with the dam methylation-sensitive enzyme MboI, electrophoresed, blotted, and hybridized with the probe shown in Fig 1A. oc, undigested, open circle forms of pNT600-10.ATG and the reporter plasmid; sc, undigested, supercoiled pNT600-10.ATG and reporter plasmid; ex, 1024-bp MboI digestion fragment from the reporter plasmid. (B) PCR analysis of Ds excision from methylated and unmethylated pMiDsf1 and pMiDsf1-RI. DNA extracted from protoplasts 30 hr after transfection was supplemented with ~1 pg pNT150 and subjected to PCR using Ds-flanking primers. The PCR products were analyzed by gel blot hybridization using the 0.25-kb PCR product from pNT150 that spans the Ds insertion site as probe. s, Ds-containing donor fragment; x, empty donor site after Ds excision; c, amplified pNT150 fragment as internal control.



View larger version (15K):
In this window
In a new window
Download PPT slide
 
Figure 5. Preparation of locally hemi-methylated reporter plasmids. (1) Isolation of single-stranded phagemid DNA; (2) PCR amplification of the Ds element in the presence of 5mdCTP and one biotinylated primer; (3) phosphorylation of the Ds PCR product and adsorption to streptavidin-conjugated magnetic beads; (4) elution of a methylated Ds single strand by NaOH treatment; (5) hybridization of the methylated Ds single strand to the single-stranded phagemid; (6) filling in of the residual phagemid sequences by Pfu polymerase; (7) closure of the remaining nick by treatment with T4 DNA Ligase.

Single-stranded methylated Ds element was annealed to single-stranded phagemid DNA at a molar ratio 1:1 in 50 mM NaCl, 10 mM Tris-HCl (pH 8), and 5 mM EDTA by heating for 3 min at 95° and allowing to cool down to 25° over 2 hr. The hybridization product was purified by gel filtration in Sephacryl micro spin columns (Amersham-Pharmacia, Freiburg, Germany).

Approximately 60 ng of hybridization product was filled in at 72° for 1 hr, in a 50-µl reaction mixture containing 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.1 mg/ml nuclease-free BSA, 0.05 mM of each dNTP, and 1.25 units of Pfu DNA polymerase (Stratagene). The product was purified by gel filtration, and the remaining nick was closed by treatment with 2 units T4 DNA Ligase (Roche Biochemicals, Basel, Switzerland) overnight at 16° in a final volume of 50 µl. Each ligation contained ~0.3 µg of DNA. Before transfection into petunia protoplasts the constructs were extracted with phenol and purified by ethanol precipitation.

Determination of Ds excision frequency and isolation of excision footprints by PCR:
Total DNA was prepared twice from four independent batches of protoplasts that were cotransfected with pNT600-10.ATG and pMiDsf1 or pMiDsf1-RI, respectively. On each DNA preparation two to four PCRs were performed, and the products were ligated into pCR2.1-Topo (Invitrogen, San Diego) and transformed into Escherichia coli. For each transformation, the plasmid inserts from 7 to 18 colonies were sequenced. To amplify the empty Ds donor site (300-bp excision product), PCRs were performed on 150 ng DNA using primers Pr_1 (GGATACTTACGTCACGTCTTGCGCACTGAT) and Pr_2 (CCACAGTTTTCGCGATCCAGACTGAA). The reaction mixture (50 µl) contained 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.4 µM of each primer, and 2.5 units Taq DNA polymerase.

Amplification was carried out by incubating for 5 min at 94°, followed by 25 cycles of 94°, 30 sec/60°, 20 sec, and one final step of 5 min at 72°. With the same primer pair a 250-bp fragment was coamplified from plasmid pNT150, which lacks the Ds insertion and which was added (1 pg) as a control to each reaction tube.

Sixty-five excision footprints each from pMiDsf1 and pMiDsf1-RI, originating from 20 independent PCR reactions and four transfection assays, were cloned into pCR2.1-TOPO (Invitrogen) and sequenced.

DNA analysis by gel blot hybridization:
For gel blot analyses DNA was size fractionated by 1% agarose gel electrophoresis and transferred to positively charged nylon membranes (Hybond-N+). Hybridization and washing were done using standard conditions (SAMBROOK et al. 1989 Down). Probes were labeled by random priming using [{alpha}-32P]dCTP.

Gel retardation assays:
Gel retardation assays were performed using renatured TPase103-465 essentially as described (FELDMAR and KUNZE 1991 Down; BECKER and KUNZE 1997 Down). Target DNAs (Fig 6A) were prepared as follows: unmethylated and holomethylated Ds ends were prepared by PCR amplification of the complete miniDs in the presence of dCTP or 5mdCTP, respectively, and digestion of the product with DraI, yielding a 0.3-kb 5' end fragment and a 0.4-kb 3' end fragment.



View larger version (37K):
In this window
In a new window
Download PPT slide
 
Figure 6. Gel mobility shift assay of TPase binding to differentially methylated Ds end fragments. (A) Schematic of the Ds ends. The Ds 5' and 3' ends comprise 250 bp and 200 bp of the transposon termini, respectively. The three 5' end segments I, II, and III correspond to positions 30–96, 106–158, and 168–242 on the Ac sequence. The distribution of TPase binding sites (open triangles) is drawn approximately to scale. (B) Gel mobility shift assays with the Ds end fragments in different methylation states and the TPase103-465 protein. u, unmethylated; M, holomethylated; bm, bottom strand methylated; tm, top strand methylated. The diffuse appearance is characteristic of TPase/DNA complexes and is caused by the presence of heterogeneous TPase oligomers in the protein preparation. Free probe DNA migrates at the bottom of the gels. (C) Model for the methylation-dependent TPase binding to the Ds 3' end and 5' end fragments. Shown is the proposed occupation of the Ds terminal fragments with TPase dependent on the methylation state, according to the gel shift assays shown in B and binding studies with synthetic target site oligomers (KUNZE and STARLINGER 1989 Down; BECKER and KUNZE 1997 Down). More than one transposase molecule is depicted per binding site, according to the strong cooperativity of the TPase binding to its target sites observed by BECKER and KUNZE 1997 Down. The four different methylation states are designated at left as in B. The transposition competence of the respective hemi-methylated transposons is indicated at the right.

Hemi-methylated Ds ends were prepared by hybridization of methylated and unmethylated single-stranded Ds DNAs, followed by DraI digestion of the hybridization products. Methylated and unmethylated single-stranded Ds DNAs were prepared as described in Fig 5, steps two to four, except that 5mdCTP or dCTP were included in the PCR reaction mixture. The fragments were radiolabeled by 5' phosphorylation using [{gamma}-32P]ATP and T4 kinase. The 5' end segments I, II, and III were generated by combinatorial hybridization of complementary methylated or unmethylated radiolabeled oligonucleotides.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Replication promotes Ds excision:
In monocots it was found that excision of Ds elements from geminivirus vectors requires replication (LAUFS et al. 1990 Down; MCELROY et al. 1997 Down; WIRTZ et al. 1997 Down). In contrast, in three dicot species Ds transposes from plasmids that supposedly do not replicate in the plant cells (BECKER et al. 1992 Down; KUNZE et al. 1993 Down). To determine whether in dicots replication has an influence on Ds excision, we constructed a set of novel reporter plasmids and controls. pMiDsf1 carries a uidA (GUS) gene whose expression is blocked by a miniDs transposon (Fig 1A). pMiDsf1-RI carries in addition the cis- and trans-acting replication sequences from TYLCV (KHEYR-POUR et al. 1992 Down). This virus is capable of propagating in various solanaceaeous species (B. GRONENBORN, personal communication).

The replication activity of each construct in petunia cells was tested by cotransfecting protoplasts with a TPase expression plasmid and Dam-methylated reporter plasmid DNA. At different time points after transfection DNA was reisolated, subjected to MboI digestion, and analyzed by gel blotting. Plasmid DNA propagated in Dam+ bacteria is resistant to MboI, whereas replication in plant cells leads to MboI sensitivity due to the loss of Dam methylation. The reisolated pMiDsf1 DNA is resistant to MboI digestion, indicating that the plasmid does not replicate in the plant cells (Fig 1B, lanes 5–7). In contrast, MboI releases increasing amounts of the 1024-bp digestion fragment from pMiDsf1-RI DNA isolated 30 and 60 hr after transfection (Fig 1B, lanes 2–4). To ensure that the replication activity of pMiDsf1-RI depends on the functionality of the viral replicon, we tested two plasmids with defects in the cis- and trans-acting TYLCV replication sequences, respectively. In pMiDsf1-rI the C1 gene encoding the trans-acting Rep protein is destroyed, and in pMiDsf1-R the intergenic region, containing the promoter and the Rep protein binding sites (IR), is deleted. Both control plasmids are unable to replicate in the plant cells (Fig 1C, lanes 2–3).

Ds excision from the reporter plasmids is accompanied by reversion to GUS activity. Petunia protoplasts cotransfected with a TPase expression plasmid and pMiDsf1, pMiDsf1-RI, pMiDsf1-rI, or pMiDsf1-R, respectively, were spread on filters, stained, and inspected for frequency and staining intensity of GUS-positive (blue) cells. No Ds excision is detectable 5 min after transfection. Thirty hours after transfection Ds excision is observed with all four plasmids (Table 1). This confirms that in petunia Ds is able to transpose in the absence of replication. Remarkably, the frequency of blue staining cells with the replicating plasmid pMiDsf1-RI is two to three times higher compared to the three nonreplicating plasmids, and the staining intensity of the protoplasts is significantly higher (data not shown).


 
View this table:
In this window
In a new window

 
Table 1. Ds excision events of replicating and nonreplicating Ds elements in petunia protoplasts

The GUS assay allows no distinction regarding whether these two effects result from an increase in Ds excision frequency or from replicative amplification of plasmids before and after Ds excision. We therefore performed a quantitative gel blot hybridization analysis. DNA from protoplasts was digested with AseI, blotted, and hybridized with a probe that detects three fragments: a 2807-bp vector fragment whose abundance reflects the total amount of plasmid, a 1798-bp fragment from plasmids that still contain the Ds, and a 1089-bp fragment from plasmids where Ds has been excised (Fig 2A). The ratio {alpha} of the 2807-bp band intensities between pMiDsf1- (lane 4) and pMiDsf1-RI-transfected cells (lane 5) reflects the overall difference in plasmid content due to replication ("copy number effect") times aliquot size. The ratio of the 1089-bp band intensities (ß) corresponds to the product of copy number effect times change in excision frequency times aliquot size. The ratio {alpha}/ß indicates the factor by which the Ds excision frequency is enhanced (or reduced) by replication of the reporter plasmid pMiDsf1-RI. Quantification of the respective bands (Fig 2B; upon overexposure, the Ds excision band in lane 5 becomes visible as a faint signal) led to the conclusion that the Ds excision frequency in petunia cells is promoted at least eightfold by replication of the host plasmid.

To determine whether the reduced Ds excision frequency from the nonreplicating host plasmid correlates with de novo methylation in the petunia cells of the Ds and/or the whole plasmid, DNA was isolated from the cells 30 hr after transfection, digested with the methylation-sensitive enzyme BsiEI, and analyzed by gel blot hybridization. No de novo methylation of any BsiEI sites in the Ds or the flanking plasmid sequences was detected (data not shown).

Transposon footprint formation is influenced by replication:
Excision of Ac and Ds elements is associated with the formation of characteristic transposon "footprints" that are the products of DNA end joining and repair reactions. We wanted to investigate whether excision footprint formation is also influenced by replication. Using standard conditions, the Ds excision products from nonreplicating plasmids were not detectable by gel blot hybridization or by PCR. We therefore developed optimized reaction conditions that allow the selective amplification of rare excision site sequences among a large excess of "wild-type" plasmids (see MATERIALS AND METHODS).

Sixty-five footprints were amplified, cloned, and sequenced from the replicating and the nonreplicating reporter plasmids, respectively (Fig 3). The sampling strategy for the clones assures that these sequences are derived from independent plasmid molecules (see MATERIALS AND METHODS). However, we cannot exclude the possibility that individual excision products were preferentially amplified in the protoplasts by postexcisional plasmid replication. In the presence of replication, one predominant footprint ("gc") is formed in 84% of excision events, 8% contain a second type ("g"), and 8% of footprints have individual sequences (Fig 3A). The gc and g footprints dominate with frequencies of 51 and 15% also in the absence of replication; however, the frequency of deviating and individual footprints is almost fivefold higher (34%; Fig 3B). If we assume that most of the analyzed products are derived from independent excision reactions, these data suggest that replication not only facilitates transposon excision but also has an influence on excision site repair. Possibly, the efficiency and fidelity of the reactions leading to the formation of the predominant footprints are enhanced.

Methylation of Ds inhibits transposition:
Genetic and molecular experiments led to the hypothesis that in maize the DNA methylation status of Ac/Ds elements determines their transpositional competence (FEDOROFF 1989 Down; KUNZE and STARLINGER 1989 Down; WANG et al. 1996 Down; WANG and KUNZE 1998 Down). However, the studies of Ac/Ds transposition from geminivirus vectors in monocots and our results in this study suggest that replication can regulate transposition in the absence of methylated cytosines.

We therefore directly tested the effects of Ds methylation in the presence and absence of replication. According to the proposed model, C-methylation of TPase binding sites on both DNA strands should inhibit transposition in the absence of replication. pMiDsf1 and pMiDsf1-RI plasmids, isolated from Dam+ bacteria, were treated with M-SssI that converts all cytosine residues in CpG motifs to 5mC. In Ac/Ds elements almost all CpG motifs are located in the cis-acting terminal regions that include the subterminal TPase binding sites (KUNZE et al. 1988 Down; KUNZE and STARLINGER 1989 Down). Petunia protoplasts were transfected with the methylated and, as controls, mock-methylated plasmids. Restriction analysis with MboI of DNA reisolated from the cells showed that exclusively in pMiDsf1-RI the MboI sites become Dam-demethylated (Fig 4A, lanes 1–2), thus showing that C-methylation does not significantly affect the replication activity of pMiDsf1-RI. This conclusion is corroborated by the observation that the frequency of GUS-positive petunia cells, indicating Ds excision, is similarly high after transfection with untreated, mock-methylated, and methylated pMiDsf1-RI (data not shown).

To determine whether Ds is able to excise from methylated pMiDsf1 a PCR analysis was performed [the GUS reversion assay is not suitable here because methylation by M-SssI inactivates the GUS gene (data not shown)]. A PCR primer pair was used that coamplifies the empty Ds donor site (0.3-kb excision product; Fig 4B, x), the Ds-containing donor site (1-kb product; Fig 4B, s), and a 250-bp fragment from plasmid pNT150, which lacks the Ds insertion in the GUS gene and was added as a control in transfections with pMiDsf1 (Fig 4B, Fig C). Because Ds excises only in a small fraction of the transfected plasmids and thus in the reaction the rare empty donor sites have to compete against a large excess of Ds-containing donor sites, a PCR cycle was chosen that conditions underrepresentation of the donor site among the PCR products (see MATERIALS AND METHODS). PCR products were visualized by gel blot hybridization and quantified. In contrast to the unmethylated plasmid (Fig 4B, lane 2), with methylated pMiDsf1 no empty donor site is detectable (lane 1). With the replicating pMiDsf1-RI the empty donor site signals from methylated and unmethylated plasmids are similar (Fig 4B, lanes 3–4). In summary, these results prove that C-methylation of a Ds element severely inhibits transposition and that this inhibition is overcome by replication.

Hemi-methylation determines the transposition competence of Ds elements:
It has been suggested that the chromatid selectivity of Ac/Ds transposition is caused by differential transposition competence of the two transiently hemi-methylated daughter elements resulting from replication of a holomethylated element (WANG et al. 1996 Down). To scrutinize this hypothesis we generated two modified derivatives of the replication-deficient pMiDsf1 DNA, in which only the bottom or the top strand of the Ds element, but not the flanking plasmid sequences, were C-methylated. Briefly, phagemid single-stranded DNA was isolated from pMiDsf1 and pMiDs<1f (which carries the M13 f1 origin in opposite orientation from pMiDsf1) and hybridized with the respective complementary, C-methylated or unmethylated Ds DNA strand. The residual single-stranded plasmid sequences were filled in and the remaining nick was closed by T4 ligase (Fig 5 and MATERIALS AND METHODS). The completeness of the polymerase filling-in reaction and hemi-methylation of the Ds element were confirmed by restriction analysis (data not shown). The hemi-methylated and mock-hemi-methylated plasmids were transfected into petunia protoplasts and after 30 hr the cells were plated and stained for GUS activity.

The results of three independent experiments are shown in Table 2. The Ds element that is hemi-methylated on the top strand (pMiDs<f1-hemi) achieves on average a 6.3-fold higher number of GUS-positive cells than the bottom-strand-methylated Ds (pMiDsf1-hemi). The apparent excision frequency of the top-strand-methylated Ds is as high as that of the mock-hemi-methylated Ds (pMiDsf1-mock). These results corroborate the proposed model, and they prove that the top-strand-hemi-methylated Ds is fully transposition competent, whereas C-methylation on the bottom strand severely inhibits transposition. Additional evidence that the C-methylation is responsible for the inactivity of pMiDsf1-hemi was gained by showing that replication completely restores the transposition competence of a bottom-strand-methylated transposon, pMiDsf1-RI-hemi (Table 1).


 
View this table:
In this window
In a new window

 
Table 2. Transposition competence of hemi-methylated Ds elements in petunia protoplasts

TPase binding to transposition-competent and -incompetent Ds elements:
Ac/Ds elements contain multiple short TPase binding motifs in both ends that contain a 5'-CCG-3' sequence (Fig 6A; KUNZE and STARLINGER 1989 Down; BECKER and KUNZE 1997 Down). DNA-binding studies with synthetic oligomers of these motifs have shown that in vitro the Ac TPase protein binds selectively to such sites that are hemi-methylated on the top strand (5'-mCmCG-3'/5'-CGG-3'), whereas a 5-methylcytosine on the bottom strand (5'-CCG-3'/5'-mCGG-3') inhibits TPase binding (KUNZE and STARLINGER 1989 Down).

To this end it remained an open question whether TPase binding affinity to these synthetic, hemi-methylated concatemers reflects the binding properties to hemi-methylated transposon ends (i.e., the TPase binding motifs in their native sequence environment). We therefore analyzed the in vitro TPase binding reaction to hemi-methylated, transposition-competent or -incompetent Ds ends. We separately synthesized the complete Ds 5' and 3' ends and the three TPase binding site clusters I, II, and III from the 5' end (Fig 6A) in the unmethylated ("u"), holomethylated ("M"), and both alternate hemi-methylated states ("tm" and "bm") and determined their in vitro binding affinities to a TPase103-465 protein fragment by gel shift assays (Fig 6B). TPase103-465 is an N- and C-terminally truncated Ac TPase protein containing the complete bipartite DNA-binding domain (BECKER and KUNZE 1997 Down). The binding properties of TPase103-465 to synthetic binding sites and the transposon ends resemble those of the wild-type TPase (FELDMAR and KUNZE 1991 Down), but owing to the lack of a dimerization domain it has a reduced tendency to aggregate and precipitate (ESSERS et al. 2000 Down). Because this TPase fragment still contains a multimerization domain (R. ADOLPHS and R. KUNZE, unpublished results), it forms—as the wild-type protein—in solution oligomers of variable sizes and thus the protein/DNA complexes appear as a broad, diffuse band (KUNZE and STARLINGER 1989 Down; FELDMAR and KUNZE 1991 Down; BECKER and KUNZE 1997 Down).

TPase binds efficiently to the unmethylated Ds 3' end (Fig 6B, lane 20). Remarkably, TPase affinity is even increased when the 3' end fragment is hemi-methylated on the top strand (Fig 6B, lane 19). This is the transposition-competent state (Table 2). In that hemi-methylation state, 12 out of 14 subterminal TPase binding site motifs are in the 5'-mCmCG-3'/5'-CGG-3' configuration and therefore presumably able to bind TPase protein (Fig 6C, tm). In the alternate hemi-methylation state, which correlates with very low transposition activity, the 3' end is only weakly bound (Fig 6B, lane 18). This is in accordance with the assumption that in this state TPase can recognize only two widely separated TPase binding site motifs (Fig 6C, bm). If the 3' end is methylated on both strands, it is bound by TPase only in traces (Fig 6B, lane 17).

At the 5' end the situation is different. As is the case at the 3' end, holomethylation prevents TPase binding (Fig 6B, lane 1). However, both alternatively hemi-methylated 5' ends are bound similarly well (lanes 2–3), a little less efficiently than the unmethylated 5' end (lane 4). The 5' end central cluster II has opposite orientations of TPase binding sites relative to clusters I and III. We therefore individually tested the occupation of each of these clusters with TPase. In the unmethylated state, clusters I and II are moderately well bound (lanes 8 and 12), and cluster III is more efficiently complexed (lane 16). Methylation on both DNA strands completely inhibits TPase binding to all three fragments (lanes 5, 9, and 13). The terminal cluster I is most efficiently bound in the transpositionally competent, top-strand-hemi-methylated state (lane 7). The innermost cluster III is also recognized in this state (lane 15), whereas the central cluster II is not bound at all (lane 11). In the transpositionally inactive, bottom-strand-hemi-methylated state the 5' terminal cluster I is not recognized by TPase (lane 6), whereas cluster II is efficiently bound (lane 10) and cluster III is weakly complexed (lane14).

These experiments demonstrate that hemi-methylation of the subterminal TPase binding sites is a cis-acting determinant of transposase binding that correlates with transposition activity of Ds elements. In the active state, both Ds ends have a high affinity for the Ac TPase protein, whereas the inactive state correlates with much reduced TPase binding to the 3' end and to the terminal 5' end TPase binding site cluster I. Fig 6C shows a model of the occupation of the Ds terminal fragments with TPase molecules dependent on the methylation state, according to the gel shift assays shown in Fig 6B and binding studies with synthetic target site oligomers (KUNZE and STARLINGER 1989 Down; BECKER and KUNZE 1997 Down). Because in vitro the TPase readily forms heterogeneous oligomers in the absence of DNA (R. ADOLPHS and R. KUNZE, unpublished results) and binds to DNA in a cooperative manner (FELDMAR and KUNZE 1991 Down), the protein presumably does not occupy the binding sites in the transposon end with a 1:1 stoichiometry. The in vitro TPase/DNA interactions are more compatible with a model where the protein coats the transposon ends completely or in patches as depicted in Fig 6C.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The replication dependence of Ac/Ds transposition is more pronounced in monocots than dicots:
Using four different monocot species (maize, rice, wheat, and barley) it was found that excision of Ac/Ds elements from extrachromosomal, nonreplicating geminivirus vectors is extremely rare or even absent (LAUFS et al. 1990 Down; MCELROY et al. 1997 Down; WIRTZ et al. 1997 Down). In contrast, in petunia and other dicots like N. plumbaginifolia, tobacco and parsley Ds element excision from simple plasmids that supposedly do not replicate in plant cells is readily detectable (HOUBA-HERIN et al. 1990 Down, HOUBA-HERIN et al. 1994 Down; R. KUNZE, unpublished results). What accounts for this difference between monocots and dicots? Different molecular mechanisms could be involved:

  1. In monocots, but not in dicots (this work), extrachromosomal nonreplicating DNA is rapidly methylated, resulting in inactivation of the Ac TPase promoter and interference with binding of residual TPase to the transposon ends. This scenario can be dismissed because in the monocot experiments the reporter genes used remained active for several days. However, it cannot be excluded that monocots possess a de novo methylation system that specifically acts on transposable elements. In maize, the Ac element at the wx-m9 locus is heavily C-methylated at its termini, whereas the flanking Waxy DNA is unmethylated (WANG et al. 1996 Down). Similarly, in En/Spm both active and inactive elements are extensively methylated, whereas the sequences flanking the transposon at the insertion site are not (BANKS et al. 1988 Down).

  2. It is conceivable that in monocots, but not in dicots, a transposition activator is specifically expressed during S-phase. Alternatively, monocots might contain a cell-cycle-dependent inhibitor of transposition.

Replication facilitates Ds excision in the absence of DNA methylation:
In petunia cells replication of the reporter plasmid promotes Ds excision frequency at least eightfold. As no de novo methylation of the transfected plasmid DNA was detectable, this phenomenon does not depend on DNA (de)methylation. On the one hand, the Rep protein is required for reporter plasmid replication; on the other hand, it is known to be severely toxic for prokaryotic and eukaryotic cells (B. GRONENBORN, personal communication). This might explain the observation that only a fraction of the TYLCV-containing plasmids has replicated after 30 hr, indicated by the low amplification factor of 1.3. We therefore speculate that this toxicity is a limiting factor for plasmid replication and that without this effect the boost in Ds excision frequency would be even more pronounced.

At present we can only speculate about the molecular mechanism underlying the transposition activation by replication. The fact that a mutation in the Rep binding site (IR) abolishes the transposition boost excludes the possibilities of a stimulation by direct interaction of the replicase with the Ac TPase (because a Rep/TPase interaction should not be affected) and of an activation of a host cell accessory factor by Rep. It is conceivable that the access of the TPase to its binding sites is facilitated by the conformational change of the transposon ends in the replication fork and/or by the interaction with replication-specific components. However, such an effect cannot account for the different activation factors in monocots and dicots.

Transposon footprints are influenced by replication:
Replication not only promotes Ds excision from extrachromosomal vectors, but apparently also affects the formation of the transposon footprints. With and without replication the same two footprints dominate; however, the frequency of aberrant footprints is higher in the absence of replication. This indicates that replication has no influence on the mechanism but rather on the fidelity of the reactions leading to the formation of the predominant footprints. The predominant footprint we obtained is characterized by transversion of the nucleotides immediately flanking the Ds on both sides. The same type of footprint also dominates after Ac or Ds excision in maize and transgenic Arabidopsis plants (SCOTT et al. 1996 Down; RINEHART et al. 1997 Down) and from geminivirus vectors in maize, wheat, rice, and barley protoplasts (LAUFS et al. 1990 Down; SHEN et al. 1992 Down; SUGIMOTO et al. 1994 Down; MCELROY et al. 1997 Down). As has been pointed out by SCOTT et al. 1996 Down and RINEHART et al. 1997 Down, these footprints can be explained likewise by a modified "exonuclease" model (SAEDLER and NEVERS 1985 Down) or a "hairpin-intermediate" model (COEN et al. 1989 Down). Recently it was demonstrated that Ac/Ds elements can transpose in yeast (WEIL and KUNZE 2000 Down). The Ds excision footprints in that system differ from those in plants by the presence of palindromic duplications of the flanking host sequence centered around the 3'-terminal base of the Ds element. These footprints clearly indicate that in yeast Ds excision follows the hairpin-intermediate model. Indirect support for this mechanism also acting in plants was obtained by the study of extrachromosomal Ac/Ds elements (GORBUNOVA and LEVY 2000 Down). Therefore, because it appears unlikely that Ac/Ds elements excise with alternate mechanisms in different environments, we assume that the Ac/Ds excision reaction in plants also follows the hairpin-intermediate pathway. The hairpin model has also been employed to explain the footprints generated by the transposons Tam3 from Antirrhinum (COEN et al. 1989 Down), hobo from Drosophila (ATKINSON et al. 1993 Down), Ascot from Ascobulus (COLOT et al. 1998 Down), Tn10 from E. coli (KENNEDY et al. 1998 Down), and the coding end joints generated during V(D)J recombination (ROTH et al. 1992 Down; VAN GENT et al. 1996 Down).

C-methylation of Ac/Ds elements is responsible for the chromatid selectivity of transposition:
The model for the chromatid selectivity of Ac/Ds transposition suggested by Wang and coworkers rests on the assumption that holomethylated elements do not transpose because TPase cannot bind to their ends. In addition, it predicts that, following replication, only one of the two daughter transposons is transposition competent (WANG et al. 1996 Down; WANG and KUNZE 1998 Down). As these hypotheses cannot be scrutinized in transgenic plants, we determined the transpositional activities of fully methylated and hemi-methylated Ds elements in the presence or absence of replication in transfected petunia protoplasts and the TPase binding affinities for these differentially methylated target DNAs. Our results conclusively explain the phenomenon of chromatid selectivity of Ac/Ds transposition and verify the proposed model in all aspects:

  • A fully methylated Ds element is transposition incompetent and not recognized by the TPase protein.

  • By replication of a holomethylated Ds two differentially hemi-methylated daughter elements are generated, and in our assay one of these is 6.3-fold more active than the other. The hyperactive Ds is methylated on the top strand and thus most TPase binding sites, including the ones closest to the terminal inverted repeats, can be efficiently bound by the TPase.

It is unclear whether the 6.3-fold difference in transposition activity between the two daughter elements in the petunia system truly reflects the situation of an element in the maize genome. The plasmid vectors supposedly differ in topology and association with proteins from the chromosomal chromatin structure. Also, in the synthetically methylated Ds elements all cytosines are modified to the same extent, whereas the Ac9 element in maize and its epigenetically inactivated derivative Ds-cy display distinct methylation patterns with an uneven distribution of 5mC residues (WANG et al. 1996 Down; WANG and KUNZE 1998 Down).


*  ACKNOWLEDGMENTS

We thank Bruno Gronenborn (CNRS, Gif sur Yvette, France) for the TYLCV plasmid and helpful discussions, and Ruth Adolphs for help with the mobility shift assays. This work was supported by Deutsche Forschungsgemeinschaft through a Heisenberg fellowship to R.K. and SFB 190.

Manuscript received October 23, 2000; Accepted for publication January 4, 2001.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ATKINSON, P. W., W. D. WARREN, and D. A. O'BROCHTA, 1993  The hobo transposable element of Drosophila can be cross-mobilized in houseflies and excises like the Ac element of maize. Proc. Natl. Acad. Sci. USA 90:9693-9697[Abstract/Free Full Text].

BANKS, J. A., P. MASSON, and N. FEDOROFF, 1988  Molecular mechanisms in the developmental regulation of the maize Suppressor-mutator transposable element. Genes Dev. 2:1364-1380[Abstract/Free Full Text].

BECKER, H.-A. and R. KUNZE, 1997  Maize Activator transposase has a bipartite DNA binding domain that recognizes subterminal motifs and the terminal inverted repeats. Mol. Gen. Genet. 254:219-230[Medline].

BECKER, D., R. LÜTTICKE, M.-G. LI, and P. STARLINGER, 1992  Control of excision frequency of maize transposable element Ds in Petunia protoplasts. Proc. Natl. Acad. Sci. USA 89:5552-5556[Abstract/Free Full Text].

CALVI, B. R., T. J. HONG, S. D. FINDLEY, and W. M. GELBART, 1991  Evidence for a common evolutionary origin of inverted repeat transposons in Drosophila and plants: hobo, Activator and Tam3. Cell 66:465-471[Medline].

CHATTERJEE, S. and P. STARLINGER, 1995  The role of subterminal sites of transposable element Ds of Zea mays in excision. Mol. Gen. Genet. 249:281-288[Medline].

CHEN, J., I. M. GREENBLATT, and S. L. DELLAPORTA, 1987  Transposition of Ac from the P locus of maize into unreplicated chromosomal sites. Genetics 117:109-116[Abstract/Free Full Text].

CHEN, J., I. M. GREENBLATT, and S. L. DELLAPORTA, 1992  Molecular analysis of Ac transposition and DNA replication. Genetics 130:665-676[Abstract].

COEN, E. S., T. P. ROBBINS, J. ALMEIDA, A. HUDSON and R. CARPENTER, 1989 Consequences and mechanism of transposition in Antirrhinum majus, pp. 413–436 in Mobile Genetic Elements, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington DC.

COLOT, V., V. HAEDENS, and J.-L. ROSSIGNOL, 1998  Extensive, nonrandom diversity of excision footprints generated by Ds-like transposon Ascot-1 suggests new parallels with V(D)J recombination. Mol. Cell. Biol. 18:4337-4346[Abstract/Free Full Text].

ESSERS, L., R. ADOLPHS, and R. KUNZE, 2000  A highly conserved domain of the maize Activator transposase is involved in dimerization. Plant Cell 12:211-223[Abstract/Free Full Text].

FEDOROFF, N. V., 1989 Maize transposable elements, pp. 374–411 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington DC.

FELDMAR, S. and R. KUNZE, 1991  The ORFa protein, the putative transposase of maize transposable element Ac, has a basic DNA binding domain. EMBO J. 10:4003-4010[Medline].

FONTES, E. P., P. A. EAGLE, P. S. SIPE, V. A. LUCKOW, and L. HANLEY-BOWDOIN, 1994  Interaction between a geminivirus replication protein and origin DNA is essential for viral replication. J. Biol. Chem. 269:8459-8465[Abstract/Free Full Text].

GORBUNOVA, V. and A. A. LEVY, 2000  Analysis of extrachromosomal Ac/Ds transposable elements. Genetics 155:349-359[Abstract/Free Full Text].

GREENBLATT, I. M., 1984  A chromosomal replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element, Modulator, in maize. Genetics 108:471-485[Abstract/Free Full Text].

GREENBLATT, I. M. and R. A. BRINK, 1963  Transposition of Modulator in maize into divided and undivided chromosome segments. Nature 197:412-413.

HEINLEIN, M., T. BRATTIG, and R. KUNZE, 1994  In vivo aggregation of maize Activator (Ac) transposase in nuclei of maize endosperm and Petunia protoplasts. Plant J. 5:705-714[Medline].

HOUBA-HÉRIN, N., D. BECKER, A. POST, Y. LARONDELLE, and P. STARLINGER, 1990  Excision of a Ds-like maize transposable element (Ac{Delta}) in a transient assay in Petunia is enhanced by a truncated coding region of the transposable element Ac. Mol. Gen. Genet. 224:17-23[Medline].

HOUBA-HÉRIN, N., M. DOMIN, and J. PEDRON, 1994  Transposition of a Ds element from a plasmid into the plant genome in Nicotiana plumbaginifolia protoplast-derived cells. Plant J. 6:55-66[Medline].

KENNEDY, A. K., A. GUHATHAKURTA, N. KLECKNER, and D. B. HANIFORD, 1998  Tn10 transposition via a DNA hairpin intermediate. Cell 95:125-134[Medline].

KHEYR-POUR, A., M. BENDAHMANE, V. MATZEIT, G. P. ACCOTTO, and S. CRESPI et al., 1992  Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Res. 19:6763-6769[Abstract/Free Full Text].

KUNZE, R., 1996 The Activator (Ac) element of Zea mays L., pp. 161–194 in Transposable Elements, edited by H. SAEDLER and A. GIERL. Springer, Heidelberg, Germany.

KUNZE, R. and P. STARLINGER, 1989  The putative transposase of transposable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EMBO J. 8:3177-3185[Medline].

KUNZE, R., P. STARLINGER, and D. SCHWARTZ, 1988  DNA methylation of the maize transposable element Ac interferes with its transcription. Mol. Gen. Genet. 214:325-327.

KUNZE, R., U. BEHRENS, U. COURAGE-FRANZKOWIAK, S. FELDMAR, and S. KÜHN et al., 1993  Dominant transposition-deficient mutants of maize Activator (Ac) transposase. Proc. Natl. Acad. Sci. USA 90:7094-7098[Abstract/Free Full Text].

LAUFS, J., U. WIRTZ, M. KAMMANN, V. MATZEIT, and S. SCHAEFER et al., 1990  Wheat dwarf virus Ac/Ds vectors: expression and excision of transposable elements introduced into various cereals by a viral replicon. Proc. Natl. Acad. Sci. USA 87:7752-7756[Abstract/Free Full Text].

LAUFS, J., W. TRAUT, F. HEYRAUD, V. MATZEIT, and S. G. ROGERS et al., 1995  In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc. Natl. Acad. Sci. USA 92:3879-3883[Abstract/Free Full Text].

MCELROY, D., J. D. LOUWERSE, S. M. MCELROY, and P. G. LEMAUX, 1997  Development of a simple transient assay for Ac/Ds activity in cells of intact barley tissue. Plant J. 11:157-165[Medline].

NAGAR, S., T. J. PEDERSEN, K. M. CARRICK, L. HANLEY-BOWDOIN, and D. ROBERTSON, 1995  A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7:705-719[Abstract].

RINEHART, T. A., C. DEAN, and C. F. WEIL, 1997  Comparative analysis of non-random DNA repair following Ac transposon excision in maize and Arabidopsis. Plant J. 12:1419-1427[Medline].

ROBERTS, D., B. C. HOOPES, W. R. MCCLURE, and N. KLECKNER, 1985  IS10 transposition is regulated by DNA adenine methylation. Cell 43:117-130[Medline].

ROTH, D. B., J. P. MENETSKI, P. B. NAKAJIMA, M. J. BOSMA, and M. GELLERT, 1992  V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70:983-991[Medline].

SAEDLER, H. and P. NEVERS, 1985  Transposition in plants: a molecular model. EMBO J. 4:585-590[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS (Editors), 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCOTT, L., D. LAFOE, and C. F. WEIL, 1996  Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246[Abstract].

SHEN, W. H., S. DAS, and B. HOHN, 1992  Mechanism of Ds1 excision from the genome of maize streak virus. Mol. Gen. Genet. 233:388-394[Medline].

SUGIMOTO, K., Y. OTSUKI, S. SAJI, and H. HIROCHIKA, 1994  Transposition of the maize Ds element from a viral vector to the rice genome. Plant J. 5:863-871[Medline].

VAN GENT, D. C., K. MIZUUCHI, and M. GELLERT, 1996  Similarities between initiation of V(D)J recombination and retroviral integration. Science 271:1592-1594[Abstract].

WANG, L. and R. KUNZE, 1998  Transposase binding site methylation in the epigenetically inactivated Ac derivative Ds-cy. Plant J. 13:577-582[Medline].

WANG, L., M. HEINLEIN, and R. KUNZE, 1996  Methylation pattern of Activator (Ac) transposase binding sites in maize endosperm. Plant Cell 8:747-758[Abstract].

WEIL, C. F. and R. KUNZE, 2000  Transposition of maize Ac/Ds transposable elements in the yeast Saccharomyces cerevisiae. Nat. Genet. 26:187-190[Medline].

WIRTZ, U., B. OSBORNE, and B. BAKER, 1997  Ds excision from extrachromosomal geminivirus vector DNA is coupled to vector DNA replication in maize. Plant J. 11:125-135[Medline].




This article has been cited by other articles:


Home page
Plant Cell PhysiolHome page
S. Moon, K.-H. Jung, D.-e. Lee, W.-Z. Jiang, H. J. Koh, M.-H. Heu, D. S. Lee, H. S. Suh, and G. An
Identification of Active Transposon dTok, a Member of the hAT Family, in Rice
Plant Cell Physiol., November 1, 2006; 47(11): 1473 - 1483.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
X. Lin, L. Long, X. Shan, S. Zhang, S. Shen, and B. Liu
In planta mobilization of mPing and its putative autonomous element Pong in rice by hydrostatic pressurization
J. Exp. Bot., July 1, 2006; 57(10): 2313 - 2323.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S.-N. Hashida, T. Uchiyama, C. Martin, Y. Kishima, Y. Sano, and T. Mikami
The Temperature-Dependent Change in Methylation of the Antirrhinum Transposon Tam3 Is Controlled by the Activity of Its Transposase
PLANT CELL, January 1, 2006; 18(1): 104 - 118.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zhang and T. Peterson
A Segmental Deletion Series Generated by Sister-Chromatid Transposition of Ac Transposable Elements in Maize
Genetics, September 1, 2005; 171(1): 333 - 344.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y.-M. Wang, Z.-Y. Dong, Z.-J. Zhang, X.-Y. Lin, Y. Shen, D. Zhou, and B. Liu
Extensive de Novo Genomic Variation in Rice Induced by Introgression From Wild Rice (Zizania latifolia Griseb.)
Genetics, August 1, 2005; 170(4): 1945 - 1956.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
H. K. Evans, J. R. Weidman, D. O. Cowley, and R. L. Jirtle
Comparative Phylogenetic Analysis of Blcap/Nnat Reveals Eutherian-Specific Imprinted Gene
Mol. Biol. Evol., August 1, 2005; 22(8): 1740 - 1748.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
X. Shan, Z. Liu, Z. Dong, Y. Wang, Y. Chen, X. Lin, L. Long, F. Han, Y. Dong, and B. Liu
Mobilization of the Active MITE Transposons mPing and Pong in Rice by Introgression from Wild Rice (Zizania latifolia Griseb.)
Mol. Biol. Evol., April 1, 2005; 22(4): 976 - 990.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Zhang and T. Peterson
Transposition of Reversed Ac Element Ends Generates Chromosome Rearrangements in Maize
Genetics, August 1, 2004; 167(4): 1929 - 1937.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Luo and D. Preuss
Strand-biased DNA methylation associated with centromeric regions in Arabidopsis
PNAS, September 16, 2003; 100(19): 11133 - 11138.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
S.-n. Hashida, K. Kitamura, T. Mikami, and Y. Kishima
Temperature Shift Coordinately Changes the Activity and the Methylation State of Transposon Tam3 in Antirrhinum majus
Plant Physiology, July 1, 2003; 132(3): 1207 - 1216.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Kloti, X. He, I. Potrykus, T. Hohn, and J. Futterer
Tissue-specific silencing of a transgene in rice
PNAS, August 6, 2002; 99(16): 10881 - 10886.
[Abstract] [Full Text] [PDF]