help button home button Genetics AJP: Renal Phys
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Janoo, R. T. K.
Right arrow Articles by Hoffman, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Janoo, R. T. K.
Right arrow Articles by Hoffman, C. S.
Genetics, Vol. 157, 1205-1215, March 2001, Copyright © 2001

Transcriptional Regulators of the Schizosaccharomyces pombe fbp1 Gene Include Two Redundant Tup1p-like Corepressors and the CCAAT Binding Factor Activation Complex

Rozmin T. K. Janooa, Lori A. Neely1,a, Burkhard R. Braunb, Simon K. Whitehallc, and Charles S. Hoffmana
a Biology Department, Boston College, Chestnut Hill, Massachusetts 02467,
b Department of Microbiology and Immunology, University of California, San Francisco, California 94143
c School of Biochemistry and Genetics, University of Newcastle-upon-Tyne, Newcastle NE2 4HH, United Kingdom

Corresponding author: Charles S. Hoffman, Department of Biology, Boston College, Higgins Hall 401B, Chestnut Hill, MA 02467., hoffmacs{at}bc.edu (E-mail)

Communicating editor: P. RUSSELL


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Schizosaccharomyces pombe fbp1 gene, which encodes fructose-1,6-bis-phosphatase, is transcriptionally repressed by glucose through the activation of the cAMP-dependent protein kinase A (PKA) and transcriptionally activated by glucose starvation through the activation of a mitogen-activated protein kinase (MAPK). To identify transcriptional regulators acting downstream from or in parallel to PKA, we screened an adh-driven cDNA plasmid library for genes that increase fbp1 transcription in a strain with elevated PKA activity. Two such clones express amino-terminally truncated forms of the S. pombe tup12 protein that resembles the Saccharomyces cerevisiae Tup1p global corepressor. These clones appear to act as dominant negative alleles. Deletion of both tup12 and the closely related tup11 gene causes a 100-fold increase in fbp1-lacZ expression, indicating that tup11 and tup12 are redundant negative regulators of fbp1 transcription. In strains lacking tup11 and tup12, the atf1-pcr1 transcriptional activator continues to play a central role in fbp1-lacZ expression; however, spc1 MAPK phosphorylation of atf1 is no longer essential for its activation. We discuss possible models for the role of tup11- and tup12-mediated repression with respect to signaling from the MAPK and PKA pathways. A third clone identified in our screen expresses the php5 protein subunit of the CCAAT-binding factor (CBF). Deletion of php5 reduces fbp1 expression under both repressed and derepressed conditions. The CBF appears to act in parallel to atf1-pcr1, although it is unclear whether or not CBF activity is regulated by PKA.


TRANSCRIPTIONAL regulation is an important mechanism utilized by cells to control gene expression. In eukaryotes, transcription is regulated by activators and repressors that bind regulatory elements in the DNA as well as coactivators and corepressors that associate with the DNA-binding proteins (STRUHL 1995 Down; PTASHNE and GANN 1997 Down; MANNERVIK et al. 1999 Down). These complexes may affect the recruitment of RNA polymerase to a promoter through direct interactions with RNA polymerase and/or its associated protein complexes, or alter the chromatin encompassing the regulatory elements to change the affinity of DNA-binding proteins for these elements.

The Schizosaccharomyces pombe fbp1 gene encodes fructose-1,6-bis-phosphatase and is transcriptionally regulated by environmental glucose (VASSAROTTI and FRIESEN 1985 Down; HOFFMAN and WINSTON 1989 Down, HOFFMAN and WINSTON 1990 Down). Various genetic screens have shown that two signaling pathways regulate fbp1 transcription. Glucose triggers the activation of adenylate cyclase, which in turn activates protein kinase A (PKA) to repress fbp1 transcription (HOFFMAN and WINSTON 1991 Down; BYRNE and HOFFMAN 1993 Down; JIN et al. 1995 Down). Glucose starvation stimulates a stress-activated, mitogen-activated protein kinase (MAPK) pathway, leading to the derepression of fbp1 transcription (TAKEDA et al. 1995 Down; KANOH et al. 1996 Down; STETTLER et al. 1996 Down). Major components of this pathway include the spc1/sty1 MAPK (MILLAR et al. 1995 Down; SHIOZAKI and RUSSELL 1995 Down, SHIOZAKI and RUSSELL 1996 Down; DEGOLS et al. 1996 Down; WILKINSON et al. 1996 Down), the wis1 MAPK kinase (MAPKK; WARBRICK and FANTES 1991 Down), and wis4/wik1/wak1 and win1 MAPKK kinases (MAPKKK; SAMEJIMA et al. 1997 Down, SAMEJIMA et al. 1998 Down; SHIEH et al. 1997 Down; SHIOZAKI et al. 1997 Down). The downstream target of the spc1 MAPK is atf1/gad7 (TAKEDA et al. 1995 Down; KANOH et al. 1996 Down; SHIOZAKI and RUSSELL 1996 Down; WILKINSON et al. 1996 Down), a bZIP phosphoprotein that forms a heterodimer with the pcr1 bZIP protein (WATANABE and YAMAMOTO 1996 Down). Transcriptional activation by atf1-pcr1 depends upon phosphorylation by the spc1 MAPK, although the role of this phosphorylation is controversial. Several studies have concluded that atf1 is constitutively bound to sequences resembling cAMP response elements (CRE; HAI et al. 1988 Down; ROESLER et al. 1988 Down) and that the phosphorylation of atf1 allows it to activate transcription (TAKEDA et al. 1995 Down; WILKINSON et al. 1996 Down; DEGOLS and RUSSELL 1997 Down). On the other hand, two recent studies suggest that spc1 phosphorylation of atf1 increases atf1-pcr1 (also known as mts1-mts2) binding affinity for CRE-like elements (KON et al. 1998 Down; NEELY and HOFFMAN 2000 Down).

We previously identified two cis-acting elements in the fbp1 promoter necessary for fbp1 transcriptional activation (NEELY and HOFFMAN 2000 Down). UAS1 contains a CRE-like element and is the binding site for atf1-pcr1. Mobility shift data suggest that binding of atf1-pcr1 to UAS1 is stimulated by glucose starvation and is dependent upon the spc1 MAPK pathway, while PKA inhibits this binding. UAS2 resembles the Saccharomyces cerevisiae stress response element (STRE) that is bound by transcriptional activators Msn2p and Msn4p (MARTINEZ-PASTOR et al. 1996 Down; SCHMITT and MCENTEE 1996 Down). The UAS2 sequence also resembles the binding site for the zinc finger glucose repressors Mig1p, Mig2p, and Nrg1p (LUTFIYYA and JOHNSTON 1996 Down; LUTFIYYA et al. 1998 Down; WU and TRUMBLY 1998 Down; PARK et al. 1999 Down). Both PKA and MAPK pathways regulate UAS2-binding activities; however, atf1 is not present in the UAS2-specific protein-DNA complexes (NEELY and HOFFMAN 2000 Down). Thus, the MAPK and PKA pathways regulate fbp1 transcription at both UAS1 and UAS2, but these interactions involve different mechanisms at each site.

Here, we describe a screen designed to identify downstream targets of PKA by selecting for genes that, when overexpressed, partially suppress the loss of fbp1 derepression due to high PKA activity in a strain carrying a mutation in the PKA regulatory subunit gene cgs1. This screen led to the identification of a pair of redundant corepressors of fbp1 transcription, tup11 and tup12, that resemble the S. cerevisiae Tup1p global corepressor. We show that in the absence of tup11- and tup12-mediated repression, atf1 remains a key activator of fbp1 transcription, while atf1 activation by the MAPK pathway is no longer required for atf1-dependent transcriptional activation. We also present evidence that increased PKA activity represses fbp1 transcription independent of tup11- and tup12-mediated action. Finally, the screen led to the identification of the CCAAT-binding factor (CBF) as a positive regulator of fbp1 transcription, although it is unclear whether or not CBF acts directly at the fbp1 promoter or is a direct target of PKA.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and growth media:
S. pombe strains used in this study are listed in Table 1. Distinct nomenclature rules for S. cerevisiae vs. S. pombe proteins are used such that the S. cerevisiae Tup1 protein is referred to as Tup1p, while the S. pombe tup12 protein is referred to as tup12. The ura4::fbp1-lacZ allele is a disruption of the ura4 gene by a fbp1-lacZ translational fusion (HOFFMAN and WINSTON 1990 Down) and includes ~1.5 kb of sequence 5' to the fbp1 transcriptional start site. The ura4::fbp1 ({Delta}-429 to -179)-lacZ and ura4::fbp1 ({Delta}-1399 to -336)-lacZ alleles carry overlapping deletions of the fbp1 promoter driving expression of the fbp1-lacZ fusion (NEELY and HOFFMAN 2000 Down). Defined pombe medium (PM; WATANABE et al. 1988 Down) and standard rich yeast extract medium (YEL; GUTZ et al. 1974 Down) containing 8% glucose (repressing conditions), 3% glucose (standard conditions), or 0.1% glucose plus 3% glycerol (derepressing conditions) were used to culture the cells. PM media were supplemented with 75 mg/liter of required nutrients, except for leucine, which was present at 150 mg/ml. Yeast strains were grown at 30° unless indicated otherwise.


 
View this table:
[in this window]
[in a new window]

 
Table 1. Strain list

Library screen for regulators of fbp1 transcription:
Strain JSP227 (cgs1-180) was transformed to Leu+ on PM-Leu with either of two S. pombe cDNA libraries. These libraries contain size-selected cDNAs expressed from the constitutive adh promoter in vector pLEV3 that utilizes the S. cerevisiae LEU2 selectable marker, and the S. pombe adh promoter and actin terminator (H. PRENTICE and R. KINGSTON, unpublished data). (Library SPLE-1 contains ~6 x 105 clones, 67% of which carry inserts of 1 kb or more. Library SPLE-2 contains ~1.5 x 105 clones, 94% of which carry inserts of 1.6 kb or less. RNA used to make cDNA was prepared from an h- prototrophic strain grown to exponential phase in YEL medium.) Transformants were replica plated to PM-Leu medium containing 3% gluconate as the carbon source. Transformants that grew up within 5–7 days were single colony purified, grown in glucose-rich liquid medium, and assayed for ß-galactosidase activity. Plasmids from transformants expressing >= 90 units of ß-galactosidase activity were rescued into Escherichia coli (HOFFMAN and WINSTON 1987 Down). Plasmid DNA was sequenced at the Beth Israel Deaconess Medical Center Sequencing Facility (Boston) using oligonucleotide adh-forward 5' CATTGGTCTTCCGCTCCG 3' to sequence from the adh promoter into the 5' end of the cDNA.

Deletion of the tup11 and tup12 genes:
The tup11 ORF (SPAC18B11.10, accession no. Z50728) was disrupted using a PCR-based approach as described by BAHLER et al. 1998 Down. Oligonucleotides 5' KO (5' ACAAGTTTATTCTTGTACCACAATTCAAGTGTTGCTATTGTTGTAAAAGGGCGTATATCAATCGGATTCAGTTTTTGCAATAAGTCTGACGCTTAGCTACAAATCCCACT 3') and 3' KO (5' ATCAATGCGGTTAACTATTTCCGAGAGCAAATAGTTATATGTAAACAGGAACAAAAATTCAAGGAGATGCAGGGTCAATTGACCATATGGGCTCTGACATAAAACGCCTAGG 3') were used to PCR amplify a 1.6-kb ura4-containing fragment from pREP42. The amplified fragment was used to transform S. pombe strain NT5 to Ura+, creating strain SW53. Integration at the tup11+ locus, which was confirmed by PCR analysis and Southern blotting, resulted in the replacement of tup11+ sequence from -10 to +2140 relative to the tup11 start codon with the ura4+ cassette. The tup12 ORF (formerly tup1, accession no. U92792; also SPAC630.14c, accession no. AL109832) was disrupted by inserting the ura4+ gene on an SphI fragment (made blunt by Klenow fill-in) from plasmid pURA4-A (obtained from Dr. Robert Booher) into the tup12 open reading frame. The SphI fragment replaced a BglII-HpaI fragment that carried codons 179–548 on plasmid pBB306-5-1 to create plasmid pBB312-B1. A linear DNA fragment carrying the ura4 gene flanked by tup12 sequences was used to transform strain SP826 to Ura+, creating strain BSP01.

ß-Galactosidase assays:
Strains were cultured overnight under repressing conditions (8% glucose) in YEL medium. Cells were washed twice with sterile water and subcultured into YEL medium under repressing or derepressing conditions (0.1% glucose supplemented with 3% glycerol). Cultures were grown overnight to a final cell density of ~1 x 107 cells/ml. Protein lysates were prepared on ice and assayed for ß-galactosidase activity as described previously (NOCERO et al. 1994 Down).

Spot tests:
Strains were grown in YEL (3% glucose) to exponential phase, counted, washed twice with water, and adjusted to 5 x 107 cells/ml in water. A total of 0.24 ml of cells was transferred to a microtiter dish. Four fivefold serial dilutions were performed to produce samples of 0.2 ml each. These cultures were spotted to YEA (3% glucose at 30° and 37°), PM (3% glucose), YEA + 1 M KCl, YEA (3% glycerol), and YEA (3% gluconate) media using a microplate replicator.

Conjugation assay:
Cells were cultured overnight to exponential phase at 37° in YEL medium (8% glucose), diluted to 1 x 106 cells/ml in YEL (8% glucose) in the presence or absence of 5 mM cAMP, and grown overnight at 30° without shaking, before photographing.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

cDNA library screen for suppressors of a cgs1 mutant allele:
To investigate how the PKA and MAPK pathways interact to regulate fbp1 transcription, we screened for genes encoding regulatory factors that may be targets of PKA. Strain JSP227 (cgs1-180) fails to derepress fbp1 transcription and utilize gluconate as a carbon source, presumably due to PKA repression of gluconate uptake (CASPARI 1997 Down; J. STIEFEL and C. S. HOFFMAN, unpublished results). To screen for multicopy suppressors that alleviate these cgs1-180 conferred phenotypes, JSP227 was transformed to Leu+ with either of two adh-driven cDNA libraries (H. PRENTICE and R. KINGSTON, personal communication; see MATERIALS AND METHODS). Of 250,000 transformants, 118 displayed growth on a gluconate-based medium and were screened further by assaying ß-galactosidase expressed from an integrated fbp1-lacZ reporter. A total of 23 transformants expressed >90 units of ß-galactosidase activity in glucose-grown cells, as compared with ~9 units for empty vector pLEV3 transformants. Sequence analysis of these clones revealed that two express tup12, a homolog of the S. cerevisiae Tup1p corepressor protein (KELEHER et al. 1992 Down; TRUMBLY 1992 Down; MUKAI et al. 1999 Down). A third clone expresses php5, a homolog of the S. cerevisiae Hap5p CBF subunit (MCNABB et al. 1995 Down, MCNABB et al. 1997 Down).

S. pombe tup11 and tup12 are redundant negative regulators of fbp1 transcription:
While our screen was designed to identify fbp1 transcriptional activators, tup12, along with tup11, is homologous to the S. cerevisiae Tup1p global corepressor. Tup1p, tup11, and tup12 are highly conserved in the two functional domains of Tup1p, an amino-terminal Ssn6p-binding domain and a carboxy-terminal WD repeat domain (Fig 1). Deletion of tup11 or tup12 alone derepresses fbp1 transcription slightly, while deletion of both genes causes a 100-fold increase in fbp1-lacZ expression in glucose-grown cells (Table 2), demonstrating that these genes act as redundant negative regulators. While these results seem inconsistent with the multicopy effect of tup12 in increasing fbp1 transcription, both tup12-containing clones obtained in this screen lack some of the coding region for the Ssn6p-binding domain (Fig 1). The insert in ptup12a lacks 33 codons of this region, while the insert in ptup12b lacks 46 codons. We therefore presume that these truncated clones are acting as weak dominant negative alleles in our screen. Consistent with this hypothesis, transformation of a tup11{Delta} tup12{Delta} double mutant with the ptup12a plasmid has no effect (Table 3). However, the effect of ptup12a is restricted to strains that have high PKA activity due to a mutation in the cgs1 gene and low cAMP levels, either due to the deletion of the git2 adenylate cyclase gene (as was the case in the original screen) or due to growth under derepressing conditions (strain RJP25, Table 3). There is no effect of introducing ptup12a into either a wild-type strain or a strain carrying a deletion of the pka1 gene that encodes the catalytic subunit of PKA (Table 3; MAEDA et al. 1994 Down).



View larger version (85K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. The amino acid sequence alignment of the S. pombe tup11 and tup12 proteins and the S. cerevisiae Tup1p corepressor. The tup12 protein (accession no. T38992) was aligned with the tup11 (accession no. CAA90594) and Tup1p (accession no. NP_010007) proteins using the Clustal W (version 1.8) sequence alignment program (THOMPSON et al. 1994 Down) and displayed using BOXSHADE. Identical residues are boxed in black with white letters, while conserved residues are boxed in gray with black letters. The first residues of each of the truncated tup12 proteins encoded by the cDNA library plasmids ptup12a and ptup12b are indicated by arrows. The Ssn6p-protein-binding domain and WD repeats of the Tup1p protein are indicated beneath the sequence.


 
View this table:
[in this window]
[in a new window]

 
Table 2. Effects of tup11{Delta}, tup12{Delta}, and scr1{Delta} deletions on fbp1-lacZ expression


 
View this table:
[in this window]
[in a new window]

 
Table 3. ptup12a partial suppression of a cgs1 deletion

Genetic interactions between tup11 and tup12, and the MIG1-like scr1 gene:
S. cerevisiae Tup1p is brought to various promoters through interactions with DNA-binding proteins (KELEHER et al. 1992 Down; TRUMBLY 1992 Down). The most important DNA-binding partner of the Ssn6p-Tup1p corepressor with respect to glucose repression is Mig1p (NEHLIN and RONNE 1990 Down; TRUMBLY 1992 Down). The closest S. pombe homolog of Mig1p is scr1 (TANAKA et al. 1998 Down). Similar to our previous results (NEELY and HOFFMAN 2000 Down), an scr1 deletion (scr1{Delta}) increases fbp1-lacZ expression in glucose-repressed cells >10-fold (Table 2). This effect is enhanced by deletion of either tup11 or tup12. However, deletion of scr1 has no effect in a strain lacking both tup11 and tup12, suggesting that scr1 is a DNA-binding protein that brings tup11 and tup12 to the DNA, but that other proteins can carry out a similar function in the absence of scr1.

Genetic relationship between the tup genes and the PKA and MAPK pathways:
To study the genetic relationship between tup11 and tup12, and the PKA and MAPK pathways, the tup11{Delta} tup12{Delta} double deletion was combined with mutations affecting these signaling pathways that either increase or reduce fbp1 transcription. Deletion of either atf1 or pcr1, encoding subunits of the bZIP transcriptional activator that is activated by the spc1 MAPK, significantly reduces fbp1-lacZ expression (Table 4). These results are consistent with our previous data showing that the atf1-pcr1 activator directly binds one element within the fbp1 promoter (UAS1) and is indirectly required for transcriptional activation from a second element (UAS2; NEELY and HOFFMAN 2000 Down). On the other hand, fbp1-lacZ expression is only modestly reduced by a deletion of the wis1 MAPKK gene that is normally required for activation of the atf1-pcr1 heterodimer (Table 4). Since fbp1-lacZ expression in tup11+ tup12+ strains is equally strongly reduced by deletion of either wis1 or atf1 (Table 4), we infer that in the absence of the tup11 and tup12 proteins, the MAPK signaling pathway is not required to activate atf1-pcr1.


 
View this table:
[in this window]
[in a new window]

 
Table 4. Genetic interactions between the tup12{Delta} tup11{Delta} double deletion and mutations in the MAPK or PKA pathways

Since loss of PKA activity strongly derepresses fbp1 transcription, it is possible that PKA repression operates through tup11 and tup12, leading to derepression when either system is absent. The work of STETTLER et al. 1996 Down, however, shows that constitutive expression due to lack of PKA is dependent on wis1, contrary to what we see in the tup11{Delta} tup12{Delta} mutant cells (Table 4). Likewise, deletion of cgs1, encoding the PKA regulatory subunit, reduces fbp1-lacZ expression in a tup11{Delta} tup12{Delta} strain (Table 4). Thus, PKA repression does not appear to operate through the stimulation of tup11 and tup12 activity.

Other phenotypes associated with the tup11{Delta} tup12{Delta} double deletion:
Strains carrying the tup11{Delta} tup12{Delta} double deletion display other phenotypes in addition to the derepression of fbp1-lacZ expression. Similar to S. cerevisiae tup1{Delta} strains (LIPKE and HULL-PILLSBURY 1984 Down), S. pombe tup11{Delta} tup12{Delta} strains are extremely flocculent growing as large aggregates in liquid culture (data not shown). In addition, these strains grow poorly on PM defined medium. Finally, tup11{Delta} tup12{Delta} strains display an osmotic-sensitive phenotype (Fig 2), although these cells do not have the highly elongated morphology of wis1{Delta} cells grown under similar conditions (data not shown).



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Growth characteristics conferred by deletion of tup11 and tup12. Strains 972 (wild type), RJP12 (tup11{Delta} tup12{Delta}, designated tup{Delta}{Delta}), CHP720 (wis1{Delta}), and RJP33 (tup11{Delta} tup12{Delta} wis1{Delta}, designated wis1{Delta} tup{Delta}{Delta}) were scored for their growth characteristics by spot test onto various media as indicated. Cells spotted to YEA (at 30°), PM, YEA (at 37°), and YEA + 1 M KCl were photographed after 2 days growth. Cells spotted to YEA (3% glycerol) and YEA (3% gluconate) were photographed after 5 days growth.

In contrast to the effect on fbp1-lacZ expression, deletion of tup11 and tup12 does not suppress the temperature- or osmotic-sensitive growth conferred by a wis1 deletion (Fig 2). In fact, while a tup11{Delta} tup12{Delta} double deletion strain does not have an obvious effect on growth at 37°, deletion of the tup genes enhances the temperature-sensitive phenotype conferred by a wis1 deletion (Fig 2). The tup11{Delta} tup12{Delta} wis1{Delta} triple-deletion strain displays a synthetic sickness leading to extremely poor growth on YEA medium and an almost total loss of growth on defined PM medium (Fig 2). Finally, the tup11{Delta} tup12{Delta} double deletion suppresses the wis1{Delta}-conferred defect in the utilization of glycerol, but not gluconate, as a carbon source.

There is a general correlation between the control of fbp1 transcription and of conjugation and sporulation since both processes are regulated by nutrient conditions. Mutations that reduce PKA activation both inhibit glucose repression of fbp1 transcription and allow cells to mate and sporulate in nutrient-rich medium (MAEDA et al. 1990 Down, MAEDA et al. 1994 Down; ISSHIKI et al. 1992 Down; LANDRY et al. 2000 Down; WELTON and HOFFMAN 2000 Down). We therefore examined the effect of the tup11{Delta} tup12{Delta} double deletion in a homothallic h90 strain (such strains undergo mating-type switching to create mating partners within a purified culture) with respect to regulation of conjugation and sporulation. Wild-type h90 cells grow vegetatively as long as they do not receive a glucose or nitrogen starvation signal (Fig 3A and Fig B). An h90 git2{Delta} (adenylate cyclase) strain will grow vegetatively at 37° (data not shown), but will efficiently conjugate and sporulate upon shifting to 30°, even in nutrient-rich conditions (Fig 3C). This unregulated sexual development is blocked by the addition of 5 mM cAMP to the medium (Fig 3D). The h90 tup11{Delta} tup12{Delta} strain displays a unique set of phenotypes. As with the git2{Delta} strain, little or no conjugation is seen in cells grown at 37° (data not shown). Upon shifting to 30°, the h90 tup11{Delta} tup12{Delta} cells conjugate to form zygotes in the presence or absence of cAMP (Fig 3E and Fig F). However, most of these zygotes appear to be blocked in meiosis, failing to form four-spored asci. Thus, while deletion of tup11 and tup12 creates a defect in repression of both fbp1 transcription and conjugation, it is not a phenocopy of mutations that inhibit PKA activation.



View larger version (124K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Starvation-independent sexual development in a tup11{Delta} tup12{Delta} homothallic strain. Homothallic strains 968 (wild type, A and B), CHP-558 (git2{Delta}, C and D), and RJP52 (tup11{Delta} tup12{Delta}, E and F) were grown to exponential phase in YEL medium (at 37° to inhibit conjugation) and then diluted to 106 cells/ml in YEL in the absence (A, C, and E) or presence (B, D, and F) of 5 mM cAMP. These cells were incubated for 24 hr at 30° without shaking, and were then photographed.

Cloning of the CCAAT box binding factor gene php5:
A third clone identified from the cDNA library screen encodes php5, a component of the S. pombe CBF (MCNABB et al. 1997 Down). A php5 deletion decreases fbp1-lacZ expression under both repressed and derepressed conditions, although the fold regulation is not reduced (Table 5). A php2 deletion, affecting a second CBF subunit, causes a similar reduction in fbp1-lacZ expression (data not shown). The php5 deletion reduces fbp1-lacZ expression in tup11{Delta} tup12{Delta} and in pka1{Delta} strains that are defective in glucose repression (Table 5). Finally, a php5{Delta} atf1{Delta} strain is completely defective in fbp1 derepression, suggesting that atf1-pcr1 and CBF work in parallel to activate fbp1 transcription (Table 5).


 
View this table:
[in this window]
[in a new window]

 
Table 5. S. pombe php5 is important for fbp1 transcription

Effect of tup11{Delta} tup12{Delta} and php5{Delta} on fbp1 promoter derivatives:
To study whether tup11 and tup12 or CBF act at a unique site within the fbp1 promoter, we examined the effect of the tup11{Delta} tup12{Delta} double deletion and the php5{Delta} deletion on lacZ expression from a pair of fbp1 promoter variants that represent two overlapping deletions covering >1.2 kb of the fbp1 promoter (NEELY and HOFFMAN 2000 Down). The fbp1 ({Delta}-429 to -179) promoter variant lacks UAS2, but contains UAS1, which is the binding site for the atf1-pcr1 activator (NEELY and HOFFMAN 2000 Down). The fbp1 ({Delta}-1399 to -336) promoter variant lacks UAS1, but contains UAS2 that includes a site resembling both an S. cerevisiae stress response element (STRE; ESTRUCH and CARLSON 1993 Down; MARTINEZ-PASTOR et al. 1996 Down; SCHMITT and MCENTEE 1996 Down) and the binding site for the S. cerevisiae glucose repressors Mig1p, Mig2p, and Nrg1p (NEHLIN and RONNE 1990 Down; TRUMBLY 1992 Down; LUNDIN et al. 1994 Down; PARK et al. 1999 Down). Both of the fbp1-lacZ promoter derivatives are derepressed by the tup11{Delta} tup12{Delta} double deletion (Table 6), indicating that there is not a unique site of action for tup11 and tup12 within these deletion intervals (see DISCUSSION). Similarly, transcriptional derepression by glucose starvation of both constructs is reduced by the php5 deletion (Table 6), although the fold reduction is significantly greater for the UAS2-driven [fbp1 ({Delta}-1399 to -336)] promoter than for the UAS1-driven [fbp1 ({Delta}-429 to -179)] promoter. As with the tup11{Delta} tup12{Delta} data, these results suggest that the CFB does not act at a unique site within these deletion intervals, although CBF appears to be essential for UAS2-driven transcription (Table 6).


 
View this table:
[in this window]
[in a new window]

 
Table 6. Effects of tup11{Delta} tup12{Delta} and php5{Delta} deletions on fbp1 promoter variants


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Transcription of the S. pombe fbp1 gene is regulated by the activity of both a negatively acting PKA pathway that is activated by glucose and a positively acting MAPK pathway that is activated by glucose starvation (HOFFMAN and WINSTON 1990 Down, HOFFMAN and WINSTON 1991 Down; BYRNE and HOFFMAN 1993 Down; TAKEDA et al. 1995 Down; DAL SANTO et al. 1996 Down; STETTLER et al. 1996 Down). These pathways regulate transcriptional activation from at least two positively acting elements, UAS1 and UAS2, through multiple mechanisms (NEELY and HOFFMAN 2000 Down). We previously showed both direct and indirect roles for the transcriptional activator atf1-pcr1 (NEELY and HOFFMAN 2000 Down). In this study, we identify a pair of redundant negative regulators, tup11 and tup12, along with a second activation complex, CBF, that works in parallel to atf1-pcr1.

The tup11 and tup12 proteins are homologous to the S. cerevisiae Tup1p protein, a WD repeat protein involved in transcriptional repression. Tup1p is physically associated to Ssn6p/Cyc8p and this complex negatively regulates the transcription of many diversely regulated genes (WILLIAMS et al. 1991 Down; KELEHER et al. 1992 Down; TZAMARIAS and STRUHL 1994 Down). The N-terminal region of Ssn6p consists of 10 degenerate repeats of the (tetratrico peptide repeat TPR) motif (SCHULTZ et al. 1990 Down). Some of the TPR repeats interact with Tup1p while others mediate recruitment of the Tup1p-Ssn6p complex to different promoters through interactions with structurally different DNA-bound repressor proteins (TZAMARIAS and STRUHL 1995 Down; SMITH and JOHNSON 2000 Down).

Mutations in TUP1 or SSN6 cause derepression of several genes, including genes regulated by cell type (MUKAI et al. 1991 Down; KELEHER et al. 1992 Down), glucose (SCHULTZ and CARLSON 1987 Down; TRUMBLY 1992 Down), oxygen (ZITOMER and LOWRY 1992 Down), osmotic stress (MARQUEZ et al. 1998 Down; PROFT and SERRANO 1999 Down), or DNA damage (ELLEDGE et al. 1993 Down). The Tup1p-Ssn6p complex appears to work via two distinct mechanisms. It is able to bind the RNA polymerase II holoenzyme (WAHI et al. 1998 Down; PAPAMICHOS-CHRONAKIS et al. 2000 Down). Tup1p also binds monoacetylated or unacetylated histones H3 and H4 in vitro (EDMONDSON et al. 1996 Down, EDMONDSON et al. 1998 Down), forming a hairpin structure containing 10 nucleosomes encompassing the STE6 gene (DUCKER and SIMPSON 2000 Down). Thus, Tup1p-Ssn6p may initially interact with the basal transcriptional machinery to inhibit transcription. This repressed state may be maintained by Tup1p-Ssn6p binding to histones H3 and H4 to alter the chromatin structure, making these regulatory elements less accessible to transcriptional activators.

We have shown that tup11 and tup12 act as redundant regulators of fbp1 transcription (Table 2), which is similar to the observations of MUKAI et al. 1999 Down. In addition, genetic interactions between an scr1 deletion and deletions in either tup11 or tup12 suggest that scr1 acts in concert with tup11 and tup12 (Table 2). However, as the loss of scr1 is not equivalent to the combined loss of tup11 and tup12, other proteins may recruit tup11 and tup12 to the fbp1 promoter. Several S. pombe proteins contain a pair of scr1-like zinc fingers that could allow them to bind similar DNA sequences (NEELY and HOFFMAN 2000 Down). As both UAS1- and UAS2-driven fbp1 promoter derivatives are derepressed by the tup11{Delta} tup12{Delta} double deletion (Table 6), tup11 and tup12 may act through multiple sites in the fbp1 promoter. Alternatively, a unique site of tup11 and tup12 recruitment may lie outside of the deletion intervals, from base pairs -1508 to -1400 or downstream from -178.

As the loss of tup11 and tup12 derepresses fbp1 transcription, one might infer that tup11 and tup12 activity is negatively regulated by the MAPK pathway and/or positively regulated by the PKA pathway. However, such models cannot fully explain the roles of tup11, tup12, and the signaling pathways. In the absence of tup11 and tup12, the atf1 and pcr1 proteins remain key activators of fbp1 transcription (Table 4). Therefore, atf1-pcr1 is not simply a negative regulator of tup11 and tup12 activity. In addition, since an atf1 deletion causes a greater reduction in fbp1-lacZ expression than does a pcr1 deletion, atf1 appears to function, albeit less effectively, as either a homodimer or as a heterodimer with other bZIP proteins such as atf21 (SHIOZAKI and RUSSELL 1996 Down). Conversely, since fbp1-lacZ expression in a tup11{Delta} tup12{Delta} strain is reduced by PKA activation due to a cgs1 deletion (Table 4), PKA must be able to repress fbp1 transcription independently of tup11 and tup12 action. While these data demonstrate that the MAPK and PKA pathways continue to regulate fbp1 expression in the absence of tup11 and tup12, we cannot discount the possibility that one of the effects of signaling from these pathways in a wild-type cell is to regulate tup11- and tup12-mediated repression.

Surprisingly, a deletion of the wis1 MAPKK gene has little effect on fbp1-lacZ expression in a tup11{Delta} tup12{Delta} double deletion strain (Table 4). The discrepancy between the effect of an atf1 deletion and a wis1 deletion suggests that in the absence of the tup11- and tup12-mediated repression, phosphorylation of atf1 by the MAPK pathway is not required for atf1 activity. Alternatively, the MAPK pathway may regulate tup11- and tup12-mediated repression in an atf1-independent manner. While some studies indicate that atf1 binding to DNA is independent of phosphorylation (WILKINSON et al. 1996 Down; DEGOLS and RUSSELL 1997 Down), our study of fbp1 UAS1 binding in vitro suggests that phosphorylation by the MAPK pathway increases the binding while phosphorylation by the PKA pathway inhibits binding (NEELY and HOFFMAN 2000 Down). (The conclusions from these various studies do not necessarily conflict as they may represent different requirements for binding of atf-pcr1 to nonequivalent cis-acting elements.) Given the known mechanisms of Tup1p-mediated repression in S. cerevisiae, tup11 and tup12 may modify the chromatin at the fbp1 promoter such that the spc1 MAPK must phosphorylate atf1 for it to bind UAS1. Alternatively, or additionally, tup11 and tup12 could interfere with transcriptional activation by atf1-pcr1 in a manner that is sensitive to the phosphorylation state of atf1.

We have also shown here that S. pombe CBF plays an important role in fbp1 transcriptional activation. CBF is a multimeric DNA-binding complex that binds to promoter elements containing the CCAAT sequence. In S. cerevisiae, CBF contains four subunits, Hap2p, Hap3p, Hap4p, and Hap5p, that are required for the transcriptional activation of nuclear genes whose products are involved in mitochondrial functions (OLESEN et al. 1987 Down; FORSBURG and GUARENTE 1989 Down; MCNABB et al. 1995 Down). Disruption of S. pombe homologs to HAP2 and HAP5, php2 and php5, was shown to confer defects in growth on glycerol-containing medium, presumably due to a defect in respiration (OLESEN et al. 1991 Down; MCNABB et al. 1997 Down). However, reduced fbp1 expression would also contribute to a loss of glycerol utilization (Table 5).

While php5 was identified in a screen designed to identify PKA targets, it is unclear whether CBF is regulated by PKA or acts as a basal factor in fbp1 transcription. A php5 deletion reduces fbp1 transcription in cells grown in either repressed or derepressed conditions, but has little effect on the ratio of the two levels of expression (Table 5). It is also unclear whether the CBF is acting directly at the fbp1 promoter or acts indirectly by regulating expression of other transcriptional activators. We have not been able to identify a unique site of CBF action, although it appears to be essential for UAS2-driven transcription (Table 6). This result is consistent with the dramatic loss of fbp1-lacZ expression from the full-length promoter in an atf1{Delta} php5{Delta} strain (Table 5), as we have previously shown that atf1 is required for UAS1-driven transcription.

The results described here share a common theme with those of our earlier study identifying UAS1 and UAS2 of the fbp1 promoter (NEELY and HOFFMAN 2000 Down), namely that individual regulatory components play multiple roles in fbp1 transcriptional regulation. This may explain our inability to identify unique sites of action of tup11 and tup12 or of CBF within the fbp1 promoter. Such multiplicity of action may also explain the wide range over which fbp1 transcript levels vary with respect to carbon source conditions. Genes whose promoters are less intricately "wired" could be subject to regulation by the same signaling pathways and yet have transcript levels vary by only a few fold. This allows a single input signal that feeds into a finite number of signaling pathways to produce a wide range of transcriptional outputs from different genes.


*  FOOTNOTES

1 Present address: New England Biolabs, 32 Tozer Rd., Beverly, MA 01915. Back


*  ACKNOWLEDGMENTS

We thank Holly Prentice and Robert Kingston for cDNA libraries SPLE-1 and SPLE-2, along with information regarding their construction. We also thank Robert Booher, David McNabb, and Leonard Guarente for additional strains and plasmids used in these studies. This work was supported by Biotechnology and Biological Sciences Research Council grant 13/P11981 to S.K.W., by American Cancer Society postdoctoral fellowship grant PF-3879 to B.B., and by National Institutes of Health grant GM46226 to C.S.H.

Manuscript received October 4, 2000; Accepted for publication December 11, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BAHLER, J., J. Q. WU, M. S. LONGTINE, N. G. SHAH, and A. MCKENZIE, III et al., 1998  Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.. Yeast 14:943-951[Medline].

BYRNE, S. M. and C. S. HOFFMAN, 1993  Six git genes encode a glucose-induced adenylate cyclase activation pathway in the fission yeast Schizosaccharomyces pombe.. J. Cell Sci. 105:1095-1100[Abstract].

CASPARI, T., 1997  Onset of gluconate-H+ symport in Schizosaccharomyces pombe is regulated by the kinases Wis1 and Pka1, and requires the gti1+ gene product. J. Cell Sci. 110:2599-2608[Abstract].

DAL SANTO, P., B. BLANCHARD, and C. S. HOFFMAN, 1996  The Schizosaccharomyces pombe pyp1 protein tyrosine phosphatase negatively regulates nutrient monitoring pathways. J. Cell Sci. 109:1919-1925[Abstract].

DEGOLS, G. and P. RUSSELL, 1997  Discrete roles of the Spc1 kinase and the Atf1 transcription factor in the UV response of Schizosaccharomyces pombe.. Mol. Cell. Biol. 17:3356-3363[Abstract].

DEGOLS, G., K. SHIOZAKI, and P. RUSSELL, 1996  Activation and regulation of the Spc1 stress-activated protein kinase in Schizosaccharomyces pombe.. Mol. Cell. Biol. 16:2870-2877[Abstract].

DUCKER, C. E. and R. T. SIMPSON, 2000  The organized chromatin domain of the repressed yeast cell-specific gene STE6 contains two molecules of the corepressor Tup1p per nucleosome. EMBO J. 19:400-409[Medline].

EDMONDSON, D. G., M. M. SMITH, and S. Y. ROTH, 1996  Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10:1247-1259[Abstract/Free Full Text].

EDMONDSON, D. G., W. ZHANG, A. WATSON, W. XU, and J. R. BONE et al., 1998  In vivo functions of histone acetylation/deacetylation in Tup1p repression and Gcn5p activation. Cold Spring Harbor Symp. Quant. Biol. 63:459-468[Medline].

ELLEDGE, S. J., Z. ZHOU, J. B. ALLEN, and T. A. NAVAS, 1993  DNA damage and cell cycle regulation of ribonucleotide reductase. Bioessays 15:333-339[Medline].

ESTRUCH, F. and M. CARLSON, 1993  Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:3872-3881[Abstract/Free Full Text].

FORSBURG, S. L. and L. GUARENTE, 1989  Identification and characterization of HAP4: a third component of the CCAAT-bound HAP2/HAP3 heteromer. Genes Dev. 3:1166-1178[Abstract/Free Full Text].

GUTZ, H., H. HESLOT, U. LEUPOLD and N. LOPRIENO, 1974 Schizosaccharomyces pombe, pp. 395–446 in Handbook of Genetics, edited by R. C. KING. Plenum Press, New York.

HAI, T. W., F. LIU, E. A. ALLEGRETTO, M. KARIN, and M. R. GREEN, 1988  A family of immunologically related transcription factors that includes multiple forms of ATF and AP-1. Genes Dev. 2:1216-1226[Abstract/Free Full Text].

HOFFMAN, C. S. and F. WINSTON, 1987  A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli.. Gene 57:267-272[Medline].

HOFFMAN, C. S. and F. WINSTON, 1989  A transcriptionally regulated expression vector for the fission yeast Schizosaccharomyces pombe.. Gene 84:473-479[Medline].

HOFFMAN, C. S. and F. WINSTON, 1990  Isolation and characterization of mutants constitutive for expression of the fbp1 gene of Schizosaccharomyces pombe.. Genetics 124:807-816[Abstract].

HOFFMAN, C. S. and F. WINSTON, 1991  Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway. Genes Dev. 5:561-571[Abstract/Free Full Text].

ISSHIKI, T., N. MOCHIZUKI, T. MAEDA, and M. YAMAMOTO, 1992  Characterization of a fission yeast gene, gpa2, that encodes a G alpha subunit involved in the monitoring of nutrition. Genes Dev. 6:2455-2462[Abstract/Free Full Text].

JIN, M., M. FUJITA, B. M. CULLEY, E. APOLINARIO, and M. YAMAMOTO et al., 1995  sck1, a high copy number suppressor of defects in the cAMP-dependent protein kinase pathway in fission yeast, encodes a protein homologous to the Saccharomyces cerevisiae SCH9 kinase. Genetics 140:457-467[Abstract].

KANOH, J., Y. WATANABE, M. OHSUGI, Y. IINO, and M. YAMAMOTO, 1996  Schizosaccharomyces pombe gad7+ encodes a phosphoprotein with a bZIP domain, which is required for proper G1 arrest and gene expression under nitrogen starvation. Genes Cells 1:391-408[Abstract].

KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992  Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].

KON, N., S. C. SCHROEDER, M. D. KRAWCHUK, and W. P. WAHLS, 1998  Regulation of the Mts1-Mts2-dependent ade6-M26 meiotic recombination hot spot and developmental decisions by the Spc1 mitogen-activated protein kinase of fission yeast. Mol. Cell. Biol. 18:7575-7583[Abstract/Free Full Text].

LANDRY, S., M. T. PETTIT, E. APOLINARIO, and C. S. HOFFMAN, 2000  The fission yeast git5 gene encodes a G beta subunit required for glucose-triggered adenylate cyclase activation. Genetics 154:1463-1471[Abstract/Free Full Text].

LIPKE, P. N. and C. HULL-PILLSBURY, 1984  Flocculation of Saccharomyces cerevisiae tup1 mutants. J. Bacteriol. 159:797-799[Abstract/Free Full Text].

LUNDIN, M., J. O. NEHLIN, and H. RONNE, 1994  Importance of a flanking AT-rich region in target site recognition by the GC box-binding zinc finger protein MIG1. Mol. Cell. Biol. 14:1979-1985[Abstract/Free Full Text].

LUTFIYYA, L. L. and M. JOHNSTON, 1996  Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression. Mol. Cell. Biol. 16:4790-4797[Abstract].

LUTFIYYA, L. L., V. R. IYER, J. DERISI, M. J. DEVIT, and P. O. BROWN et al., 1998  Characterization of three related glucose repressors and genes they regulate in Saccharomyces cerevisiae.. Genetics 150:1377-1391[Abstract/Free Full Text].

MAEDA, T., N. MOCHIZUKI, and M. YAMAMOTO, 1990  Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 87:7814-7818[Abstract/Free Full Text].

MAEDA, T., Y. WATANABE, H. KUNITOMO, and M. YAMAMOTO, 1994  Cloning of the pka1 gene encoding the catalytic subunit of the cAMP-dependent protein kinase in Schizosaccharomyces pombe.. J. Biol. Chem. 269:9632-9637[Abstract/Free Full Text].

MANNERVIK, M., Y. NIBU, H. ZHANG, and M. LEVINE, 1999  Transcriptional coregulators in development. Science 284:606-609[Abstract/Free Full Text].

MARQUEZ, J. A., A. PASCUAL-AHUIR, M. PROFT, and R. SERRANO, 1998  The Ssn6-Tup1 repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and -independent genes. EMBO J. 17:2543-2553[Medline].

MARTINEZ-PASTOR, M. T., G. MARCHLER, C. SCHULLER, A. MARCHLER-BAUER, and H. RUIS et al., 1996  The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J. 15:2227-2235[Medline].

MCNABB, D. S., Y. XING, and L. GUARENTE, 1995  Cloning of yeast HAP5: a novel subunit of a heterotrimeric complex required for CCAAT binding. Genes Dev. 9:47-58[Abstract/Free Full Text].

MCNABB, D. S., K. A. TSENG, and L. GUARENTE, 1997  The Saccharomyces cerevisiae Hap5p homolog from fission yeast reveals two conserved domains that are essential for assembly of heterotetrameric CCAAT-binding factor. Mol. Cell. Biol. 17:7008-7018[Abstract].

MILLAR, J. B., V. BUCK, and M. G. WILKINSON, 1995  Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at division in fission yeast. Genes Dev. 9:2117-2130[Abstract/Free Full Text].

MUKAI, Y., S. HARASHIMA, and Y. OSHIMA, 1991  AAR1/TUP1 protein, with a structure similar to that of the beta subunit of G proteins, is required for a1-alpha 2 and alpha 2 repression in cell type control of Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:3773-3779[Abstract/Free Full Text].

MUKAI, Y., E. MATSUO, S. Y. ROTH, and S. HARASHIMA, 1999  Conservation of histone binding and transcriptional repressor functions in a Schizosaccharomyces pombe Tup1p homolog. Mol. Cell. Biol. 19:8461-8468[Abstract/Free Full Text].

NEELY, L. A. and C. S. HOFFMAN, 2000  Protein kinase A and mitogen-activated protein kinase pathways antagonistically regulate fission yeast fbp1 transcription by employing different modes of action at two upstream activation sites. Mol. Cell. Biol. 20:6426-6434[Abstract/Free Full Text].

NEHLIN, J. O. and H. RONNE, 1990  Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumour finger proteins. EMBO J. 9:2891-2898[Medline].

NOCERO, M., T. ISSHIKI, M. YAMAMOTO, and C. S. HOFFMAN, 1994  Glucose repression of fbp1 transcription of Schizosaccharomyces pombe is partially regulated by adenylate cyclase activation by a G protein alpha subunit encoded by gpa2 (git8). Genetics 138:39-45[Abstract].

OLESEN, J., S. HAHN, and L. GUARENTE, 1987  Yeast HAP2 and HAP3 activators both bind to the CYC1 upstream activation site, UAS2, in an interdependent manner. Cell 51:953-961[Medline].

OLESEN, J. T., J. D. FIKES, and L. GUARENTE, 1991  The Schizosaccharomyces pombe homolog of Saccharomyces cerevisiae HAP2 reveals selective and stringent conservation of the small essential core protein domain. Mol. Cell. Biol. 11:611-619[Abstract/Free Full Text].

PAPAMICHOS-CHRONAKIS, M., R. S. CONLAN, N. GOUNALAKI, T. COPF, and D. TZAMARIAS, 2000  Hrs1/Med3 is a Cyc8-Tup1 corepressor target in the RNA polymerase II holoenzyme. J. Biol. Chem. 275:8397-8403[Abstract/Free Full Text].

PARK, S. H., S. S. KOH, J. H. CHUN, H. J. HWANG, and H. S. KANG, 1999  Nrg1 is a transcriptional repressor for glucose repression of STA1 gene expression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 19:2044-2050[Abstract/Free Full Text].

PROFT, M. and R. SERRANO, 1999  Repressors and upstream repressing sequences of the stress-regulated ENA1 gene in Saccharomyces cerevisiae: bZIP protein Sko1p confers HOG-dependent osmotic regulation. Mol. Cell. Biol. 19:537-546[Abstract/Free Full Text].

PTASHNE, M. and A. GANN, 1997  Transcriptional activation by recruitment. Nature 386:569-577[Medline].

ROESLER, W. J., G. R. VANDENBARK, and R. W. HANSON, 1988  Cyclic AMP and the induction of eukaryotic gene transcription. J. Biol. Chem. 263:9063-9066[Free Full Text].

SAMEJIMA, I., S. MACKIE, and P. A. FANTES, 1997  Multiple modes of activation of the stress-responsive MAP kinase pathway in fission yeast. EMBO J. 16:6162-6170[Medline].

SAMEJIMA, I., S. MACKIE, E. WARBRICK, R. WEISMAN, and P. A. FANTES, 1998  The fission yeast mitotic regulator win1+ encodes an MAP kinase kinase kinase that phosphorylates and activates Wis1 MAP kinase kinase in response to high osmolarity. Mol. Biol. Cell 9:2325-2335[Abstract/Free Full Text].

SCHMITT, A. P. and K. MCENTEE, 1996  Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 93:5777-5782[Abstract/Free Full Text].

SCHULTZ, J. and M. CARLSON, 1987  Molecular analysis of SSN6, a gene functionally related to the SNF1 protein kinase of Saccharomyces cerevisiae.. Mol. Cell. Biol. 7:3637-3645[Abstract/Free Full Text].

SCHULTZ, J., L. MARSHALL-CARLSON, and M. CARLSON, 1990  The N-terminal TPR region is the functional domain of SSN6, a nuclear phosphoprotein of Saccharomyces cerevisiae.. Mol. Cell. Biol. 10:4744-4756[Abstract/Free Full Text].

SHIEH, J. C., M. G. WILKINSON, V. BUCK, B. A. MORGAN, and K. MAKINO et al., 1997  The Mcs4 response regulator coordinately controls the stress-activated Wak1-Wis1-Sty1 MAP kinase pathway and fission yeast cell cycle. Genes Dev. 11:1008-1022[Abstract/Free Full Text].

SHIOZAKI, K. and P. RUSSELL, 1995  Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature 378:739-743[Medline].

SHIOZAKI, K. and P. RUSSELL, 1996  Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 10:2276-2288[Abstract/Free Full Text].

SHIOZAKI, K., M. SHIOZAKI, and P. RUSSELL, 1997  Mcs4 mitotic catastrophe suppressor regulates the fission yeast cell cycle through the Wik1-Wis1-Spc1 kinase cascade. Mol. Biol. Cell 8:409-419[Abstract].

SMITH, R. L. and A. D. JOHNSON, 2000  A sequence resembling a peroxisomal targeting sequence directs the interaction between the tetratricopeptide repeats of Ssn6 and the homeodomain of alpha 2. Proc. Natl. Acad. Sci. USA 97:3901-3906[Abstract/Free Full Text].

STETTLER, S., E. WARBRICK, S. PROCHNIK, S. MACKIE, and P. FANTES, 1996  The wis1 signal transduction pathway is required for expression of cAMP-repressed genes in fission yeast. J. Cell Sci. 109:1927-1935[Abstract].

STRUHL, K., 1995  Yeast transcriptional regulatory mechanisms. Annu. Rev. Genet. 29:651-674[Medline].

TAKEDA, T., T. TODA, K. KOMINAMI, A. KOHNOSU, and M. YANAGIDA et al., 1995  Schizosaccharomyces pombe atf1+ encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J. 14:6193-6208[Medline].

TANAKA, N., N. OHUCHI, Y. MUKAI, Y. OSAKA, and Y. OHTANI et al., 1998  Isolation and characterization of an invertase and its repressor genes from Schizosaccharomyces pombe.. Biochem. Biophys. Res. Commun. 245:246-253[Medline].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

TRUMBLY, R. J., 1992  Glucose repression in the yeast Saccharomyces cerevisiae.. Mol. Microbiol. 6:15-21[Medline].

TZAMARIAS, D. and K. STRUHL, 1994  Functional dissection of the yeast Cyc8-Tup1 transcriptional co-repressor complex. Nature 369:758-761[Medline].

TZAMARIAS, D. and K. STRUHL, 1995  Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9:821-831[Abstract/Free Full Text].

VASSAROTTI, A. and J. D. FRIESEN, 1985  Isolation of the fructose-1,6-bisphosphatase gene of the yeast Schizosaccharomyces pombe. Evidence for transcriptional regulation. J. Biol. Chem. 260:6348-6353[Abstract/Free Full Text].

W