- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by van Nues, R. W.
- Articles by Beggs, J. D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by van Nues, R. W.
- Articles by Beggs, J. D.
Functional Contacts With a Range of Splicing Proteins Suggest a Central Role for Brr2p in the Dynamic Control of the Order of Events in Spliceosomes of Saccharomyces cerevisiae
Rob W. van Nuesa and Jean D. Beggsaa Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR, United Kingdom
Corresponding author: Jean D. Beggs, Wellcome Trust Centre for Cell Biology, University of Edinburgh, King's Bldgs., Mayfield Rd., Edinburgh EH9 3JR, United Kingdom., jbeggs{at}ed.ac.uk (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
Mapping of functional protein interactions will help in understanding conformational rearrangements that occur within large complexes like spliceosomes. Because the U5 snRNP plays a central role in pre-mRNA splicing, we undertook exhaustive two-hybrid screening with Brr2p, Prp8p, and other U5 snRNP-associated proteins. DExH-box protein Brr2p interacted specifically with five splicing factors: Prp8p, DEAH-box protein Prp16p, U1 snRNP protein Snp1p, second-step factor Slu7p, and U4/U6.U5 tri-snRNP protein Snu66p, which is required for splicing at low temperatures. Co-immunoprecipitation experiments confirmed direct or indirect interactions of Prp16p, Prp8p, Snu66p, and Snp1p with Brr2p and led us to propose that Brr2p mediates the recruitment of Prp16p to the spliceosome. We provide evidence that the prp8-1 allele disrupts an interaction with Brr2p, and we propose that Prp8p modulates U4/U6 snRNA duplex unwinding through another interaction with Brr2p. The interactions of Brr2p with a wide range of proteins suggest a particular function for the C-terminal half, bringing forward the hypothesis that, apart from U4/U6 duplex unwinding, Brr2p promotes other RNA rearrangements, acting synergistically with other spliceosomal proteins, including the structurally related Prp2p and Prp16p. Overall, these protein interaction studies shed light on how splicing factors regulate the order of events in the large spliceosome complex.
SPLICING of RNA is the removal of introns from messenger RNA precursors (pre-mRNAs) by two successive trans-esterification reactions. It is a highly dynamic process that is catalyzed by a multi-component complex, the spliceosome. During spliceosome formation and subsequent catalysis, conformational rearrangements of RNA-RNA, protein-protein, and protein-RNA interactions occur (reviewed in ![]()
![]()
![]()
During or just after U4/U6.U5 tri-snRNP recruitment to the prespliceosome the U4/U6 base pairing is disrupted by the U5 snRNP-associated RNA unwindase Brr2p (Slt22p/Snu246p/Rss1p/Prp44p; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Upon completion of the first catalytic step, Prp16p, another RNA-dependent NTPase, joins the spliceosome, interacts with the 3' splice site (the junction between intron and exon 2), and drives further rearrangements in the spliceosome (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
After the second splicing reaction, ATP hydrolysis by Prp22p releases the mature mRNA from the spliceosome, the spliceosome dissociates, and the components are recycled. The DEAH-box protein Prp22p is structurally related to the DExH/DEAD-box proteins Prp2p, Prp16p, Prp28p, and Brr2p. RNA unwindase activity has been demonstrated in vivo and in vitro for Brr2p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
To fully understand the interactions that take place within the spliceosome all the components have to be identified and their interactions mapped. Recent purification of subcomplexes and microsequencing of the component proteins increased the number of known yeast splicing factors over those previously identified by genetics and sequence homology (e.g., ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
General procedures:
Preparation of splicing extracts, immunoprecipitation of proteins and snRNAs, Western detection, isolation of RNA, and hybridization of Northern blots with snRNA probes were as described previously (![]()
![]()
![]()
![]()
Oligonucleotides sequences are 5' to 3':
5' ACT-PCR (CGCGTTTGGAATCACTACAGGGATG), 3' ACT-PCR (GAAATTGAGATATGGTGCACGATGCAC), TNT-ACT (AAACTCGAGTAATACGACTCACTATAGGGAGCCACCATGGCTAGCTTGGGTGGTC).
Two-hybrid screens and direct analysis of two-hybrid interactions:
The two-hybrid bait vectors were pAS
(Gal4 DNA-binding domain), pBTM116 (LexA DNA-binding domain), or their derivatives with +1 or -1 frameshifts in the multiple cloning site. Prey constructs were made in pACTII-stop (Gal4 activation domain; ![]()
200, leu2
1, trp1
94, ura3
99, cir
; a kind gift of J. D. BROWN). Linearized plasmids containing both the N and C terminus of each open reading frame were cotransformed with DNA fragments bridging the gap. Successful gap repair of prp16-1 bait plasmid was scored by the growth defect at 16° for PRP16/prp16-1 strains. Full-length bait and prey fusions of Prp8p complemented prp8
strains. Stable expression of prey peptides was verified by Western blotting using 12CA5 anti-HA antibodies. Two-hybrid screens were done by mating (![]()
![]()
![]()
![]()
|
Isolation and in vivo analysis of cPrp8p mutations that affect two-hybrid interaction with Brr2p:
A pool of PCR fragments, generated under mutagenic conditions with primers 5'ACT-PCR and 3'ACT-PCR on prey plasmid E3 DNA (Fig 3A), was repaired into gapped pACTII-stop in yeast L40 cells expressing the LexABrr2p bait. After 1-hr recovery in dropout medium free of tryptophan and leucine, the transformation mixture was plated on histidine-free medium and incubated at 25°. Dot-sized colonies were replica plated onto histidine-free medium with different triaminotriazole (3AT) concentrations (incubated at 30°) or without 3AT (and incubated at 16°, 25°, 30°, and 36°). Comparison of plates yielded candidates for temperature-sensitive, 3AT-sensitive, or 3AT-resistant Brr2p interactions. Rescued prey plasmids were verified to cause the growth phenotype and their cPRP8 inserts were sequenced. Fragments with mutations responsible for the phenotype were identified after recloning into gapped E3-plasmid. Two mutations, prp8-28 (clone E3-N) and prp8-52 (clone E3-H), showed the strongest temperature sensitivity and 3AT resistance, respectively. These mutations as well as allele prp8-1 were introduced into PRP8 on either pRS315 (ARS/CEN, LEU2, a gift from D. Xu) or pJU225 (2µ; TRP1; ![]()
::HIS3; kindly provided by D. Xu). YDX2258 differs from YDX216 in mating type (MAT
) and the slt22-1 allele (![]()
::LYS2 disruption (![]()
|
|
|
Epitope tagging of genes:
Three different haploid strains were made with BRR2 placed under control of the conditional MET3 promoter that stimulates strong gene expression but is tightly repressed by methionine (![]()
), a strain that produced cMYC3-tagged Brr2p was obtained. The second strain, a JDY4 derivative, had a PMET3-controlled, HA2-tagged BRR2 gene separated from a truncated BRR2 gene (with the native promoter) by pUC18 DNA and the TRP1 gene (see Fig 2B). In the third strain Brr2p was placed under PMET3 control without a tag. In an analogous way JDY4 derivatives were obtained in which SNU66, YMR102C, or ECM5 were N-terminally tagged with a double HA-epitope.
Immunofluorescence:
Yeast cells grown to OD600 = 0.5 were fixed with 1/10 volume 37% formaldehyde for 1530 min, collected, washed with 0.1 M KPO4, pH 7.5/0.7 M sorbitol, and resuspended in 1 ml 250 µg/ml zymolyase 20.000 for 20 min at 30° to digest the cell walls. Cells were collected and resuspended in PBS/0.7 M sorbitol. Fixed cells were immobilized on microscope slides, blocked with 4% milk/0.1% Tween/PBS, and stained overnight at 4° with 3F10 anti-HA antibodies (diluted 1:200) in a humid chamber. After three washes with PBS, cells were incubated with FITC-conjugated Alexa 488 secondary antibody (Molecular Probes, Eugene, OR) for 1 hr at 20° in the dark and examined on an Axioplan2 (Zeiss) microscope attached with CCD camera (Hamamatsu, Bridgewater, NJ).
Gene disruptions and growth analysis:
In yeast strain JDY6 (diploid of JDY4 and JDY5, see above) open reading frames YMR102C, YOR308C, YNL099C, and YPL064C were entirely substituted by the HIS3 gene. Correct integration was verified by PCR analysis. Dissected tetrads from diploids with disrupted genes were analyzed at 14°, 16°, 25°, 30°, 36°, and 37° on plates with rich medium (YPDA) or complete synthetic medium lacking histidine and testing glucose, galactose, or lactate as sole carbon source. Growth of SNU66 and snu66
::HIS3 haploids (derived from the same tetrad) was monitored over time in liquid cultures. Cells collected from a preculture incubated overnight at 24° were divided in two, diluted with precooled or prewarmed liquid medium, and further incubated at either 16° or 30°. At particular time points samples of 50 OD units of cells were taken and stored at -80° before RNA was isolated from the cell pellets. Synthetic lethality between snu66
::HIS3 and slt22-1 was tested using the strain YDX22100 (MAT
, ade2-1, his3-11, leu2-3,-112, trp1-1, ura3-1, can1-100, slt22.1, kindly provided by D. Xu) that was mated to haploid snu66
::HIS3. Dissected spores were allowed to germinate at 2530° prior to testing for temperature sensitivity at 36° and cold sensitivity at 14°.
Analysis of splicing efficiency by means of an in vivo reporter assay:
Wild-type and gene-disrupted haploid transformants with either reporter plasmid pJC51 (![]()
![]()
![]()
Immunoprecipitation of in vitro-synthesized peptides:
35S-labeled peptides were produced in vitro using Promega's (Madison, WI) TNT-system and [35S]methionine (Amersham, Buckinghamshire, UK) with transcription template PCR products amplified from two-hybrid prey plasmids using primers 3'ACT-PCR and TNT-ACT. Aliquots of cMYC3-tagged BRR2 splicing extract were depleted of ATP (and thus splicing activity) by endogenous hexokinase at 24° for 20 min after adding glucose and mixed with 35S-labeled fragments and polyclonal anti-cMYC antibodies in conditions of 150 mM NaCl. After a half-hour incubation on ice protein, A-Sepharose (Sigma, St. Louis) was added and the mixtures were rotated at 4° for 2 hr. The beads were washed three times with IP buffer containing 150 mM NaCl, after which the attached proteins were eluted with loading buffer at 60°. Eluted proteins and supernates (50%) were separated on 10% SDS polyacrylamide and visualized by fluorography on Kodak Biomax MR film after fixing the gel in 10% glacial acetic acid/30% methanol.
| RESULTS |
|---|
Two-hybrid screens:
The characteristics of our exhaustive two-hybrid screens and of the proteins found as prey are presented in Fig 1 (classified according to A1, A2/A3, A4, and B prey categories; ![]()
We started with Prp18p and Slu7p as bait fusions. The Prp18p screen was highly selective, the main prey (of the A1 category) being Slu7p. Ten different Slu7p fragments (54 clones in total) share a region of overlap (residues 170249) that was sufficient for the interaction (M. ALBERS, R. W. VAN NUES and J. D. BEGGS, unpublished results; also implicated by data reported by ![]()
![]()
![]()
![]()
Screens with the full-length U5 snRNP protein Brr2p were also highly informative. Brr2p retrieved the C terminus of another U5 snRNP protein, Prp8p, in three different fusions (prey E3, E4*, and E5*), both termini of Prp16p (St13 and St510), the middle of Snu66p (Su1Su10), and almost complete Snp1p (Sp1 and Sp2; see Table 1 for details of all these prey fusions). Furthermore, there are some statistically significant interactions of Brr2p with proteins not directly implicated in splicing, such as the finding of a cyclophilin of unusual length, Ypl064p (Table 1). Mammalian cyclophilins have been described that co-localize with splicing factors (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
M; Table 1), the most abundant A1 prey were Dbi9p, Fab1p, and Pet127 (data not shown), while Prp16p was found once (clone St4; Table 1).
Full-length Prp8p as bait did not produce such obviously specific interactions (although the bait fusion protein proved to be functional by complementation of prp8
strains; data not shown). The only known splicing factor to be found as prey was the U1 snRNP protein Prp39p, of which one A2/A3 clone with the N-terminal tetratricopeptide repeat (TPR) region was found twice. As Prp8p is very large (280 kD), we also performed screens with several Prp8p fragments that have been successfully used to raise antibodies (![]()
![]()
![]()
A screen with Snu66p, isolated as one of the main prey with Brr2p, yielded the C terminus of Brr2p (clones B1 and B3; Table 1), a large fragment of Prp6p with TPR repeats (clone S1), as well as Ynl099p and Yll010p. Ynl099p is a nonessential protein (our data, see below, and ![]()
![]()
![]()
![]()
![]()
![]()
In all these experiments we screened the complete FRYL yeast genomic library (![]()
![]()
![]()
![]()
In subsequent experiments we sought evidence for the functional significance of these two-hybrid interactions through genetic analyses, localization studies, and co-immunoprecipitation experiments.
Genetic analysis of uncharacterized open reading frames:
We further analyzed five open reading frames that were uncharacterized at the time. YOR308C (SNU66), YMR102C, and ECM5 were epitope tagged by adding a double HA epitope to the N termini (MATERIALS AND METHODS) and the YOR308C, YPL064C, YMR102C, and YNL099C ORFs were disrupted by replacing the entire open reading frame with HIS3 (MATERIALS AND METHODS). Growth and localization studies allowed elucidation of gene function only in the case of YOR308C (SNU66; the second most abundant open reading frame found in our Brr2p screens). None of the other disrupted genes was essential for growth under the various conditions tested (MATERIALS AND METHODS). However, although haploid snu66
::HIS3 cells showed no apparent growth defect at 30°, they did not grow at 14° (Fig 2A) and grew only very slowly at 16°. The growth defect at 14° was specific for the disruption of SNU66 as demonstrated by complementation of the defect by full-length Snu66p or some of the Snu66 fragments fished in Brr2p screens (data not shown). Deletion of SNU66 is not synthetic lethal with the BRR2 allele slt22-1.
Nuclear localization of Brr2p and Snu66p:
To evaluate the role of YOR308C we tested the cellular localization of the gene product using strains in which the BRR2 or SNU66 gene was N terminally tagged with a double HA epitope (Fig 2B). By addition of methionine to the medium the MET3 promoter that controlled expression of tagged SNU66 (PMET3:HA2:SNU66) was effectively repressed as observed by the strong decrease of HA-specific Western signals, although cell growth was not affected (see also Fig 2C). Under these conditions PMET3:HA2:BRR2 cells stopped growing, since BRR2 is an essential gene (![]()
![]()
![]()
![]()
By indirect immunofluorescence we found that, as expected for a pre-mRNA splicing factor, tagged Brr2p localized in the nucleus (Fig 2C): the 4'6-diamidino-2-phenylindole (DAPI) staining of DNA merged with the immunostaining obtained with anti-HA primary antibodies. HA2-Snu66p displayed clear nuclear accumulation in a protein-specific manner, as upon repression of the MET3 promoter only background signals were observed (Fig 2C). The localization of Snu66p was analyzed more precisely by immunoprecipitation experiments with anti-Prp8p and anti-HA antibodies. HA2-Snu66p was present in Prp8p-containing complexes and Northern analysis of RNAs isolated from anti-HA antibody precipitates showed that U5, U4, and U6 snRNAs associated specifically with tagged Snu66p under nonsplicing conditions, whereas U1 and U2 snRNAs and U3 snoRNA did not (data not shown, but see ![]()
Snu66p is a splicing factor required for efficient splicing:
Snu66p was previously shown to copurify with U4/U6.U5 tri-snRNPs and spliceosomes (![]()
![]()
![]()
![]()
::HIS3 cells at 16° but not in wild-type SNU66 cells. Even at 30° a mild defect in splicing was observed both by Northern analysis with a probe specific for the U3 intron (Fig 2D) and by primer extension analysis (data not shown). The observation that absence of Snu66p is detrimental at low temperatures suggests a kinetic or assembly defect (![]()
We observed a comparable cold-sensitive splicing defect when we assessed splicing activity in snu66
::HIS3 cells with a sensitive ß-galactosidase assay (![]()
![]()
::HIS3 cells was only 40% of the level in wild-type SNU66 cells, and at 30° the activity in mutant cells was
60% of the wild-type level, whereas the level of expression of the intronless reporter was essentially identical in the two strains (data not shown). In similar experiments there was no significant difference in ß-galactosidase activity from the two reporters in strains with gene disruptions of YPL064C, YMR102C, or YNL099C (data not shown).
Genetic analysis of the interaction between Brr2p and cPrp8p:
Fragments longer than
700 bp are underrepresented in the FRYL library of prey plasmids (![]()
) greatly reduced the affinity for Brr2p (Fig 3A) but did not affect the stability or expression of the prey peptides as checked by Western analysis (data not shown). This suggests that the Brr2p interaction with cPrp8p is weakened by the presence of Prp8p regions implicated in 3' splice site recognition (![]()
![]()
![]()
![]()
We searched by reverse two-hybrid analysis (![]()
![]()
Full-length prp8 genes carrying these mutations were constructed for further analysis in vivo. BRR2 and slt22-1 strains that contain a chromosomal prp8
plus a plasmid-borne prp8-1, prp8-28, or prp8-52 allele were produced by a plasmid-shuffle system (kindly provided by D. Xu; MATERIALS AND METHODS). In contrast to the prp8-52 allele that behaved like wild-type PRP8, the prp8-28 allele did not support growth at elevated temperatures in BRR2 cells. At 36° these cells grew very slowly (Fig 3B, left) and at 37° they were dead. The prp8-1 allele had a more severe effect; it caused a mild growth defect in BRR2 cells at 30°, whereas the prp8-1, slt22-1 double mutant was not viable at this temperature (Fig 3B, right). The prp8-28 and prp8-52 alleles did not cause such synthetic lethality. Thus, mutations of Prp8p that affect its interaction with Brr2p caused growth defects comparable to the reduced affinity for Brr2p.
Co-immunoprecipitation experiments validate two-hybrid interactions of Brr2p with Prp16p, Snp1p, and Snu66p:
As an independent means of testing the Brr2p interactions detected in the two-hybrid screens, and to check the stability and strength of these interactions, we did co-immunoprecipitation experiments using in vitro 35S-labeled prey peptides and yeast extract containing triple cMYC-tagged Brr2p. We also tested the effects of the prp8-1, prp8-28, and prp8-52 mutations. As shown in Fig 4A, the wild-type Prp8 peptide (E3) and the one containing the prp8-52 mutation (E3-H) precipitated with cMYC3-tagged Brr2p, confirming that Brr2p and Prp8p associate, directly or indirectly. In contrast, none of the mutant peptides E3-D, E3-N, and E3
that had displayed reduced two-hybrid interaction with Brr2p was detectably co-immunoprecipitated with Brr2p. These results also demonstrate the specificity of the cMYC antibodies (e.g., that they do not stick to the peptide derived from pACTII sequences that were amplified with each DNA template used for the in vitro transcription/translation reaction; see MATERIALS AND METHODS). Thus, the two-hybrid interactions accurately indicate the ability of these two splicing factors to associate (directly or indirectly).
|
Similarly, we observed specific coprecipitation of Snp1p (Sp1), Snu66p (Su2), and nPrp16p (St1, St2), cPrp16p (St10) fragments (Fig 4B and Fig C) that strongly supports the two-hybrid results. In contrast, the weakly interacting, but frequently found, Ypl064p prey fusions did not coprecipitate with cMYC3-Brr2p under our stringent test conditions (Fig 4B). Interestingly,
20-fold more of the 35S-labeled cPrp8 protein precipitated with cMYC3-Brr2p (fragment E3; Fig 4A) than did nSnu66p (fragment Su2; Fig 4B; note that both prey peptides contain nine methionines). Also in the two-hybrid assay we found that the interaction of Brr2p with cPrp8p appears to be stronger than with Snu66p. When abundance of prey peptides was a limiting factor for interaction (e.g., in the case of prey fusions requiring a frameshift for complete expression), the interaction of Snu66p (clones Su1* or Su6*; Table 1) with Brr2p was markedly down (i.e., lost after addition of 3AT to the medium) compared to cPrp8p (clones E4* and E5*, resistant to 20 and 5 mM 3AT, respectively; Fig 3A).
Both the N- and C-terminal fragments of Prp16p that interacted with Brr2p correspond to regions of Prp16p that have been reported to bind the spliceosome (![]()
![]()
A network of contacts between splicing proteins:
In our screens we observed interactions between Brr2p as bait and splicing factors Prp16p, Snu66p, Prp8p, or Snp1p on one hand and between Slu7p, Snu66p, or nPrp8p as bait with Brr2p on the other (Fig 1). To delineate the Brr2p portion responsible for each interaction, we tested two-hybrid interactions between all these proteins and prey peptides. Brr2p deletion variants, slt22-1p, truncated Prp16p, prp16-1p and other DEAH-box proteins, Prp22p (prey of Slu7p), and Prp2p were also included (see Fig 5A and Table 1 for definition of clones). The results of these direct two-hybrid tests (Fig 5B) not only confirmed the specificity of our two-hybrid screens but also showed two-hybrid interactions of Brr2p with Prp2p and of Prp16p with Prp22p.
|
Interestingly, a near-exhaustive screen with Prp16p as bait retrieved, as the sole prey, two different Prp22p fragments (with fusions starting at residues 390 and 647; A. COLLEY and J. D. BEGGS, unpublished results), which limits the Prp16p-interacting region to Prp22p residues 647806. Note that the termini of Prp16p (e.g., St1p or St6p as prey) interact with Brr2p but not with Prp22p, whereas deletion of the internal GKT-DEAH region from Prp16p (bait 16
M) reduced the Prp22p interaction but did not affect the contact with Brr2p. Similarly, the prp16-1 allele (Y386D), located within the DEAH-box region, affected the interaction with Brr2p only slightly at 30° (more so at 14°) but made the interaction with Prp22p temperature sensitive (as the interaction of Prp16p with clone Tt2 at 36° was disrupted by prp16-1). Thus, the interactions of Prp16p with Brr2p and with Prp22p appear to be independent.
In contrast to Prp16p that interacted through either terminus with Brr2p, PRP2 clone T1 (the C-terminal half, starting at amino acid 460) did not interact, whereas full-length Prp2p interacted with Brr2p. The failure to retrieve Prp2p in Brr2p screens may therefore be explained by a lack of sufficiently long inserts in the FRYL yeast genomic library (![]()
The C terminus of Brr2p is a protein interaction domain, but is not sufficient for cPrp8p interaction:
Deletion analysis of Brr2p showed that the C-terminal Brr2p region with the second helicase-like domain was responsible for most Brr2 interactions. Prp2p, nPrp8p, Prp16p, Snu66p, and Slu7p appear to interact differently with the C-terminal Brr2p fragments pulled out in two-hybrid screens (clones B1, B2, and B3). The region that is common to these Brr2p fragments (clone B123) was not sufficient for these interactions, whereas the extreme C terminus by itself interacts strongly with Prp2p, Prp16p, and Snp1p (compare Brr2 clones wild type,
M, and C with clone
C as bait fusions, and compare Brr2 clones wild type,
N, and
N
M with
M
C as prey fusions). In contrast, the interaction with the C-terminal region (clone C or E3) of Prp8p requires the M region of Brr2p (compare Brr2 clones wild type and
N with clone
N
M as prey fusions and compare Brr2 clone wild type with clone
M as bait fusions). Thus, as for the strength of the interaction (as concluded from the co-immunoprecipitation experiments), the Brr2p region responsible for the interactions with Prp2p, Prp16p, Snp1p, and Snu66p also differs from that responsible for cPrp8p.
Note, in particular, that full-length Prp8p did not show any interactions but that its N terminus and C terminus interacted in a mutually exclusive way with Brr2p: cPrp8p does not interact with truncated Brr2p baits lacking the first helicase domain (i.e., all
M variants). In contrast, nPrp8p, like full-length Slu7p, interacted only with such truncated Brr2p fragments (the proline repeats in the extreme N terminus of Prp8p are not required for this interaction). This suggests that different regions of Brr2p interact with the Prp8p termini and also that in spliceosomes particular conformations of either protein might be required for their association. As a summary, the network of splicing protein associations emerging from our protein interaction studies is shown in Fig 5C, indicating how these relate to kinetic events in spliceosome assembly and function.
| DISCUSSION |
|---|
The data presented in this article provide strong evidence for functional interactions between Brr2p (Slt22p/Snu246p/Rss1p/Prp44p) and the splicing factors Prp8p, Prp16p, Snp1p, and Snu66p. Furthermore, we observed other specific two-hybrid interactions that suggest functional links of Brr2p with Slu7p and Prp2p and of Prp16p with Prp22p. Intriguingly, and reminiscent of helicases involved in DNA replication, the interaction of different DExH/DEAD-box proteins might be instrumental during pre-RNA splicing for obtaining specific and optimal unwindase activities. Overall, our data will help to formulate a more accurate model of protein dynamics (and of the central role of Brr2p therein) during spliceosome assembly and subsequent activation of the first and second catalytic steps.
Apart from most Prp8p screens, all two-hybrid screens presented in this article were highly specific and sensitive according to the criteria of VIDAL and LEGRAIN (1999). We found interactions with a number of proteins that were previously found as prey of other splicing factors, thus extending the network of protein interactions, identified through two-hybrid screens, that are highly relevant for pre-mRNA splicing (![]()
![]()
Interactions of Prp8p:
Prp8p is a very large protein (280 kD, 2413 amino acids) and different regions have been shown to interact with Snu114p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Recently, genetic analyses and sequence comparisons implicated particular regions of Prp8p in recognizing the uridine tract near the 3' splice site, in controlling the fidelity of 3' splice site, selection (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Four further observations support the functional significance of the Prp8p:Brr2p interaction observed here. First, in contrast to regions more upstream, the C terminus of Prp8p implicated in Brr2p interaction is not highly conserved, and when this region of yeast Prp8p was replaced by the plant Arabidopsis thaliana counterpart the two-hybrid interaction with Brr2p was lost, and hybrid yeast/plant Prp8p proteins were not functional in vivo (J. HAMILTON, R. W. VAN NUES, J. D. BEGGS and J. W. S. BROWN, unpublished results). Second, in this region the cPrp8p mutation (prp8-28) that caused the interaction with Brr2p to be temperature sensitive (Fig 3A) also led to a conditional phenotype in vivo (Fig 3B). Third, other mutations, like prp8-52, could be isolated that increase the affinity for Brr2p and for the temperature-sensitive slt22-1p (Fig 3A) that has a mutation within the first helicase domain of Brr2p affecting ATP hydrolysis (![]()
![]()
![]()
![]()
![]()
![]()
In summary, we propose that the N- and C-terminal regions of Prp8p have distinct interactions that are likely to contribute to the regulation of Brr2p. On the one hand, interaction of nPrp8p with the C terminus of Brr2p may affect the activity of Brr2p in assembling spliceosomes (unwinding the U4/U6 duplex and/or disrupting the U1/5' splice site interaction), while, on the other hand, interaction of cPrp8p with Brr2p may affect the assembly and/or stability of U5 snRNPs and/or U4/U6.U5 tri-snRNPs. The mutually exclusive nature of these interactions in the two-hybrid assay suggests that Prp8p undergoes conformational rearrangements that could modify the function of Brr2p (and likely other splicing factors also) in the spliceosome.
Interactions of Brr2p:
In contrast to Prp8p, screens with the comparably long Brr2p (246 kD; 2163 amino acids) worked well and yielded enough information to delineate interaction domains of Prp8p (as discussed above), Prp16p, and Snu66p. Brr2p, in turn, was fished in screens with nPrp8p (see above), Slu7p, and Snu66p as bait (Fig 1 and Table 1). Apart from interactions with splicing factors, the screens with Brr2p also suggested contacts with proteins involved in other cellular processes such as signal transduction (Fab1p, Cdc25p), cell division (Dbi9p), or gene transcription (Met28p). Although beyond the scope of this article, further analysis of these links might provide insight into the relation between the regulation of the pre-mRNA splicing machinery and that of other cellular events.
Specific association of RNA unwindases:
Among the most interesting outcomes of our analyses are the interactions between RNA unwindases; Brr2p with Prp16p and Prp2p on one hand and Prp16p with Prp22p on the other. Because we tested all these proteins against each other using either full-length or truncated forms, we can exclude that these interactions are due to a general stickiness of the conserved helicase domains or that ATP or RNA molecules specifically mediate these interactions (Fig 5 and data not shown). The statistically most relevant two-hybrid interaction of this kind was observed between Brr2p and the N terminus of Prp16p. This interaction, like that between Prp22p and Prp16p (A. COLLEY and J. D. BEGGS, unpublished results), could be reproduced in vitro by co-immunoprecipitation assays under nonsplicing conditions. We were able to pull down Brr2p with nPrp16p without detectable coprecipitation of snRNAs, indicating that no spliceosomal complexes were present and suggesting a direct physical interaction. Both ends of Prp16p that were pulled out as A1 prey of Brr2p are involved in recruitment of Prp16p to the spliceosome (![]()
![]()
![]()
The interactions between the four DExH box proteins Brr2p, Prp2p, Prp16p, and Prp22p suggest that during pre-mRNA splicing associations of different unwindases occur, which might be important for their functionality. Interestingly, another DExH-box protein, NS3h from the hepatitis C virus, is active as an (unstable) oligomer (![]()
![]()
![]()
![]()
Does the C-terminal helicase-like domain regulate Brr2p function through protein interactions?
Our deletion analysis to delineate the protein-binding regions of Brr2p showed that the interaction with the C terminus of Prp8p required the presence of the first helicase domain of Brr2p. In contrast, for all the other interactio




